Location of motif pairs/triplets/quadruplets in each transcript within the cluster set

t=transcript number

p=position of last motif with respect to ATG for each motif

affy=affymetrix probe id

nm=refseq accession number

ug=unigene accession number

chr=chromosome

pos=chromosomal position

strand=strand

Saccharomyces Cerevisiae

1 motifs = 50 126 0 0 thresholds = 6.445 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-323-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ctcaaaacggcaaaatgtaaa
9.661
1-367-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ctcaaaacggcaaaatgtaaa
9.661
2-55-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ccctttttggtaaaacgtaaa
14.091
2-100-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ccctttttggtaaaacgtaaa
14.091
2-184-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
ccctttttggtaaaacgtaaa
14.091
5-536-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaaaaggtaaa
14.571
5-578-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaaaaggtaaa
14.571
8-503-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
tctatatgttgcccgggtagg
8.39-1
8-503-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
tctatatgttgcccgggtagg
8.391
9-224-208YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tttatatatttcctatttgag
12.531
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaaaacatcaa
11.511
10-715-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
cccaaagaggaaaaacatcaa
11.511
11-772-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
ccgaatcaggaaaaggtcaac
10.221
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
gtttgctgttaccacaaaggg
11.201
16-135-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaattgcgtaa
10.021
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaattgcgtaa
10.021
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
gtttattattccccaagagag
10.001
18-249-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
cctgtttaggaaaaaggtaaa
14.631
18-314-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
cctgtttaggaaaaaggtaaa
14.631
21-225-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
ttgacaaatttcctagttaag
8.571
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
taaagatttttcctttttggg
9.001
29-89-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcaaacaat
7.821
ctgtatgagggaaagaggaaa
8.711
29-213-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ctgtatgagggaaagaggaaa
8.711
29-213-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
cccttttgggtaacagcggac
11.701
29-213-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
cccttttgggtaacagcggac
11.701
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
cctaaagcgggaaatagtaaa
9.461

2 motifs = 70 140 0 0 thresholds = 7.941 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
tcaaaacggcaaaatgtaaaca
14.491
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
cctttttggtaaaacgtaaaca
14.761
2-189-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaagataaaca
9.521
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ccgatttggaaaaaggtaaaca
15.841
7-313-3233.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
cgaaagaggcaaaacgtaaata
14.111
9-219-209YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tgtttatatatttcctatttga
14.841
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
caaaaaaggagatttgtaaata
13.861
11-690-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
caaaaaaggagatttgtaaata
13.861
11-767-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
caaaaaaggagatttgtaaata
13.861
11-767-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaacgtcaata
8.071
cacaaagggtaaaacgtcaata
11.971
13-187-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaagtgtaaaca
11.021
ctaaaagaggaaagtgtaaaca
12.291
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tgtttatccttttccaatagcg
13.931
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctgtttaggaaaaaggtaaaca
15.591
20-96-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaaatgtaaaca
12.471
cgcataaggaaacaaggacaca
9.411
21-145-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
tgttgacaaatttcctagttaa
13.151
21-191-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
tgttgacaaatttcctagttaa
13.151
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
ctttttgggaaataagtaaaca
15.071
29-204-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ctctttgggcaagttgtaaaca
14.631
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ctctttgggcaagttgtaaaca
14.631
29-283-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ctctttgggcaagttgtaaaca
14.631
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
ctaaagcgggaaatagtaaaca
14.881

3 motifs = 50 140 0 0 thresholds = 6.445 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-323-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
tcaaaacggcaaaatgtaaaca
14.491
1-367-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
tcaaaacggcaaaatgtaaaca
14.491
2-55-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
cctttttggtaaaacgtaaaca
14.761
2-100-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
cctttttggtaaaacgtaaaca
14.761
2-184-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
cctttttggtaaaacgtaaaca
14.761
5-536-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ccgatttggaaaaaggtaaaca
15.841
5-578-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ccgatttggaaaaaggtaaaca
15.841
9-224-209YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcctatttga
14.841
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
tgtttacaaccgcccaaagagg
9.941
10-715-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
tgtttacaaccgcccaaagagg
9.941
11-772-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
caaaaaaggagatttgtaaata
13.861
11-772-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
caaaaaaggagatttgtaaata
13.861
12-184-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
cacaaagggtaaaacgtcaata
11.971
13-182-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
13-239-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
tgtttattattccccaagagag
13.061
18-249-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ctgtttaggaaaaaggtaaaca
15.591
18-314-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ctgtttaggaaaaaggtaaaca
15.591
20-79-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
cgcataaggaaacaaggacaca
9.411
21-225-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
tgttgacaaatttcctagttaa
13.151
22-252-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ctttttgggaaataagtaaaca
15.071
23-184-1691.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttcccgttttga
10.971
29-213-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ctctttgggcaagttgtaaaca
14.631
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
ctaaagcgggaaatagtaaaca
14.881

4 motifs = 50 138 0 0 thresholds = 6.445 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-55-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ccctttttggtaa
8.51-1
2-184-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
ccctttttggtaa
8.51-1
5-536-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaa
10.48-1
8-503-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaaggg
8.851
8-503-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaaggg
8.851
9-562-639YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
tatccttaatggg
8.651
10-636-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaa
10.81-1
10-715-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
cccaaagaggaaa
10.81-1
11-772-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
cccgtttaggaaa
10.12-1
11-772-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
cccgtttaggaaa
10.12-1
16-135-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaa
9.42-1
16-184-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaa
9.42-1
19-166-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
cccagaagggaaa
9.19-1
21-225-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
ttcccttttcggg
8.161
22-252-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttcctttttggg
10.941
23-837-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
ccccatgggccaa
8.11-1
29-213-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccccatccggaaa
10.33-1
29-213-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tttccggatgggg
10.33-1
29-213-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccccatccggaaa
10.331
29-213-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccccatccggaaa
10.33-1

5 motifs = 11 98 0 0 thresholds = 7.124 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ggtaaaacgtaaaca
11.721
4-647-6575.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaccttaactggtga
7.201
gacttgtctttgtcc
8.97-1
5-597-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ggaaaaaggtaaaca
12.791
7-327-2723.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
ggcaaaacgtaaata
11.821
7-327-3163.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
ggcaaaacgtaaata
11.821
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
ggaaaaacatcaaca
11.761
18-382-3222.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
ggaaaaaggtaaaca
12.791
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ggaaataagtaaaca
9.231
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gggttaattttgtcc
9.701
26-583-6504.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gggttaagtttttcc
10.04-1
30-220-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gggaaatagtaaaca
8.881
32-659-6416.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-659-6496.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

6 motifs = 108 121 0 0 thresholds = 8.604 ||8.435 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-749-8262.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatcgttggtaaagcc
11.031
tggtggcatggc
8.711
3-659-7575.116000e+03YNL172W5.001000e+03NaNNaNNaN
ctttccagtcgtcgaacgtgcc
8.811
tgctgctagggc
10.071
3-815-7575.116000e+03YNL172W5.001000e+03NaNNaNNaN
ccactccctcgtcgatgttcac
11.071
tgctgctagggc
10.071
14-665-6986.076000e+03YPL155C5.983000e+03NaNNaNNaN
gggccaagaagggttggaccgg
9.431
accttgccatca
9.14-1
19-438-3974.529000e+03YML064C4.404000e+03NaNNaNNaN
cgtggcaatcatcactccggcc
9.851
acaccggcacca
9.72-1
22-643-5463.587000e+03YJL051W3.103000e+03NaNNaNNaN
cgcttccatcttcgatgcctcc
10.061
tgttgccaaggc
9.861
23-447-4101.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggacgtttagcgacggtttag
9.071
gcattggcagca
10.33-1

7 motifs = 11 50 0 0 thresholds = 7.124 ||6.445 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-552.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaacaaa
9.371
2-119-1002.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaacaaa
9.371
2-119-1842.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ataaacaaa
8.651
4-647-7195.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaccttaactggtga
7.201
aatgtttgc
7.04-1
5-583-5363.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
5-597-5363.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
5-597-5783.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
6-589-5774.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
gtaaacatt
8.111
8-535-5034.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagggtca
10.531
ataaagaaa
6.461
10-632-7153.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
tttctttac
7.17-1
11-689-7726.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tatgtttac
8.59-1
11-703-7726.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tatgtttac
8.59-1
12-166-1845.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
tatgtttgc
7.53-1
16-204-1351.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
gtaaacatt
8.111
16-204-1841.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
gtaaacatt
8.111
18-319-2492.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
gtaaacaat
8.881
18-382-3142.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
gtaaacaat
8.881
22-271-2523.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gtaaacaat
8.881
29-277-2134.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
gtaaacaat
8.881
29-291-2134.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
gtaaacaat
8.881
30-220-2015.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gtaaacata
8.591
31-439-3826.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
gtaaacaaa
9.371
31-439-4546.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
gtaaacaaa
9.371

8 motifs = 70 126 0 0 thresholds = 7.941 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
ctcaaaacggcaaaatgtaaa
9.661
2-105-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
ccctttttggtaaaacgtaaa
14.091
2-189-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaagataaaca
9.521
ccctttttggtaaaacgtaaa
14.091
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cccgatttggaaaaaggtaaa
14.571
7-313-3243.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
ccgaaagaggcaaaacgtaaa
12.251
9-219-208YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tttatatatttcctatttgag
12.531
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
ccgaatcaggaaaaggtcaac
10.221
11-767-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
ccgaatcaggaaaaggtcaac
10.221
14-171-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tttatccttttccaatagcgg
10.981
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cctgtttaggaaaaaggtaaa
14.631
21-145-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttgacaaatttcctagttaag
8.571
21-191-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttgacaaatttcctagttaag
8.571
29-204-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ctgtatgagggaaagaggaaa
8.711
29-204-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
cccttttgggtaacagcggac
11.701
29-204-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
cccttttgggtaacagcggac
11.701
29-218-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ctgtatgagggaaagaggaaa
8.711
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cccttttgggtaacagcggac
11.701
29-218-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cccttttgggtaacagcggac
11.701
29-283-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cccttttgggtaacagcggac
11.701
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
cctaaagcgggaaatagtaaa
9.461

9 motifs = 108 129 0 0 thresholds = 8.604 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-815-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
ccactccctcgtcgatgttcac
11.071
ccattggccatcaacaata
11.96-1
4-551-6025.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggaatgtaggttgatggacatg
9.051
taactctggtgtcaactgg
10.771
14-426-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.23-1
ccactggccatcgttggtg
9.82-1
15-710-6941.368000e+03YIL106W2.938000e+03NaNNaNNaN
ggcggcacaggagatgtttcag
9.731
tttcagagaagtctactgg
10.371
22-643-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
cgcttccatcttcgatgcctcc
10.061
ccaattgtctccaaagttc
9.19-1
23-732-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
ccggatcatcttcggagttgcc
9.231
ccatgggccaaccaaagga
9.95-1

10 motifs = 3 129 0 0 thresholds = 4.837 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-327-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
ccattagactacttcgacg
9.66-1
4-274-2185.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
ccagttgccaagacctagg
9.21-1
14-496-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ccactggccatcgttggtg
9.82-1
18-618-6922.553000e+03YDR146C1.131000e+03NaNNaNNaN
gttct
4.84-1
ttcacatgctgtctagtgg
9.261
19-846-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
ccagtggacttgttaacta
9.12-1
20-620-5345.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
ttttgaaggagccacttgg
9.991
23-871-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
ccatgggccaaccaaagga
9.95-1
26-449-5024.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ccaattggcaagaaagctc
9.26-1
26-527-5024.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ccaattggcaagaaagctc
9.26-1
31-875-9026.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
ccacgggacaacccttatg
10.47-1

11 motifs = 72 117 0 0 thresholds = 8.401 ||7.961 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-327-2654.121000e+03YLR131C3.983000e+03NaNNaNNaN
gacacttttggt
10.45-1
caactccagaaagcatttagccat
8.521
2-674-7472.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcatctttggt
11.05-1
catcgccatcgttggtaaagccat
11.411
2-755-7472.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccatcgttggt
9.28-1
catcgccatcgttggtaaagccat
11.411
14-467-4286.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatcgttggt
9.28-1
tgggcaacaatgcggttggtttgg
10.601
14-866-7886.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccacctttggt
10.73-1
ttgaaggtatcggtttaggcgacg
7.981
14-866-8996.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccacctttggt
10.73-1
aggatactgaaaatggcggtgaag
9.571
17-997-9792.557000e+03YDR150W1.135000e+03NaNNaNNaN
accaacagtgac
9.401
cctcaccaacagtgacagtgtcct
11.101
22-707-7153.587000e+03YJL051W3.103000e+03NaNNaNNaN
accgaagatgcc
9.151
tgggttacaccgaagatgccgttg
11.531
23-269-3651.613000e+03YKL130C3.580000e+03NaNNaNNaN
accaaaagtgca
9.611
atgatgataatgacgatggcgatg
12.301
29-280-3524.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
cttccccctctcgagggtgcccct
10.021
29-935-9854.635000e+03YMR032W4.512000e+03NaNNaNNaN
tacaactttggg
8.52-1
ttgaagttttagaagtagcagaag
8.131

12 motifs = 58 144 0 0 thresholds = 8.547 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-597-6632.989000e+03YGL021W1.995000e+03NaNNaNNaN
gaagagataaa
8.971
gggtttggtggtgatg
10.211
10-626-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
caaaacgggcacgacc
10.80-1
12-739-6815.551000e+03YOR025W5.449000e+03NaNNaNNaN
tttcccctttg
8.83-1
ggcggtgtccattttg
11.621
21-192-1661.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ggcggtggtcgtgttg
12.871
22-262-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttt
10.37-1
caaaacgcacataccc
11.30-1
23-881-8131.613000e+03YKL130C3.580000e+03NaNNaNNaN
aaaaaaataaa
10.651
caataccaccaccccc
11.52-1

13 motifs = 3 112 0 0 thresholds = 4.837 ||9.601 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-416-3313.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
ttgattgccgaaagag
10.241
7-430-3313.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
ttgattgccgaaagag
10.241
10-78-1193.340000e+03YGR108W2.350000e+03NaNNaNNaN
agaac
4.841
ttagatcacaaaagcg
10.121
22-191-2543.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaaataa
9.84-1
22-290-2543.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaaataa
9.84-1
22-340-2543.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaaataa
9.84-1
23-291-2751.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
taacataccaaaagtg
9.911
25-639-6984.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
ctcttatggtaggaaa
11.11-1
26-449-5424.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttttgtcccaaacggg
10.081
26-527-5424.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttttgtcccaaacggg
10.081
26-527-5864.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttttgtcccaaacggg
10.081
29-374-3354.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ttttcttccagaagag
11.801
29-397-3354.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
ttttcttccagaagag
11.801
31-875-9416.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
ttagttccgacaaggg
9.931

14 motifs = 11 140 0 0 thresholds = 7.124 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tgtttatatatttcctatttga
14.841
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
tgtttacaaccgcccaaagagg
9.941
11-381-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
atacctcaagaagtaa
7.261
ggttaattttttgccaatttag
9.721
11-542-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
ggttaattttttgccaatttag
9.721
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
ctctttggggaaaagagaaata
12.921
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
11-689-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
11-703-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
cacaaagggtaaaacgtcaata
11.971
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
ctgtttaggaaaaaggtaaaca
15.591
18-382-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
ctgtttaggaaaaaggtaaaca
15.591
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ctttttgggaaataagtaaaca
15.071
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ctctttgggcaagttgtaaaca
14.631
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ctctttgggcaagttgtaaaca
14.631
29-291-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ctctttgggcaagttgtaaaca
14.631
29-313-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ctctttgggcaagttgtaaaca
14.631
32-659-6486.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

15 motifs = 50 98 0 0 thresholds = 6.445 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-323-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-323-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-367-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-367-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
2-55-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ggtaaaacgtaaaca
11.721
2-100-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ggtaaaacgtaaaca
11.721
2-184-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
ggtaaaacgtaaaca
11.721
4-719-6575.200000e+02YCL014W5.570000e+02NaNNaNNaN
aatgtttgc
7.04-1
gacttgtctttgtcc
8.97-1
5-536-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ggaaaaaggtaaaca
12.791
5-578-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ggaaaaaggtaaaca
12.791
6-577-5854.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
cgaaaaaggtaaaca
9.461
9-224-216YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcc
9.49-1
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ggaaaaacatcaaca
11.761
10-715-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
ggaaaaacatcaaca
11.761
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
ggtaaaacgtcaata
10.601
18-249-3222.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaaaaggtaaaca
12.791
18-314-3222.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaaaaggtaaaca
12.791
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaataagtaaaca
9.231
23-184-1761.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttccc
11.75-1
30-201-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gggaaatagtaaaca
8.881

16 motifs = 98 104 0 0 thresholds = 8.863 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-387-4465.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggacaaagataataa
10.661
tttttagtttatttttc
8.86-1
4-387-4555.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggacaaagataataa
10.661
tttttagtttatttttc
8.86-1
4-489-4465.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tttttagtttatttttc
8.86-1
4-489-4555.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tttttagtttatttttc
8.86-1
5-799-8953.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgcttacttttatcc
9.00-1
tactctctccattgttc
11.02-1
7-272-3693.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
gaaaaatgtgaagtgca
10.391
7-316-2713.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
gaaaaatgcaacgacaa
12.161
7-316-3693.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
gaaaaatgtgaagtgca
10.391
11-545-5056.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
gaaaaaaaatcaaaata
9.861
12-372-3005.551000e+03YOR025W5.449000e+03NaNNaNNaN
ggccaaagttcatca
10.431
ttccctgttcgtttttc
10.48-1
14-168-1256.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttttcc
9.46-1
gaaaaataaaaagaaat
9.691
21-473-3921.420000e+03YIL158W2.990000e+03NaNNaNNaN
gtgaaaaagtaaaca
9.551
gaagaaagagtacaaaa
11.131
23-176-821.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
tactcaagacatttttc
11.19-1
23-176-1901.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
ttttttttttttttttc
11.361
26-650-6914.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
ttttagtcccttttttc
11.47-1
26-766-6914.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtttactttttgac
9.68-1
ttttagtcccttttttc
11.47-1
30-514-4445.003000e+03YNL058C4.886000e+03NaNNaNNaN
tattggtattttgcc
10.77-1
ttttctgatcttttttt
10.93-1
32-649-6406.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

17 motifs = 11 58 0 0 thresholds = 7.124 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-750-7364.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
tttctcctttc
9.12-1
1-764-7364.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
tttctcctttc
9.12-1
2-119-1902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
aaaaagataaa
10.791
5-597-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaaggtaaa
10.691
6-589-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
ttttttttttt
10.91-1
11-381-2966.323000e+03YPR119W6.238000e+03NaNNaNNaN
atacctcaagaagtaa
7.261
tttattctttc
9.07-1
11-542-5096.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
gaaaagagaaa
9.811
18-382-3202.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
aaaaaggtaaa
10.691
22-271-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttttcctttt
10.37-1
24-169-1554.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
gaaaaaaaaaa
10.031
25-278-2214.074000e+03YLR084C3.935000e+03NaNNaNNaN
ttcccaaattaggcaa
8.14-1
aaaaaaagaaa
10.551
28-194-1444.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
aaagaaagaaa
9.611
29-218-1314.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
gaaagaggaaa
8.871
29-218-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
tttcccttttg
9.53-1
29-277-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
tttcccttttg
9.53-1
29-291-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
29-291-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
29-313-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
29-313-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
30-220-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
aaaaaaaaaaa
10.911
31-439-3776.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
aaaaaggtaaa
10.691
31-439-3886.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
aaaaaggtaaa
10.691
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

18 motifs = 70 80 0 0 thresholds = 7.941 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-189-2242.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaagataaaca
9.521
taaaggaaatgactaaga
10.561
9-748-733YBR038W2.730000e+02NaNNaNNaN
tgtttccaatct
7.94-1
tctgcgtttctccctgtt
9.86-1
14-171-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tctatgctgctgcccata
9.95-1
18-319-2612.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
tctttctttctccctata
11.39-1
30-206-2685.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
tctcactttctgccgatt
11.47-1

19 motifs = 112 138 0 0 thresholds = 9.601 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-585-639YBR038W2.730000e+02NaNNaNNaN
ttgactgccataagcg
10.231
tatccttaatggg
8.651
11-812-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttattccaaatgcg
11.521
cccgtttaggaaa
10.12-1
22-254-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
cctttttgggaaataa
9.84-1
tttcctttttggg
10.941
26-542-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttttgtcccaaacggg
10.081
cccaaacgggcaa
9.61-1
26-586-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttttgtcccaaacggg
10.081
ttgcccgtttggg
9.61-1
26-586-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttttgtcccaaacggg
10.081
cccaaacgggcaa
9.61-1
29-335-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttttcttccagaagag
11.801
tttccggatgggg
10.33-1
29-335-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttttcttccagaagag
11.801
ccccatccggaaa
10.331
29-335-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttttcttccagaagag
11.801
ccccatccggaaa
10.33-1

20 motifs = 11 95 0 0 thresholds = 7.124 ||9.232 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-689-6716.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ggtcaacaacgaagttc
10.56-1
11-703-6716.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ggtcaacaacgaagttc
10.56-1
14-423-4126.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
ggccatcgttggtgatg
11.01-1
14-423-4636.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
ggccatcgttggtgatg
11.01-1
27-220-1594.497000e+03YML034W4.371000e+03NaNNaNNaN
ttactgttttaggaag
8.90-1
ggacatcgatctacttg
11.16-1
29-277-3254.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
gaagagcaccgattgcc
11.111
29-291-3254.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
gaagagcaccgattgcc
11.111
29-313-3254.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
gaagagcaccgattgcc
11.111
32-659-5916.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

21 motifs = 91 108 0 0 thresholds = 9.029 ||8.604 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-858-9512.989000e+03YGL021W1.995000e+03NaNNaNNaN
gttgcagcgtggtggga
9.161
cttctccttctgttgttttgcc
11.171
4-595-5515.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggtgtcaactggatcag
9.271
ggaatgtaggttgatggacatg
9.051
14-473-4266.076000e+03YPL155C5.983000e+03NaNNaNNaN
ttggcccactggccatc
9.97-1
actggccatcgttggtgatgcc
11.23-1
14-473-4616.076000e+03YPL155C5.983000e+03NaNNaNNaN
ttggcccactggccatc
9.97-1
actggccatcgttggtgatgcc
11.231
15-687-7101.368000e+03YIL106W2.938000e+03NaNNaNNaN
ggtgccacatggtgtgg
9.991
ggcggcacaggagatgtttcag
9.731
15-755-7101.368000e+03YIL106W2.938000e+03NaNNaNNaN
ggtgccacatggtgtgg
9.991
ggcggcacaggagatgtttcag
9.731
23-796-7321.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccccccatgggccaac
11.23-1
ccggatcatcttcggagttgcc
9.231

22 motifs = 94 105 0 0 thresholds = 8.391 ||9.482 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-342-4052.989000e+03YGL021W1.995000e+03NaNNaNNaN
gatgatgcccaag
8.891
gactacttcgacgaag
10.991
3-717-8155.116000e+03YNL172W5.001000e+03NaNNaNNaN
gaaggcgccactg
9.161
cctcgtcgatgttcac
10.70-1
22-650-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.851
ggttacaccgaagatg
10.241
22-704-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.851
ggttacaccgaagatg
10.241
23-777-7321.613000e+03YKL130C3.580000e+03NaNNaNNaN
gaagctgcatacg
9.181
catcttcggagttgcc
11.02-1
29-475-4964.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtagctgccaaag
8.731
aatcgtcagagtgcac
9.87-1

23 motifs = 3 114 0 0 thresholds = 4.837 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-274-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
tcaccatcgtggtgctctttgtcat
15.031
5-894-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
tctccattgttctcgtattcttcct
13.501
11-202-1606.323000e+03YPR119W6.238000e+03NaNNaNNaN
gttct
4.84-1
tagattcttttaacgacattggaga
11.981
13-945-9146.163000e+03YPL242C6.071000e+03NaNNaNNaN
agaac
4.841
tctccaatgatatagaaaatgtatt
12.621
14-496-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ttggcccactggccatcgttggtga
12.221
17-767-8472.557000e+03YDR150W1.135000e+03NaNNaNNaN
agaac
4.841
tcaccaacgtttttagtatattcct
12.531
21-406-4941.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
atggaagtgatgaaaacgatggtga
14.641
23-291-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
acgatgatgataatgacgatggcga
12.361
29-397-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
tccccatcgagtggcagtagttctt
10.341

24 motifs = 11 70 0 0 thresholds = 7.124 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
aaaacgtaaaca
12.001
2-119-1892.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
aaaagataaaca
9.521
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaggtaaaca
12.561
7-327-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
aaaacgtaaata
9.711
11-689-7676.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tgtttacatatt
11.08-1
11-703-6906.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
aaaaggtcaaca
10.921
11-703-7676.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tgtttacatatt
11.08-1
18-382-3192.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
aaaaggtaaaca
12.561
22-271-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
aataagtaaaca
10.521
29-218-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
aagttgtaaaca
8.541
29-218-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
tatttccctttt
8.98-1
29-277-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
aagttgtaaaca
8.541
29-277-2184.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
tatttccctttt
8.98-1
29-291-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
aagttgtaaaca
8.541
29-291-2184.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttccctttt
8.98-1
29-313-2184.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttccctttt
8.98-1
29-313-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttccctttt
8.98-1
30-220-2065.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
aaatagtaaaca
10.651
31-439-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
aaaaggtaaaca
12.561

25 motifs = 11 135 0 0 thresholds = 7.124 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
cctttttggtaa
11.36-1
11-689-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgtttaggaaa
9.51-1
11-703-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgtttaggaaa
9.51-1
12-166-1805.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
ttaccacaaagg
10.611
22-271-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
cctttttgggaa
10.21-1
26-583-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cctttcgggaaa
10.33-1
29-218-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccttttgggtaa
10.95-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccttttgggtaa
10.95-1
29-313-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccttttgggtaa
10.95-1

26 motifs = 72 140 0 0 thresholds = 8.401 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-327-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gacacttttggt
10.45-1
tcaaaacggcaaaatgtaaaca
14.491
2-107-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccctttttggt
10.21-1
cctttttggtaaaacgtaaaca
14.761
10-258-2263.340000e+03YGR108W2.350000e+03NaNNaNNaN
ggcaattttggt
9.24-1
tttttacattcggccaaacttg
11.011
10-629-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
tgtttacaaccgcccaaagagg
9.941
22-260-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
ctttttgggaaataagtaaaca
15.071
29-221-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ctctttgggcaagttgtaaaca
14.631
29-280-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ctctttgggcaagttgtaaaca
14.631

27 motifs = 135 140 0 0 thresholds = 9.254 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
cctttttggtaa
11.36-1
cctttttggtaaaacgtaaaca
14.761
11-751-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgtttaggaaa
9.51-1
caaaaaaggagatttgtaaata
13.861
11-751-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgtttaggaaa
9.51-1
caaaaaaggagatttgtaaata
13.861
22-258-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
cctttttgggaa
10.21-1
ctttttgggaaataagtaaaca
15.071
26-545-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaa
10.33-1
ccaaacgggcaaaatataaata
13.831
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ctctttgggcaagttgtaaaca
14.631

28 motifs = 67 126 0 0 thresholds = 8.494 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-652-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
gcgttacccg
9.06-1
tctatatgttgcccgggtagg
8.391
12-246-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
cgggtatccc
10.091
gtttgctgttaccacaaaggg
11.201
14-215-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
cgggtagccc
9.631
tttatccttttccaatagcgg
10.981
15-264-2031.368000e+03YIL106W2.938000e+03NaNNaNNaN
cgggtatccc
10.091
cccaaaatggaaatatcaaaa
12.061
28-233-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
cgggtagcgc
8.941
ccagattaggaaagaacataa
10.751

29 motifs = 79 85 0 0 thresholds = 7.791 ||8.241 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-355-3015.116000e+03YNL172W5.001000e+03NaNNaNNaN
ctatcgggccccttcg
8.86-1
cagcctcgcagtatttcaccaat
10.231
3-355-3675.116000e+03YNL172W5.001000e+03NaNNaNNaN
ctatcgggccccttcg
8.86-1
gctcccgccccaaaagttcctat
11.351
9-816-750YBR038W2.730000e+02NaNNaNNaN
ggaagggtcccccaag
10.111
cagcctccttctgtgtttccaat
11.081
22-664-6403.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
cttccatcttcgatgcctccgct
10.361
24-48-1144.047000e+03YLR057W3.908000e+03NaNNaNNaN
gaaaaaggccgccact
8.941
acaggcaaataggaagctggaag
11.091
31-933-9056.062000e+03YPL141C5.969000e+03NaNNaNNaN
gacaagggctccgacc
8.361
gctccgaccacgggacaaccctt
8.671

30 motifs = 58 123 0 0 thresholds = 8.547 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-174-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
caaagggtaaa
8.931
tccctcaattgcgggt
9.50-1
12-293-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
tttccctcttc
8.77-1
tccctcaattgcgggt
9.50-1
17-440-3852.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttttcttttt
11.06-1
aggcctagttgaggga
10.331
18-320-4122.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaaggtaaa
10.691
tagcagcattgttgga
10.561
23-881-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
aaaaaaataaa
10.651
tccccccatgggccaa
10.20-1
28-60-1084.588000e+03YML119W4.464000e+03NaNNaNNaN
tttactctttt
9.85-1
tccctcaattgtacat
11.65-1
28-144-1084.588000e+03YML119W4.464000e+03NaNNaNNaN
aaagaaagaaa
9.611
tccctcaattgtacat
11.65-1
31-811-9106.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaaataaa
10.651
tccgaccacgggacaa
10.49-1

31 motifs = 50 143 0 0 thresholds = 6.445 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-443-3852.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcaacaaa
6.471
tacttccgaaaactg
10.101
5-338-2763.852000e+03YJR092W3.372000e+03NaNNaNNaN
acaaacaaa
7.591
cgctgcaggaaatag
10.391
6-577-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ctcctccgaaaaagg
10.351
10-406-3853.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttgt
7.59-1
ctctgcagaaacggg
8.901
10-636-6693.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cgttttcgagtaggg
9.34-1
10-715-6693.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
cgttttcgagtaggg
9.34-1
21-225-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
cgcttctcaaaaggg
11.371
25-451-5304.074000e+03YLR084C3.935000e+03NaNNaNNaN
tttggttac
6.47-1
tcctaccgaaaagcg
10.111
31-382-4416.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
cacttcctaaaaaag
10.771
31-454-4416.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
cacttcctaaaaaag
10.771

32 motifs = 2 140 0 0 thresholds = 6.900 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
tcaaaacggcaaaatgtaaaca
14.491
2-144-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
cctttttggtaaaacgtaaaca
14.761
5-620-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
ccgatttggaaaaaggtaaaca
15.841
12-210-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
cacaaagggtaaaacgtcaata
11.971
13-220-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
ctaaaagaggaaagtgtaaaca
12.291
14-230-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
taatgtcattatatgcgggtag
8.041
tgtttatccttttccaatagcg
13.931
17-192-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
taatatcgtctttgacggagat
8.831
tgtttattattccccaagagag
13.061

33 motifs = 95 131 0 0 thresholds = 9.232 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-670-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtcatctttggtggtc
9.27-1
gtcttggtcatctttggtg
10.531
11-671-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
ggtcaacaacgaagttc
10.56-1
gaaaaggtcaacaacgaag
12.341
14-412-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
gatttgggcaacaatgcgg
11.301
14-463-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
gatttgggcaacaatgcgg
11.301
29-325-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaagagcaccgattgcc
11.111
tctcgagggtgcccctttc
10.46-1
32-591-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

34 motifs = 34 111 0 0 thresholds = 5.648 ||9.158 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-161-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
cggaacaattga
5.761
gggtagcccgatgatgcggctc
11.961
22-614-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
ggttacaccgaagatgccgttg
9.871
23-750-7321.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
ccggatcatcttcggagttgcc
10.571
31-923-9086.062000e+03YPL141C5.969000e+03NaNNaNNaN
ccgaccacggga
6.421
gggctccgaccacgggacaacc
9.381
32-650-7176.360000e+03YPR156C6.278000e+03NaNNaNNaN
tcgcccaacgga
6.341
n
NaNNaN
32-690-7176.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

35 motifs = 60 65 0 0 thresholds = 9.277 ||9.209 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-41-1103.340000e+03YGR108W2.350000e+03NaNNaNNaN
catcaaaggaagctt
10.311
aaaagcgtaatt
10.111
20-222-1395.680000e+02YCL063W6.040000e+02NaNNaNNaN
acatttccgctgggg
9.80-1
aaaagagaaaaa
11.201
20-222-3015.680000e+02YCL063W6.040000e+02NaNNaNNaN
acatttccgctgggg
9.80-1
attgtccctttt
10.35-1
25-189-2654.074000e+03YLR084C3.935000e+03NaNNaNNaN
catcatcagaagtct
11.301
aattcctctttt
10.94-1
29-268-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccgaagcggaagcgt
9.901
tatttccctttt
11.24-1
32-233-2966.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
ttttccactttt
9.21-1

36 motifs = 62 98 0 0 thresholds = 8.515 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-313-3875.200000e+02YCL014W5.570000e+02NaNNaNNaN
gatcaccatc
9.11-1
ggacaaagataataa
10.661
5-870-7993.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatagtgatg
9.691
tgcttacttttatcc
9.00-1
7-394-3163.084000e+03YGL116W2.089000e+03NaNNaNNaN
cttcacttcc
8.52-1
ggcaaaacgtaaata
11.821
12-354-3725.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttc
10.18-1
ggccaaagttcatca
10.431
21-492-4731.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggaagtgatg
9.211
gtgaaaaagtaaaca
9.551

37 motifs = 108 128 0 0 thresholds = 8.604 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-985-8966.323000e+03YPR119W6.238000e+03NaNNaNNaN
cttgaccgtctactaaggtgcc
11.421
gcgagtgcattagcacagtggaa
7.921
14-426-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.23-1
ggctcctgtatctctgcaattac
8.711
14-461-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.231
ggctcctgtatctctgcaattac
8.711
19-438-3954.529000e+03YML064C4.404000e+03NaNNaNNaN
cgtggcaatcatcactccggcc
9.851
ggcggcttcacaccggcaccacc
9.651
23-447-4141.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggacgtttagcgacggtttag
9.071
gacggtttagcttctgcattggc
12.791
23-447-4951.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggacgtttagcgacggtttag
9.071
ggaagtgcaacagttggacccac
10.181
23-799-8371.613000e+03YKL130C3.580000e+03NaNNaNNaN
ccaccccctccccccatgggcc
9.121
gagacaactgcaactgcaactgc
11.791
23-799-8491.613000e+03YKL130C3.580000e+03NaNNaNNaN
ccaccccctccccccatgggcc
9.121
gagacaactgcaactgcaactgc
11.79-1
31-605-6656.062000e+03YPL141C5.969000e+03NaNNaNNaN
catatccatcttttttactccc
12.061
gcctcttcagcctatacatcagc
10.381

38 motifs = 118 138 0 0 thresholds = 9.133 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-568-639YBR038W2.730000e+02NaNNaNNaN
gttacagtaaagaatccc
10.641
tatccttaatggg
8.651
10-683-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
gggcggtttttcactacc
9.20-1
cccaaagaggaaa
10.81-1
11-647-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
cccgtttaggaaa
10.12-1
23-843-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaactgcaaacatacca
10.141
ccccatgggccaa
8.11-1
29-386-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtggcagtagttcttccc
9.561
ccccatccggaaa
10.331
29-386-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtggcagtagttcttccc
9.561
ccccatccggaaa
10.33-1

39 motifs = 128 131 0 0 thresholds = 7.918 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-549-4582.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtagatgcaagggcttctgagac
12.951
attcaatggtggccaagcc
10.28-1
3-400-3305.116000e+03YNL172W5.001000e+03NaNNaNNaN
gtcaatgcaagggctcccgcccc
11.431
gaaaaggccagcctcgcag
11.581
5-928-8873.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttgctgcagttggctattactc
8.901
ctccattgttctcgtattc
10.46-1
14-513-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggctcctgtatctctgcaattac
8.711
gatttgggcaacaatgcgg
11.301
32-693-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
ggcttcgtcactgcggcaatgtc
9.29-1
n
NaNNaN

40 motifs = 3 68 0 0 thresholds = 4.837 ||9.019 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-358-3854.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
tcaatcaccttc
10.99-1
12-339-3545.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
ttcatcaccttc
10.35-1
16-749-6961.065000e+03YHR023W2.624000e+03NaNNaNNaN
agaac
4.841
atcacctccttc
9.08-1
21-300-3481.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
gaaggagatgta
9.971
21-406-3481.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
gaaggagatgta
9.971
24-371-4204.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
gaaggtgatgat
9.661
25-639-5874.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
gaaggtgactgt
9.431
27-720-7334.497000e+03YML034W4.371000e+03NaNNaNNaN
gttct
4.84-1
gaaggagctggt
9.671
31-235-3316.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
ttcaaccccttc
9.08-1
31-397-3316.062000e+03YPL141C5.969000e+03NaNNaNNaN
agaac
4.841
ttcaaccccttc
9.08-1

41 motifs = 11 131 0 0 thresholds = 7.124 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-703-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
gaaaaggtcaacaacgaag
12.341
14-423-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
gatttgggcaacaatgcgg
11.301
29-277-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
tctcgagggtgcccctttc
10.46-1
29-291-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tctcgagggtgcccctttc
10.46-1
29-313-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tctcgagggtgcccctttc
10.46-1
30-220-3135.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gtataggggaacctggtga
9.531
32-659-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

42 motifs = 115 134 0 0 thresholds = 8.577 ||9.795 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-395-3395.116000e+03YNL172W5.001000e+03NaNNaNNaN
tgcaagggctcccgcccc
9.571
atatttgcggaaaaggccagcc
10.181
11-897-8436.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgcgagtgcattagcaca
11.561
aaacacgcggaaatagccgcca
11.761
12-266-3145.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgcacagtggcaaatgca
11.04-1
tgtctgctcttcctgcttcttc
9.801
22-897-8573.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgctaaggctgtcggtaa
8.861
accggtgctgctaaggctgtcg
11.821
23-413-3961.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttagcttctgcattggca
9.34-1
gcattggcagcaagagcaaaca
10.091

43 motifs = 3 84 0 0 thresholds = 4.837 ||9.578 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-358-3124.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
aacaactggaagctttc
11.251
10-78-413.340000e+03YGR108W2.350000e+03NaNNaNNaN
agaac
4.841
catcaaaggaagcttta
12.311
19-846-7994.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
aagcatcggaagcattc
9.581
22-938-8793.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
taaggctgtcggtaagg
11.39-1
23-871-9621.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
cagtaaagaaagcctcc
9.771
27-408-4994.497000e+03YML034W4.371000e+03NaNNaNNaN
agaac
4.841
taattctgcctgtagag
10.37-1
32-331-2336.360000e+03YPR156C6.278000e+03NaNNaNNaN
agaac
4.841
n
NaNNaN

44 motifs = 3 62 0 0 thresholds = 4.837 ||8.515 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-810-7612.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
catcgccatc
8.92-1
4-274-3135.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
gatcaccatc
9.11-1
5-894-8703.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gatagtgatg
9.691
7-416-3943.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
cttcacttcc
8.52-1
7-430-3943.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
cttcacttcc
8.52-1
12-339-3545.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
catcaccttc
10.18-1
16-749-6991.065000e+03YHR023W2.624000e+03NaNNaNNaN
agaac
4.841
catcacctcc
9.79-1
19-846-9394.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
ggtagtgaag
8.611
19-900-9394.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
ggtagtgaag
8.611
21-406-4921.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggaagtgatg
9.211
23-291-3601.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
gatggcgatg
8.921
24-371-4204.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
gaaggtgatg
10.181
25-639-5614.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
ggaagtgatg
9.211

45 motifs = 78 99 0 0 thresholds = 8.229 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-742-8064.603000e+03YMR001C4.479000e+03NaNNaNNaN
tattgttgaagga
9.481
catcaccatcttc
10.64-1
9-815-763YBR038W2.730000e+02NaNNaNNaN
tcctccagatgga
9.41-1
cttcagcctcctt
8.76-1
12-389-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
tccttcagaggta
10.90-1
catcaccttcctt
10.61-1
22-744-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgccgctgaaggt
9.091
gaagatgccgttg
9.001
31-426-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
tcctaaaaaagca
8.98-1
caaccccttcatc
9.24-1

46 motifs = 58 80 0 0 thresholds = 8.547 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-736-7564.121000e+03YLR131C3.983000e+03NaNNaNNaN
tttctcctttc
9.12-1
tctcagaatgtcccaata
10.72-1
2-190-2242.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
taaaggaaatgactaaga
10.561
14-170-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
tctatgctgctgcccata
9.95-1
14-297-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
tctatgctgctgcccata
9.95-1
18-320-2612.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaaggtaaa
10.691
tctttctttctccctata
11.39-1
23-197-2761.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttttttttttt
10.91-1
tcttcgtgcatgcctctt
10.89-1
30-176-2685.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
tctcactttctgccgatt
11.47-1

47 motifs = 138 140 0 0 thresholds = 8.111 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccctttttggtaa
8.51-1
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cccgatttggaaa
10.48-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgag
8.291
tgtttatatatttcctatttga
14.841
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-689-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-751-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-751-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
21-177-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
ttcccttttcggg
8.161
tgttgacaaatttcctagttaa
13.151
26-545-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttgcccgtttggg
9.61-1
ccaaacgggcaaaatataaata
13.831
26-569-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
cccaaacgggcaa
9.61-1
ccaaacgggcaaaatataaata
13.831
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatgggg
10.33-1
ctctttgggcaagttgtaaaca
14.631
29-291-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccccatccggaaa
10.331
ctctttgggcaagttgtaaaca
14.631
29-299-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccccatccggaaa
10.33-1
ctctttgggcaagttgtaaaca
14.631

48 motifs = 58 69 0 0 thresholds = 8.547 ||8.609 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-597-5452.989000e+03YGL021W1.995000e+03NaNNaNNaN
gaagagataaa
8.971
atgcaagggcttc
8.611
3-448-3965.116000e+03YNL172W5.001000e+03NaNNaNNaN
tttattttttt
10.65-1
atgcaagggctcc
9.111
5-584-5323.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
atgcaaaggaaac
9.851
12-293-3795.551000e+03YOR025W5.449000e+03NaNNaNNaN
tttccctcttc
8.77-1
cttcagtggccaa
9.001
15-591-6331.368000e+03YIL106W2.938000e+03NaNNaNNaN
tttactctttt
9.85-1
tgttcccttgaat
9.31-1
17-440-4142.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttttcttttt
11.06-1
tcctcccctgaag
9.09-1
22-262-1723.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttt
10.37-1
ttatcctttgaag
10.16-1
29-482-4384.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttgcttcttt
8.87-1
ggatccactgaat
9.38-1

49 motifs = 11 138 0 0 thresholds = 7.124 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ccctttttggtaa
8.51-1
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaa
10.48-1
8-535-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagggtca
10.531
ttacctaaaaggg
8.851
10-632-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
cccaaagaggaaa
10.81-1
11-689-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
11-703-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
11-703-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
15-206-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cttcccaaaatggaaa
9.651
cccaaaatggaaa
10.60-1
16-204-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
cccaaaagggtaa
9.42-1
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttcctttttggg
10.941
26-583-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
ttgcccgtttggg
9.61-1
26-583-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cccaaacgggcaa
9.61-1
28-194-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
tttccagattagg
9.001
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccccatccggaaa
10.33-1
29-218-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
tttccggatgggg
10.33-1
29-218-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccccatccggaaa
10.331
29-218-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccccatccggaaa
10.33-1
29-277-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.33-1
29-277-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.331
29-277-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.33-1
29-291-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.33-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttccggatgggg
10.33-1
29-313-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.33-1
29-313-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttccggatgggg
10.33-1
29-313-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.331
29-313-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.33-1
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

50 motifs = 3 123 0 0 thresholds = 4.837 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-327-4022.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
tcccaccattagacta
11.30-1
2-810-8572.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
ttgcagcgtggtggga
12.031
12-128-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
tccctcaattgcgggt
9.50-1
18-434-4122.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
tagcagcattgttgga
10.561
22-938-9483.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tcccacaaggactgga
9.04-1
23-871-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
tccccccatgggccaa
10.20-1
28-193-1084.588000e+03YML119W4.464000e+03NaNNaNNaN
agaac
4.841
tccctcaattgtacat
11.65-1
31-875-9106.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
tccgaccacgggacaa
10.49-1

51 motifs = 86 111 0 0 thresholds = 8.949 ||9.158 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-119-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
taaaaagaaataggctgcag
9.101
gggtagcccgatgatgcggctc
11.961
20-659-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
ttgacatgctgttgcagcag
10.921
cagcagcaaaaccggcattacc
11.911
22-753-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgttaaggctgccgctgaag
10.171
ggttacaccgaagatgccgttg
9.871
23-827-7321.613000e+03YKL130C3.580000e+03NaNNaNNaN
ctgcaactgcaaacatacca
11.721
ccggatcatcttcggagttgcc
10.571

52 motifs = 94 129 0 0 thresholds = 8.391 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-342-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
gatgatgcccaag
8.891
ccattagactacttcgacg
9.66-1
3-717-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
gaaggcgccactg
9.161
ccattggccatcaacaata
11.96-1
22-650-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.851
ccaattgtctccaaagttc
9.19-1
22-704-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.851
ccaattgtctccaaagttc
9.19-1
23-777-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
gaagctgcatacg
9.181
ccatgggccaaccaaagga
9.95-1

53 motifs = 105 129 0 0 thresholds = 9.482 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-405-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
gactacttcgacgaag
10.991
ccattagactacttcgacg
9.66-1
3-815-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
cctcgtcgatgttcac
10.70-1
ccattggccatcaacaata
11.96-1
22-713-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggttacaccgaagatg
10.241
ccaattgtctccaaagttc
9.19-1
23-732-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
catcttcggagttgcc
11.02-1
ccatgggccaaccaaagga
9.95-1

54 motifs = 118 144 0 0 thresholds = 9.133 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-833-7642.989000e+03YGL021W1.995000e+03NaNNaNNaN
tggtgggattacggttac
9.86-1
caatactcacatcgcc
10.35-1
10-683-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
gggcggtttttcactacc
9.20-1
caaaacgggcacgacc
10.80-1
20-646-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
gcagcagcaaaaccggca
10.741
caaaaccggcattacc
10.68-1
23-843-8131.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaactgcaaacatacca
10.141
caataccaccaccccc
11.52-1

55 motifs = 138 144 0 0 thresholds = 8.111 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-618-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaaa
10.81-1
caaaacgggcacgacc
10.80-1
21-177-1661.420000e+03YIL158W2.990000e+03NaNNaNNaN
ttcccttttcggg
8.161
ggcggtggtcgtgttg
12.871
22-271-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttggg
10.941
caaaacgcacataccc
11.30-1
23-797-8131.613000e+03YKL130C3.580000e+03NaNNaNNaN
ccccatgggccaa
8.11-1
caataccaccaccccc
11.52-1

56 motifs = 50 118 0 0 thresholds = 6.445 ||9.133 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-391-430YBR038W2.730000e+02NaNNaNNaN
ataaacaca
7.281
tgctgttttttctgtttc
11.18-1
9-562-568YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
gttacagtaaagaatccc
10.641
10-636-6833.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
gggcggtttttcactacc
9.20-1
10-715-6833.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
gggcggtttttcactacc
9.20-1
12-184-2475.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
tgcatgtgtttctgtggc
11.57-1
16-490-4131.065000e+03YHR023W2.624000e+03NaNNaNNaN
ctaaacaaa
7.501
gtcgctgaaaatcgagcc
10.481
23-837-8431.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
gcaactgcaaacatacca
10.141
23-960-9661.613000e+03YKL130C3.580000e+03NaNNaNNaN
gtaaagaaa
7.171
gtcgcagtaaagaaagcc
10.321
29-434-3864.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
gtggcagtagttcttccc
9.561

57 motifs = 2 70 0 0 thresholds = 6.900 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3724.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
aaaatgtaaaca
12.471
2-144-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
aaaacgtaaaca
12.001
2-144-1892.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
aaaagataaaca
9.521
5-620-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
aaaaggtaaaca
12.561
12-210-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
aaaacgtcaata
8.071
13-220-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
aaagtgtaaaca
11.021
14-230-1716.076000e+03YPL155C5.983000e+03NaNNaNNaN
taatgtcattatatgcgggtag
8.041
tgtttatccttt
8.08-1
15-236-2001.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccactcgtataatatgacaaat
7.641
aaaatggaaata
8.881
20-148-965.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtttccgttcgcggtgattagt
8.521
aaaatgtaaaca
12.471
28-403-3434.588000e+03YML119W4.464000e+03NaNNaNNaN
aggttcgttgctagcgacaagc
9.481
tattgacctttt
8.63-1

58 motifs = 34 131 0 0 thresholds = 5.648 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-380-4582.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccgaaaactgga
6.561
attcaatggtggccaagcc
10.28-1
14-736-7026.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatggtgccg
8.65-1
gaattggagagccatggtg
11.011
14-736-7566.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatggtgccg
8.65-1
gaattggagagccatggtg
11.011
21-548-5881.420000e+03YIL158W2.990000e+03NaNNaNNaN
acgaacaaagga
5.941
gccaaggaaaacattgaaa
10.691
22-614-6913.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
caccgaagatgccgttgtc
9.97-1
32-650-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
tcgcccaacgga
6.341
n
NaNNaN
32-690-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

59 motifs = 70 138 0 0 thresholds = 7.941 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-189-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaagataaaca
9.521
ccctttttggtaa
8.51-1
11-690-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
cccgtttaggaaa
10.12-1
11-767-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
cccgtttaggaaa
10.12-1
11-767-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
cccgtttaggaaa
10.12-1
15-200-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
cccaaaatggaaa
10.60-1
19-171-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cccagaagggaaa
9.19-1
21-145-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttcccttttcggg
8.161
21-191-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttcccttttcggg
8.161
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
tttcctttttggg
10.941
29-204-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ccccatccggaaa
10.33-1
29-204-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
tttccggatgggg
10.33-1
29-204-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ccccatccggaaa
10.331
29-204-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ccccatccggaaa
10.33-1
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1
29-218-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
tttccggatgggg
10.33-1
29-218-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.331
29-218-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1
29-283-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1
29-283-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.331
29-283-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1

60 motifs = 50 103 0 0 thresholds = 6.445 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-338-2763.852000e+03YJR092W3.372000e+03NaNNaNNaN
acaaacaaa
7.591
cgctgcaggaaata
9.131
6-577-5114.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
gatttactcatccg
9.10-1
10-406-3923.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttgt
7.59-1
gatttcctcattcg
11.80-1
10-636-6283.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ccaaagaggaaaaa
9.761
10-715-6283.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
ccaaagaggaaaaa
9.761
20-79-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
cgcataaggaaaca
9.951
22-252-2613.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttttgg
9.51-1
29-213-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tatttcccttttgg
11.04-1
29-213-2814.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tatttcccttttgg
11.04-1
30-201-2105.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gatttcctaaagcg
10.01-1

61 motifs = 58 140 0 0 thresholds = 8.547 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-190-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
cctttttggtaaaacgtaaaca
14.761
5-584-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
ccgatttggaaaaaggtaaaca
15.841
11-509-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
ggttaattttttgccaatttag
9.721
11-509-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
ctctttggggaaaagagaaata
12.921
11-543-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
ggttaattttttgccaatttag
9.721
11-543-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
ctctttggggaaaagagaaata
12.921
14-170-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
tgtttatccttttccaatagcg
13.931
18-320-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaaggtaaa
10.691
ctgtttaggaaaaaggtaaaca
15.591
20-132-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
cgcataaggaaacaaggacaca
9.411
21-169-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
tgttgacaaatttcctagttaa
13.151
21-192-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
tgttgacaaatttcctagttaa
13.151
23-76-1691.613000e+03YKL130C3.580000e+03NaNNaNNaN
aaaaagagaaa
10.701
tgtttgtattttcccgttttga
10.971
23-197-1691.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttttttttttt
10.91-1
tgtttgtattttcccgttttga
10.971
25-221-2824.074000e+03YLR084C3.935000e+03NaNNaNNaN
aaaaaaagaaa
10.551
tattgacaaattcccaaattag
15.031
29-131-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaaagaggaaa
8.871
ctctttgggcaagttgtaaaca
14.631
29-282-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ctctttgggcaagttgtaaaca
14.631
30-176-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
ctaaagcgggaaatagtaaaca
14.881

62 motifs = 72 144 0 0 thresholds = 8.401 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-674-6632.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcatctttggt
11.05-1
gggtttggtggtgatg
10.211
2-674-7642.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcatctttggt
11.05-1
caatactcacatcgcc
10.35-1
2-755-6632.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccatcgttggt
9.28-1
gggtttggtggtgatg
10.211
2-755-7642.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccatcgttggt
9.28-1
caatactcacatcgcc
10.35-1
10-629-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
caaaacgggcacgacc
10.80-1
22-260-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
caaaacgcacataccc
11.30-1
23-269-3571.613000e+03YKL130C3.580000e+03NaNNaNNaN
accaaaagtgca
9.611
ggcgatgatgatgatg
10.051

63 motifs = 95 129 0 0 thresholds = 9.232 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-349-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
gaagaaggatgatgccc
10.811
ccattagactacttcgacg
9.66-1
14-412-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
ccactggccatcgttggtg
9.82-1
19-670-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
ggtcaacgaccttcttc
11.91-1
ccagtggacttgttaacta
9.12-1
20-726-7505.680000e+02YCL063W6.040000e+02NaNNaNNaN
gggcaccggtgttcctg
10.19-1
ccagtaggcaccactcacg
9.31-1

64 motifs = 111 132 0 0 thresholds = 9.158 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-482-4204.345000e+03YLR353W4.215000e+03NaNNaNNaN
gagaggccaaaccggatagtcc
9.481
tttttttattgcgcgtaagcgat
9.991
6-482-5474.345000e+03YLR353W4.215000e+03NaNNaNNaN
gagaggccaaaccggatagtcc
9.481
tttttttttttttcataagggaa
12.14-1
10-422-3953.340000e+03YGR108W2.350000e+03NaNNaNNaN
gcgttccgcatacggtctgccc
10.291
tgttttgtttgtgatttcctcat
13.141
14-214-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
gggtagcccgatgatgcggctc
11.961
aagcagaagcgaaaaataaaaag
10.911
14-214-3026.076000e+03YPL155C5.983000e+03NaNNaNNaN
gggtagcccgatgatgcggctc
11.961
ataagtagataacaataaaaaaa
11.111
32-717-6446.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

65 motifs = 62 114 0 0 thresholds = 8.515 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-657-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtgatg
9.891
attatgtcttggtcatctttggtgg
10.121
2-761-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatc
8.92-1
attatgtcttggtcatctttggtgg
10.121
3-691-6745.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatc
9.58-1
tcaccatcggcaaagtacctttcca
9.721
4-313-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
gatcaccatc
9.11-1
tcaccatcgtggtgctctttgtcat
15.031
5-870-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatagtgatg
9.691
tctccattgttctcgtattcttcct
13.501
23-360-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
acgatgatgataatgacgatggcga
12.361

66 motifs = 3 83 0 0 thresholds = 4.837 ||9.139 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-327-3432.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
ggatgatgcccaaggt
11.991
5-894-8413.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
ggatgttggacaagtt
9.351
19-846-8294.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
accttgaacttcatcg
10.24-1
19-846-8834.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
accttgaacttcatcg
10.24-1
19-900-8294.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
accttgaacttcatcg
10.24-1
19-900-8834.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
accttgaacttcatcg
10.24-1
21-300-3251.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggatgaagatcacgtt
11.561
21-406-3251.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggatgaagatcacgtt
11.561
23-291-3821.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
tgctgacgatgatgat
10.381
24-371-4244.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
ggtcgaaggtgatgat
9.141
27-720-7894.497000e+03YML034W4.371000e+03NaNNaNNaN
gttct
4.84-1
agcttgttcatcacca
10.68-1
31-235-2526.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
tgttgctgatcacggt
11.011

67 motifs = 74 142 0 0 thresholds = 9.204 ||9.159 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-271-2843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgca
10.22-1
gaagcttccgctgcaggaaa
11.921
12-546-5595.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaaga
10.261
12-546-5905.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaaga
10.261
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
gttgcagcagcaaaaccggc
9.751
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctga
11.101
23-421-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gcggaaagtgctgacgatga
11.371
23-421-3901.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gcggaaagtgctgacgatga
11.371

68 motifs = 135 138 0 0 thresholds = 9.254 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-535-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagg
11.361
ttacctaaaaggg
8.851
11-751-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgtttaggaaa
9.51-1
cccgtttaggaaa
10.12-1
22-258-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
cctttttgggaa
10.21-1
tttcctttttggg
10.941
26-545-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaa
10.33-1
cccaaacgggcaa
9.61-1
29-277-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.33-1
29-277-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.331
29-277-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.33-1

69 motifs = 70 79 0 0 thresholds = 7.941 ||7.791 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-4334.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
gagagcggctcgtcag
8.571
9-748-816YBR038W2.730000e+02NaNNaNNaN
tgtttccaatct
7.94-1
ggaagggtcccccaag
10.111
11-690-6416.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
cttcggtgcctgtccc
9.51-1
14-171-1136.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
gaaataggctgcagag
8.661
29-283-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cgagggtgcccctttc
11.18-1

70 motifs = 132 147 0 0 thresholds = 9.994 ||8.808 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-249-3095.116000e+03YNL172W5.001000e+03NaNNaNNaN
tactttttttcatttttatcgct
12.741
aggccagcctcgcagtatt
10.46-1
10-915-8683.340000e+03YGR108W2.350000e+03NaNNaNNaN
ttttttttttttgcatccaattt
14.461
aggcgtttcttccaaattt
10.66-1
16-501-5381.065000e+03YHR023W2.624000e+03NaNNaNNaN
aagtcaaaaggctaaacaaaaag
11.471
aggcaaaccttgccttata
9.99-1
27-443-4864.497000e+03YML034W4.371000e+03NaNNaNNaN
ttttttttttttaaaatttatct
11.781
aggcagaattagcagcgtt
10.56-1
27-443-5224.497000e+03YML034W4.371000e+03NaNNaNNaN
ttttttttttttaaaatttatct
11.781
aacgctgctaattctgcct
10.561
31-95-696.062000e+03YPL141C5.969000e+03NaNNaNNaN
tattttttttacccatccacaat
11.761
aggcgagccaagcggcgtt
11.65-1
31-130-696.062000e+03YPL141C5.969000e+03NaNNaNNaN
ttttttgattgctaattaaacct
12.161
aggcgagccaagcggcgtt
11.65-1

71 motifs = 50 70 0 0 thresholds = 6.445 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-323-3724.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
aaaatgtaaaca
12.471
2-55-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaacgtaaaca
12.001
2-100-1892.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaagataaaca
9.521
2-184-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
aaaacgtaaaca
12.001
4-175-1965.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaggtaaata
10.271
4-191-1805.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaggtaaata
10.271
5-536-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaggtaaaca
12.561
11-772-6906.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
aaaaggtcaaca
10.921
12-184-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
aaaacgtcaata
8.071
13-239-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaagtgtaaaca
11.021
15-573-4791.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
tgtatacctttt
9.67-1
18-249-3192.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
aaaaggtaaaca
12.561
20-79-965.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
aaaatgtaaaca
12.471
21-225-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
aaaagggaaata
8.981
21-225-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
aaaagggaaata
8.981
29-213-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
aagttgtaaaca
8.541
29-213-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tatttccctttt
8.98-1
31-454-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaggtaaaca
12.561

72 motifs = 65 140 0 0 thresholds = 9.209 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-628-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaagagacatt
10.841
ccgatttggaaaaaggtaaaca
15.841
11-542-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaagagaaata
11.461
ggttaattttttgccaatttag
9.721
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaagagaaata
11.461
ctctttggggaaaagagaaata
12.921
20-139-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaaagagaaaaa
11.201
cgcataaggaaacaaggacaca
9.411
21-170-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
tgttgacaaatttcctagttaa
13.151
21-191-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
tgttgacaaatttcctagttaa
13.151
25-265-2824.074000e+03YLR084C3.935000e+03NaNNaNNaN
aattcctctttt
10.94-1
tattgacaaattcccaaattag
15.031
29-283-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ctctttgggcaagttgtaaaca
14.631

73 motifs = 58 143 0 0 thresholds = 8.547 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-736-7154.121000e+03YLR131C3.983000e+03NaNNaNNaN
tttctcctttc
9.12-1
cacttcagaaatcag
10.021
6-583-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
6-608-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
10-626-6693.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
cgttttcgagtaggg
9.34-1
11-281-3496.323000e+03YPR119W6.238000e+03NaNNaNNaN
tttattctttc
9.07-1
tacttctgaaaagcg
11.011
11-296-3496.323000e+03YPR119W6.238000e+03NaNNaNNaN
tttattctttc
9.07-1
tacttctgaaaagcg
11.011
14-170-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
ccttttccaatagcg
9.05-1
21-169-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
cgcttctcaaaaggg
11.371
21-192-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
cgcttctcaaaaggg
11.371
31-377-4416.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaggtaaa
10.691
cacttcctaaaaaag
10.771
31-388-4416.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaggtaaa
10.691
cacttcctaaaaaag
10.771

74 motifs = 24 85 0 0 thresholds = 6.571 ||8.241 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-643-6693.852000e+03YJR092W3.372000e+03NaNNaNNaN
cgggtaa
8.37-1
catcctacgagaaacgcccccct
8.241
12-224-2955.551000e+03YOR025W5.449000e+03NaNNaNNaN
cgggtaa
8.37-1
cttccctgttcgtttttccctct
11.041
17-164-2472.557000e+03YDR150W1.135000e+03NaNNaNNaN
cgggtgg
6.66-1
attggctcactccgggcaggacc
10.831
28-622-7024.588000e+03YML119W4.464000e+03NaNNaNNaN
ttacccg
8.371
actccttccccactatgccctat
10.431
30-950-9445.003000e+03YNL058C4.886000e+03NaNNaNNaN
taacccg
6.571
catcccaccagaaaataacccgt
10.521

75 motifs = 34 123 0 0 thresholds = 5.648 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-380-4022.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccgaaaactgga
6.561
tcccaccattagacta
11.30-1
2-380-4712.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccgaaaactgga
6.561
tcccacaattattcaa
11.90-1
17-374-3852.557000e+03YDR150W1.135000e+03NaNNaNNaN
agggaaaaagga
5.821
aggcctagttgaggga
10.331
23-750-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
tccccccatgggccaa
10.20-1
31-923-9106.062000e+03YPL141C5.969000e+03NaNNaNNaN
ccgaccacggga
6.421
tccgaccacgggacaa
10.49-1

76 motifs = 50 125 0 0 thresholds = 6.445 ||9.554 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-4414.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggggcactgagagcggctc
10.211
15-573-6131.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
aacccttcttctacgcctc
10.33-1
17-145-502.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
gacgcaacggtcaaggctt
10.071
23-837-7991.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
ccccctccccccatgggcc
9.64-1

77 motifs = 50 144 0 0 thresholds = 6.445 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-636-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
caaaacgggcacgacc
10.80-1
10-715-6463.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
caaaacgggcacgacc
10.80-1
21-225-1661.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
ggcggtggtcgtgttg
12.871
22-252-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
caaaacgcacataccc
11.30-1
23-405-3571.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacaaa
8.301
ggcgatgatgatgatg
10.051
23-837-8131.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
caataccaccaccccc
11.52-1

78 motifs = 58 122 0 0 thresholds = 8.547 ||10.183 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-584-5733.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
caacaatgaaatattcctcgagaaaa
12.871
20-132-815.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
cagtaaagaatgggaccataagatag
11.401
29-482-4094.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttgcttcttt
8.87-1
caacaaggagttctccccatcgagtg
13.751
32-645-7016.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

79 motifs = 62 146 0 0 thresholds = 8.515 ||9.895 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-761-7732.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatc
8.92-1
ataacaacacgtggaacaatact
10.211
3-691-6845.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatc
9.58-1
agtacctttccagtcgtcgaacg
9.901
12-354-3825.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttc
10.18-1
ggatccttcagaggtaaaatgcg
11.751
25-561-4904.074000e+03YLR084C3.935000e+03NaNNaNNaN
ggaagtgatg
9.211
agcatggtcccgattggtgtacg
11.261

80 motifs = 69 131 0 0 thresholds = 8.609 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-545-4582.989000e+03YGL021W1.995000e+03NaNNaNNaN
atgcaagggcttc
8.611
attcaatggtggccaagcc
10.28-1
2-733-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
gtcttggtcatctttggtg
10.531
3-396-3305.116000e+03YNL172W5.001000e+03NaNNaNNaN
atgcaagggctcc
9.111
gaaaaggccagcctcgcag
11.581
22-735-6913.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
caccgaagatgccgttgtc
9.97-1
29-438-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
tctcgagggtgcccctttc
10.46-1

81 motifs = 83 129 0 0 thresholds = 9.139 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-343-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggatgatgcccaaggt
11.991
ccattagactacttcgacg
9.66-1
4-543-6025.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggttgatggacatggt
11.401
taactctggtgtcaactgg
10.771
19-829-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
accttgaacttcatcg
10.24-1
ccagtggacttgttaacta
9.12-1
22-675-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
ccaattgtctccaaagttc
9.19-1

82 motifs = 95 103 0 0 thresholds = 9.232 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-671-6426.323000e+03YPR119W6.238000e+03NaNNaNNaN
ggtcaacaacgaagttc
10.56-1
ccctcgaggaaata
9.971
19-670-5804.529000e+03YML064C4.404000e+03NaNNaNNaN
ggtcaacgaccttcttc
11.91-1
ggtttcctcaaagg
9.81-1
29-325-2814.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaagagcaccgattgcc
11.111
tatttcccttttgg
11.04-1
32-591-6556.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

83 motifs = 95 128 0 0 thresholds = 9.232 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-463-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
ggctcctgtatctctgcaattac
8.711
19-322-3954.529000e+03YML064C4.404000e+03NaNNaNNaN
ggacatccatgctgctc
10.97-1
ggcggcttcacaccggcaccacc
9.651
20-726-6525.680000e+02YCL063W6.040000e+02NaNNaNNaN
gggcaccggtgttcctg
10.19-1
gctgttgcagcagcaaaaccggc
12.881
29-763-8304.635000e+03YMR032W4.512000e+03NaNNaNNaN
catgagcgtcgctgacg
10.011
gaagctgcatgagcgtcgctgac
10.281

84 motifs = 98 103 0 0 thresholds = 8.863 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-585-5114.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
gatttactcatccg
9.10-1
11-545-6426.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
ccctcgaggaaata
9.971
26-572-5554.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.701
cctttcgggaaata
10.011
26-580-5554.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.70-1
cctttcgggaaata
10.011
26-650-5554.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
cctttcgggaaata
10.011
32-641-6556.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

85 motifs = 112 128 0 0 thresholds = 9.601 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-450-4005.116000e+03YNL172W5.001000e+03NaNNaNNaN
ttttaaaccacaagag
10.411
gtcaatgcaagggctcccgcccc
11.431
7-724-7943.084000e+03YGL116W2.089000e+03NaNNaNNaN
tattattccacaagcg
10.731
gggtatgttactattgcatcaac
12.361
11-812-8966.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttattccaaatgcg
11.521
gcgagtgcattagcacagtggaa
7.921
25-698-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
ctcttatggtaggaaa
11.11-1
ggcagaactacaaaggcaattac
10.671

86 motifs = 117 123 0 0 thresholds = 7.961 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-949-8572.989000e+03YGL021W1.995000e+03NaNNaNNaN
cttctccttctgttgttttgccat
12.451
ttgcagcgtggtggga
12.031
14-899-9636.076000e+03YPL155C5.983000e+03NaNNaNNaN
aggatactgaaaatggcggtgaag
9.571
tccctccattttacaa
10.55-1
23-826-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
caactgcaactgcaaacataccaa
9.981
tccccccatgggccaa
10.20-1
30-860-8765.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctacaccaacacggtgcttgccct
13.071
tcccacaactacacca
11.21-1
30-956-8765.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctactccatctttcatcccaccag
9.051
tcccacaactacacca
11.21-1

87 motifs = 118 146 0 0 thresholds = 9.133 ||9.895 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-833-7732.989000e+03YGL021W1.995000e+03NaNNaNNaN
tggtgggattacggttac
9.86-1
ataacaacacgtggaacaatact
10.211
7-784-8053.084000e+03YGL116W2.089000e+03NaNNaNNaN
gggacagtaaggatgcca
9.451
atatcctccacgggtatgttact
11.531
9-568-604YBR038W2.730000e+02NaNNaNNaN
gttacagtaaagaatccc
10.641
gtaccgcccacaggtactctgct
10.891
29-386-3384.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtggcagtagttcttccc
9.561
ggtgcccctttcggtagtttgcg
10.781

88 motifs = 133 146 0 0 thresholds = 8.661 ||9.895 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-641-604YBR038W2.730000e+02NaNNaNNaN
ccttctcgcactttgccgt
9.70-1
gtaccgcccacaggtactctgct
10.891
17-894-8272.557000e+03YDR150W1.135000e+03NaNNaNNaN
cggtctcaatagtggccaa
8.84-1
gggactctgccatcggaggaact
10.511
27-937-9864.497000e+03YML034W4.371000e+03NaNNaNNaN
catgctcatctagggccaa
10.27-1
agagctacaattggtagaatgcg
13.041
29-352-3384.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccctctcgagggtgcccct
10.56-1
ggtgcccctttcggtagtttgcg
10.781

89 motifs = 3 11 0 0 thresholds = 4.837 ||7.124 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-807-7504.121000e+03YLR131C3.983000e+03NaNNaNNaN
agaac
4.841
tgtcccaataaggcac
7.58-1
1-807-7644.121000e+03YLR131C3.983000e+03NaNNaNNaN
agaac
4.841
tgtcccaataaggcac
7.58-1
4-739-6475.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
aaaccttaactggtga
7.201
7-416-3273.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
ttgccgaaagaggcaa
7.871
8-483-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaagggtca
10.531
8-567-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaagggtca
10.531
9-179-219YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tttcctatttgagtat
7.281
12-128-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
ttaccacaaagggtaa
7.64-1
14-496-4236.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
tttacgatttgggcaa
7.14-1
18-434-3822.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
aatcccaatccgggca
8.511
22-191-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
22-191-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
22-290-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
22-290-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
22-340-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
22-340-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttgggaaa
10.60-1
24-117-1694.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
tttcctattctagtga
7.601
26-527-5834.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
tgtcccaaacgggcaa
11.081
29-374-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
tttccggatggggcaa
9.58-1
29-374-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ttgccccatccggaaa
9.581
29-374-3134.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ttgccccatccggaaa
9.581
29-397-3134.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
ttgccccatccggaaa
9.581
31-397-4396.062000e+03YPL141C5.969000e+03NaNNaNNaN
agaac
4.841
cttcctaaaaaagcaa
7.811
32-622-6596.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

90 motifs = 11 126 0 0 thresholds = 7.124 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaaaaggtaaa
14.571
8-535-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagggtca
10.531
tctatatgttgcccgggtagg
8.391
9-219-208YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tttatatatttcctatttgag
12.531
11-381-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
atacctcaagaagtaa
7.261
gttaattttttgccaatttag
8.761
11-542-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
gttaattttttgccaatttag
8.761
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
cctctttggggaaaagagaaa
12.891
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgaatcaggaaaaggtcaac
10.221
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
cctgtttaggaaaaaggtaaa
14.631
18-382-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
cctgtttaggaaaaaggtaaa
14.631
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
taaagatttttcctttttggg
9.001
26-583-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gttaattttgtcccaaacggg
11.73-1
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gttaattttgtcccaaacggg
11.731
28-194-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
ccagattaggaaagaacataa
10.751
29-218-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ctgtatgagggaaagaggaaa
8.711
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
cccttttgggtaacagcggac
11.701
29-218-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
cccttttgggtaacagcggac
11.701
29-277-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
cccttttgggtaacagcggac
11.701
29-277-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
cccttttgggtaacagcggac
11.701
29-291-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
cccttttgggtaacagcggac
11.701
29-313-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
cccttttgggtaacagcggac
11.701
29-313-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
cccttttgggtaacagcggac
11.701

91 motifs = 50 123 0 0 thresholds = 6.445 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-443-4022.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcaacaaa
6.471
tcccaccattagacta
11.30-1
2-443-4712.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcaacaaa
6.471
tcccacaattattcaa
11.90-1
12-184-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
tccctcaattgcgggt
9.50-1
18-314-4122.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
tagcagcattgttgga
10.561
23-837-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
tccccccatgggccaa
10.20-1
29-896-8444.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacata
7.881
tagctgccttgtcgga
9.211

92 motifs = 3 126 0 0 thresholds = 4.837 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-416-3243.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
ccgaaagaggcaaaacgtaaa
12.251
8-483-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
tctatatgttgcccgggtagg
8.39-1
8-567-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
tctatatgttgcccgggtagg
8.39-1
8-567-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
tctatatgttgcccgggtagg
8.391
8-666-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
gttct
4.84-1
tctatatgttgcccgggtagg
8.391
9-179-208YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tttatatatttcctatttgag
12.531
12-128-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
gtttgctgttaccacaaaggg
11.201
14-245-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tttatccttttccaatagcgg
10.981
17-86-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
gttct
4.84-1
gtttattattccccaagagag
10.001
22-191-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
taaagatttttcctttttggg
9.001
22-290-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
taaagatttttcctttttggg
9.001
22-340-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
taaagatttttcctttttggg
9.001
25-639-7204.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
tttccatgttgcccgaaatag
11.011
26-527-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
gttaattttgtcccaaacggg
11.73-1
26-527-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
gttaattttgtcccaaacggg
11.731
28-193-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
agaac
4.841
ccagattaggaaagaacataa
10.751
29-374-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
cccttttgggtaacagcggac
11.701
32-622-6566.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

93 motifs = 3 91 0 0 thresholds = 4.837 ||9.029 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-327-4012.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
tcacaccattagacgtc
9.05-1
2-327-4162.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
tcacaccattagacgtc
9.05-1
2-810-8582.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
gttgcagcgtggtggga
9.161
14-496-4736.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ttggcccactggccatc
9.97-1
18-618-6852.553000e+03YDR146C1.131000e+03NaNNaNNaN
gttct
4.84-1
gctgtctagtggcctaa
10.581
20-620-5275.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
ggagccacttggttgaa
9.791
23-871-7961.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
tccccccatgggccaac
11.23-1
31-875-9096.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
tccgaccacgggacaac
12.18-1

94 motifs = 3 144 0 0 thresholds = 4.837 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-810-7642.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
caatactcacatcgcc
10.35-1
20-620-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
caaaaccggcattacc
10.68-1
21-134-1661.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggcggtggtcgtgttg
12.871
22-191-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
caaaacgcacataccc
11.30-1
22-290-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
caaaacgcacataccc
11.30-1
23-291-3571.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
ggcgatgatgatgatg
10.051
23-871-8131.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
caataccaccaccccc
11.52-1

95 motifs = 50 133 0 0 thresholds = 6.445 ||8.661 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-562-641YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ccttctcgcactttgccgt
9.70-1
20-286-3035.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
cctcctcatattgtccctt
10.34-1
20-364-3035.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
cctcctcatattgtccctt
10.34-1
23-405-4491.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacaaa
8.301
tggggacgtttagcgacgg
9.781
23-837-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
ccctccccccatgggccaa
11.11-1
29-434-3524.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
ccctctcgagggtgcccct
10.56-1
30-201-2705.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
ccttctcactttctgccga
10.28-1

96 motifs = 11 132 0 0 thresholds = 7.124 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
tttggtaaaacgtaaacaaaata
10.651
6-589-5474.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcataagggaa
12.14-1
6-589-5994.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcataagggaa
12.141
11-542-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
agaaaggaaaaaaaatcaaaata
13.161
14-423-3356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
ataagtagataacaataaaaaaa
11.111
16-204-1351.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
tgttttgattgttcattgtttat
12.891
26-583-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
tattttatttctagataaaccct
11.361
27-220-1904.497000e+03YML034W4.371000e+03NaNNaNNaN
ttactgttttaggaag
8.90-1
tgtttttgttttggtttcaattt
11.231
30-220-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
ataaaacatttgtaaaaaaaaaa
13.531
32-659-6446.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

97 motifs = 63 106 0 0 thresholds = 9.512 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-62-775.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaactgaaggga
10.441
gtggttagtggtgtaaaaactg
8.721
12-640-5655.551000e+03YOR025W5.449000e+03NaNNaNNaN
aatcctgaggaga
11.071
gaggatgacgatgaggaagaat
9.251
12-640-5905.551000e+03YOR025W5.449000e+03NaNNaNNaN
aatcctgaggaga
11.071
gaggatgacgatgaggaagaat
9.251
14-260-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtcctcagtttt
12.10-1
gggtagcccgatgatgcggctc
8.491
20-609-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaacctgaggaga
12.171
ctgttgcagcagcaaaaccggc
9.121
22-680-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
tctcctctgattt
11.23-1
cttcagcggcagccttaacagc
11.71-1
22-680-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
tctcctctgattt
11.23-1
gctgttaaggctgccgctgaag
11.711

98 motifs = 69 72 0 0 thresholds = 8.609 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-6742.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
gtcatctttggt
11.05-1
2-733-7552.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
gccatcgttggt
9.28-1
14-905-8666.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaaaggatac
10.691
gccacctttggt
10.73-1
22-172-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttatcctttgaag
10.16-1
ttcctttttggg
9.32-1
22-735-7073.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
accgaagatgcc
9.151
29-438-3464.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
gcccctttcggt
9.02-1
29-981-9354.635000e+03YMR032W4.512000e+03NaNNaNNaN
gattcttttgaag
8.85-1
tacaactttggg
8.52-1

99 motifs = 64 129 0 0 thresholds = 8.519 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-282-2185.200000e+02YCL014W5.570000e+02NaNNaNNaN
gacaaaaaaga
8.971
ccagttgccaagacctagg
9.21-1
19-667-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
ccttcttcttc
9.34-1
ccagtggacttgttaacta
9.12-1
20-699-7505.680000e+02YCL063W6.040000e+02NaNNaNNaN
tcttctttgtc
8.57-1
ccagtaggcaccactcacg
9.31-1
28-376-3444.588000e+03YML119W4.464000e+03NaNNaNNaN
gcaaagaaagg
9.071
tttaaatggtgcccagtgg
11.891

100 motifs = 66 84 0 0 thresholds = 9.028 ||9.578 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-825-7385.116000e+03YNL172W5.001000e+03NaNNaNNaN
gtcgatgttcaccttg
9.891
cgttactggcagcgtta
11.301
5-262-1673.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggcgatgataccatgg
10.901
ctcaaatgaaagcctta
10.831
5-262-2923.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggcgatgataccatgg
10.901
cacaactggaagcttcc
11.441
19-881-7994.529000e+03YML064C4.404000e+03NaNNaNNaN
cttgaacttcatcgac
9.41-1
aagcatcggaagcattc
9.581
22-824-7353.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtcgatgtttccgttg
11.051
taaggctgccgctgaag
11.53-1
22-824-8793.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtcgatgtttccgttg
11.051
taaggctgtcggtaagg
11.39-1

101 motifs = 69 107 0 0 thresholds = 8.609 ||9.839 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-545-5692.989000e+03YGL021W1.995000e+03NaNNaNNaN
atgcaagggcttc
8.611
ccgcagagggagaata
9.851
15-633-6101.368000e+03YIL106W2.938000e+03NaNNaNNaN
tgttcccttgaat
9.31-1
tcttctacgcctcttg
10.34-1
29-438-3614.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
tcttccccctctcgag
10.69-1
30-927-9655.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctgcagtggacca
8.631
tctactccatctttca
10.02-1

102 motifs = 69 134 0 0 thresholds = 8.609 ||9.795 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-396-3395.116000e+03YNL172W5.001000e+03NaNNaNNaN
atgcaagggctcc
9.111
atatttgcggaaaaggccagcc
10.181
12-379-3145.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
tgtctgctcttcctgcttcttc
9.801
14-589-6816.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaatggctac
10.121
attaatgctgaaattggggcca
10.131
22-735-7613.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
aagaaggctgttaaggctgccg
11.481

103 motifs = 71 101 0 0 thresholds = 9.133 ||8.486 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-657-6443.340000e+03YGR108W2.350000e+03NaNNaNNaN
gctctcacaaaa
9.73-1
ggcacgacctt
10.48-1
13-499-4006.163000e+03YPL242C6.071000e+03NaNNaNNaN
ttttgatagaga
10.401
gggaccaccta
8.65-1
16-890-9631.065000e+03YHR023W2.624000e+03NaNNaNNaN
gcttttacaaag
9.13-1
aaggtcatggc
9.351
17-183-2242.557000e+03YDR150W1.135000e+03NaNNaNNaN
ctttgacggaga
10.021
ggcaggacctt
9.56-1

104 motifs = 72 131 0 0 thresholds = 8.401 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-674-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcatctttggt
11.05-1
gtcttggtcatctttggtg
10.531
2-755-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccatcgttggt
9.28-1
gtcttggtcatctttggtg
10.531
14-467-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatcgttggt
9.28-1
gatttgggcaacaatgcgg
11.301
22-707-6913.587000e+03YJL051W3.103000e+03NaNNaNNaN
accgaagatgcc
9.151
caccgaagatgccgttgtc
9.97-1
29-280-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
tctcgagggtgcccctttc
10.46-1

105 motifs = 79 86 0 0 thresholds = 7.791 ||8.949 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-622-5635.551000e+03YOR025W5.449000e+03NaNNaNNaN
ctgaggagactttggc
9.13-1
ttatgatgctggtgctgcag
12.051
22-664-7533.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
tgttaaggctgccgctgaag
10.171
23-585-5721.613000e+03YKL130C3.580000e+03NaNNaNNaN
atacggtgcctgttgc
8.87-1
ctgttgcagcgacaggggca
8.951
32-768-8186.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

106 motifs = 88 115 0 0 thresholds = 9.284 ||8.577 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
13-760-8016.163000e+03YPL242C6.071000e+03NaNNaNNaN
tttgaaaaagcattat
12.07-1
tgcgaatgcgccggcgta
9.951
22-87-663.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaaagcatttccaaa
10.431
tgcatttgcccttgagca
10.841
23-484-4131.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttggaagtgcaacag
10.42-1
ttagcttctgcattggca
9.34-1
28-270-3194.588000e+03YML119W4.464000e+03NaNNaNNaN
ttttaaagtgctttgt
10.59-1
tgcccagtggcaattgcc
9.74-1

107 motifs = 92 95 0 0 thresholds = 7.901 ||9.232 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-465-4126.076000e+03YPL155C5.983000e+03NaNNaNNaN
gatgccttcttgcg
8.721
ggccatcgttggtgatg
11.01-1
19-398-3224.529000e+03YML064C4.404000e+03NaNNaNNaN
ttcacaccggcacc
9.65-1
ggacatccatgctgctc
10.97-1
20-757-7265.680000e+02YCL063W6.040000e+02NaNNaNNaN
ttccagtaggcacc
10.77-1
gggcaccggtgttcctg
10.19-1
29-359-3254.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggtgcccctttcgg
9.431
gaagagcaccgattgcc
11.111

108 motifs = 93 114 0 0 thresholds = 8.769 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-751-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgttggtaaag
9.22-1
attatgtcttggtcatctttggtgg
10.121
3-684-6745.116000e+03YNL172W5.001000e+03NaNNaNNaN
caccatcggcaaag
10.18-1
tcaccatcggcaaagtacctttcca
9.721
14-949-8876.076000e+03YPL155C5.983000e+03NaNNaNNaN
cgccattcaacaag
9.10-1
atggcggtgaagccacctttggtgg
11.171
29-298-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccccatccggaaag
9.79-1
tccccatcgagtggcagtagttctt
10.341

109 motifs = 107 116 0 0 thresholds = 9.839 ||9.616 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
15-610-6381.368000e+03YIL106W2.938000e+03NaNNaNNaN
tcttctacgcctcttg
10.34-1
cttgcctttgttccct
9.63-1
19-540-5864.529000e+03YML064C4.404000e+03NaNNaNNaN
tctgctaccactcaca
10.39-1
ttttgcttggtttcct
11.95-1
29-579-5464.635000e+03YMR032W4.512000e+03NaNNaNNaN
tcttctacagctgaaa
9.84-1
tttgcgttggttccct
11.94-1
30-965-8875.003000e+03YNL058C4.886000e+03NaNNaNNaN
tctactccatctttca
10.02-1
tttcttatgattccca
10.60-1

110 motifs = 108 114 0 0 thresholds = 8.604 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-749-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatcgttggtaaagcc
11.031
attatgtcttggtcatctttggtgg
10.121
3-659-6745.116000e+03YNL172W5.001000e+03NaNNaNNaN
ctttccagtcgtcgaacgtgcc
8.811
tcaccatcggcaaagtacctttcca
9.721
14-426-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.23-1
ttggcccactggccatcgttggtga
12.221
14-461-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.231
ttggcccactggccatcgttggtga
12.221
23-447-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggacgtttagcgacggtttag
9.071
acgatgatgataatgacgatggcga
12.361

111 motifs = 115 123 0 0 thresholds = 8.577 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-544-4712.989000e+03YGL021W1.995000e+03NaNNaNNaN
tgcaagggcttctgagac
9.771
tcccacaattattcaa
11.90-1
12-266-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgcacagtggcaaatgca
11.04-1
tccctcaattgcgggt
9.50-1
22-897-9483.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgctaaggctgtcggtaa
8.861
tcccacaaggactgga
9.04-1
23-850-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcaactgcaactgcaaa
11.561
tccccccatgggccaa
10.20-1

112 motifs = 128 134 0 0 thresholds = 7.918 ||9.795 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-400-3395.116000e+03YNL172W5.001000e+03NaNNaNNaN
gtcaatgcaagggctcccgcccc
11.431
atatttgcggaaaaggccagcc
10.181
11-896-8436.323000e+03YPR119W6.238000e+03NaNNaNNaN
gcgagtgcattagcacagtggaa
7.921
aaacacgcggaaatagccgcca
11.761
12-268-3145.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgcactgcatgtgtttctgtggc
8.261
tgtctgctcttcctgcttcttc
9.801
23-414-3961.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacggtttagcttctgcattggc
12.791
gcattggcagcaagagcaaaca
10.091
23-495-3961.613000e+03YKL130C3.580000e+03NaNNaNNaN
ggaagtgcaacagttggacccac
10.181
gcattggcagcaagagcaaaca
10.091
23-495-4201.613000e+03YKL130C3.580000e+03NaNNaNNaN
ggaagtgcaacagttggacccac
10.181
gcattggcagcaagagcaaaca
10.091

113 motifs = 11 104 0 0 thresholds = 7.124 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaaacgtaaacaaaa
9.111
5-597-5853.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gaaaaaggtaaacaaca
11.551
7-327-2713.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
gaaaaatgcaacgacaa
12.161
7-327-3693.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
gaaaaatgtgaagtgca
10.391
11-381-2886.323000e+03YPR119W6.238000e+03NaNNaNNaN
atacctcaagaagtaa
7.261
tattctttctttttttc
12.75-1
11-542-5056.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
gaaaaaaaatcaaaata
9.861
16-204-2961.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
gaaaaaaaaatcggaaa
9.451
18-382-3212.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
gaaaaaggtaaacaata
12.271
22-271-2593.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gaaataagtaaacaata
9.741
24-169-1544.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
aaaaaaaaaacagaaaa
9.751
32-659-6406.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

114 motifs = 2 126 0 0 thresholds = 6.900 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
ctcaaaacggcaaaatgtaaa
9.661
2-144-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
ccctttttggtaaaacgtaaa
14.091
5-620-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
cccgatttggaaaaaggtaaa
14.571
12-210-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
gtttgctgttaccacaaaggg
11.201
14-230-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
taatgtcattatatgcgggtag
8.041
tttatccttttccaatagcgg
10.981
15-236-2031.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccactcgtataatatgacaaat
7.641
cccaaaatggaaatatcaaaa
12.061
17-192-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
taatatcgtctttgacggagat
8.831
gtttattattccccaagagag
10.001

115 motifs = 70 143 0 0 thresholds = 7.941 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-582-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctcctccgaaaaagg
10.351
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
ccttttccaatagcg
9.05-1
15-200-2081.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
tacttcccaaaatgg
11.061
21-145-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
cgcttctcaaaaggg
11.371
21-191-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
cgcttctcaaaaggg
11.371
31-387-4416.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cacttcctaaaaaag
10.771

116 motifs = 50 80 0 0 thresholds = 6.445 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-184-2242.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
taaaggaaatgactaaga
10.561
9-562-639YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
tctcgcactttgccgtta
10.04-1
18-249-2612.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
tctttctttctccctata
11.39-1
18-314-2612.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
tctttctttctccctata
11.39-1
23-184-2761.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tcttcgtgcatgcctctt
10.89-1
30-201-2685.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
tctcactttctgccgatt
11.47-1

117 motifs = 3 140 0 0 thresholds = 4.837 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-358-3424.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
ttaggaaggaaaataataaaga
9.381
7-416-3233.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
cgaaagaggcaaaacgtaaata
14.111
9-179-209YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tgtttatatatttcctatttga
14.841
12-128-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
cacaaagggtaaaacgtcaata
11.971
14-245-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tgtttatccttttccaatagcg
13.931
17-86-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
gttct
4.84-1
tgtttattattccccaagagag
13.061
18-89-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
18-114-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
18-149-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
22-191-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ctttttgggaaataagtaaaca
15.071
22-290-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ctttttgggaaataagtaaaca
15.071
22-340-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ctttttgggaaataagtaaaca
15.071
26-527-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ccaaacgggcaaaatataaata
13.831
32-622-6486.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

118 motifs = 34 79 0 0 thresholds = 5.648 ||7.791 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-376-4334.121000e+03YLR131C3.983000e+03NaNNaNNaN
cggcaaaatgta
5.661
gagagcggctcgtcag
8.571
14-161-1136.076000e+03YPL155C5.983000e+03NaNNaNNaN
cggaacaattga
5.761
gaaataggctgcagag
8.661
22-614-6333.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
cttgggtgacactcac
9.42-1
22-614-6643.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
cttgggtgacactcac
9.42-1
24-112-484.047000e+03YLR057W3.908000e+03NaNNaNNaN
aggcaaatagga
5.821
gaaaaaggccgccact
8.941
31-923-9336.062000e+03YPL141C5.969000e+03NaNNaNNaN
ccgaccacggga
6.421
gacaagggctccgacc
8.361
32-690-7686.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

119 motifs = 50 72 0 0 thresholds = 6.445 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3274.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
gacacttttggt
10.45-1
2-55-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
gccctttttggt
10.21-1
2-100-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
gccctttttggt
10.21-1
2-184-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
gccctttttggt
10.21-1
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaa
9.501
10-715-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
cccaaagaggaa
9.501
16-135-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggta
8.901
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggta
8.901
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ttcctttttggg
9.32-1
23-184-2691.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
accaaaagtgca
9.611
29-213-2214.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ttcccttttggg
9.31-1
29-213-2804.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
gcccctttcggt
9.02-1
29-434-3464.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
gcccctttcggt
9.02-1
29-896-9354.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacata
7.881
tacaactttggg
8.52-1

120 motifs = 3 138 0 0 thresholds = 4.837 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-483-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
8-483-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
8-567-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
8-567-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
9-179-219YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tttcctatttgag
8.291
19-145-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
agaac
4.841
cccagaagggaaa
9.19-1
21-134-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ttcccttttcggg
8.161
22-191-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttggg
10.941
22-290-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttggg
10.941
22-340-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttggg
10.941
23-871-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
ccccatgggccaa
8.11-1
26-449-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttgcccgtttggg
9.61-1
26-527-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttgcccgtttggg
9.61-1
26-527-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
cccaaacgggcaa
9.61-1
28-193-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
agaac
4.841
tttccagattagg
9.001
29-374-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
tttccggatgggg
10.33-1
29-374-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ccccatccggaaa
10.331
29-374-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ccccatccggaaa
10.33-1
29-397-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
ccccatccggaaa
10.33-1
32-622-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

121 motifs = 83 121 0 0 thresholds = 9.139 ||8.435 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-841-8653.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
tgatgccagggt
10.361
12-943-9265.551000e+03YOR025W5.449000e+03NaNNaNNaN
ggccgccgagcacgct
9.451
tgctgctgatgt
9.211
19-446-3974.529000e+03YML064C4.404000e+03NaNNaNNaN
agcgtggcaatcatca
9.78-1
acaccggcacca
9.72-1
23-382-4101.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
gcattggcagca
10.33-1

122 motifs = 3 111 0 0 thresholds = 4.837 ||9.158 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-245-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
gggtagcccgatgatgcggctc
11.961
20-620-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
cagcagcaaaaccggcattacc
11.911
31-875-9086.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
gggctccgaccacgggacaacc
9.381
32-622-7176.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

123 motifs = 69 85 0 0 thresholds = 8.609 ||8.241 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-396-3015.116000e+03YNL172W5.001000e+03NaNNaNNaN
atgcaagggctcc
9.111
cagcctcgcagtatttcaccaat
10.231
3-396-3675.116000e+03YNL172W5.001000e+03NaNNaNNaN
atgcaagggctcc
9.111
gctcccgccccaaaagttcctat
11.351
12-379-2955.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
cttccctgttcgtttttccctct
11.041
22-735-6403.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
cttccatcttcgatgcctccgct
10.361
30-927-9445.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctgcagtggacca
8.631
catcccaccagaaaataacccgt
10.521

124 motifs = 73 129 0 0 thresholds = 8.401 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-232-2185.200000e+02YCL014W5.570000e+02NaNNaNNaN
gagcgattgccagt
11.13-1
ccagttgccaagacctagg
9.21-1
9-520-572YBR038W2.730000e+02NaNNaNNaN
gcgccattgccact
11.52-1
ccatttgactgccataagc
10.04-1
14-481-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttg
9.701
ccactggccatcgttggtg
9.82-1
28-330-3444.588000e+03YML119W4.464000e+03NaNNaNNaN
agtggcaattgccg
9.631
tttaaatggtgcccagtgg
11.891

125 motifs = 79 99 0 0 thresholds = 7.791 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-704-6885.116000e+03YNL172W5.001000e+03NaNNaNNaN
cgaaggcgccactggg
8.81-1
cttcaccatcggc
9.23-1
3-786-6885.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttggcagccattggc
9.78-1
cttcaccatcggc
9.23-1
9-816-763YBR038W2.730000e+02NaNNaNNaN
ggaagggtcccccaag
10.111
cttcagcctcctt
8.76-1
22-633-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
gaagatgccgttg
9.001
22-664-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
gaagatgccgttg
9.001
29-349-2694.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
accgaagcggaag
8.491

126 motifs = 79 100 0 0 thresholds = 7.791 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-816-754YBR038W2.730000e+02NaNNaNNaN
ggaagggtcccccaag
10.111
cttcagcctccttctgtgtttc
10.391
19-408-3564.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
ctaccgcgtccttcccatttac
11.711
22-633-6473.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
ctcacgcttccatcttcgatgc
10.701
22-664-6473.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
ctcacgcttccatcttcgatgc
10.701
22-664-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
gctgttaaggctgccgctgaag
9.551
29-349-2784.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
taacagcggaccgaagcggaag
8.821

127 motifs = 79 126 0 0 thresholds = 7.791 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-433-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
gagagcggctcgtcag
8.571
ctcaaaacggcaaaatgtaaa
9.661
11-641-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
cttcggtgcctgtccc
9.51-1
cctctttggggaaaagagaaa
12.891
11-641-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cttcggtgcctgtccc
9.51-1
ccgaatcaggaaaaggtcaac
10.221
14-113-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
gaaataggctgcagag
8.661
tttatccttttccaatagcgg
10.981
29-349-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
cccttttgggtaacagcggac
11.701

128 motifs = 85 99 0 0 thresholds = 8.241 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-750-763YBR038W2.730000e+02NaNNaNNaN
cagcctccttctgtgtttccaat
11.081
cttcagcctcctt
8.76-1
12-295-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttccctgttcgtttttccctct
11.041
catcaccttcctt
10.61-1
22-640-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttccatcttcgatgcctccgct
10.361
gaagatgccgttg
9.001
30-944-9675.003000e+03YNL058C4.886000e+03NaNNaNNaN
catcccaccagaaaataacccgt
10.521
ctactccatcttt
10.61-1

129 motifs = 98 114 0 0 thresholds = 8.863 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-387-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggacaaagataataa
10.661
tcaccatcgtggtgctctttgtcat
15.031
5-799-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgcttacttttatcc
9.00-1
tctccattgttctcgtattcttcct
13.501
11-545-5666.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
atggaaaatataacctctttgggga
14.031
21-473-4941.420000e+03YIL158W2.990000e+03NaNNaNNaN
gtgaaaaagtaaaca
9.551
atggaagtgatgaaaacgatggtga
14.641

130 motifs = 103 131 0 0 thresholds = 8.603 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-642-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccctcgaggaaata
9.971
gaaaaggtcaacaacgaag
12.341
22-594-6913.587000e+03YJL051W3.103000e+03NaNNaNNaN
gatttcctggtacg
10.24-1
caccgaagatgccgttgtc
9.97-1
29-281-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
tctcgagggtgcccctttc
10.46-1
32-655-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

131 motifs = 106 124 0 0 thresholds = 8.489 ||8.970 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
17-185-2772.557000e+03YDR150W1.135000e+03NaNNaNNaN
gtctttgacggagatgcgggtg
9.051
ctttaggaaccat
10.71-1
20-631-6855.680000e+02YCL063W6.040000e+02NaNNaNNaN
ctgttgcagcagcaaaaccggc
9.121
cagtaggcaccac
10.04-1
23-411-4741.613000e+03YKL130C3.580000e+03NaNNaNNaN
gtttagcttctgcattggcagc
8.681
cagttggacccac
9.86-1
29-983-8964.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaagttttagaagtagcagaag
9.801
cattagggtcaat
8.97-1

132 motifs = 116 131 0 0 thresholds = 9.616 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
13-457-5296.163000e+03YPL242C6.071000e+03NaNNaNNaN
tggtaatcatagaaaa
10.821
cgacaaggatttccaaatc
10.41-1
22-600-6913.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtcaagttgatttcct
9.62-1
caccgaagatgccgttgtc
9.97-1
30-216-3135.003000e+03YNL058C4.886000e+03NaNNaNNaN
cttaatatgatttcct
10.18-1
gtataggggaacctggtga
9.531
32-555-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

133 motifs = 117 129 0 0 thresholds = 7.961 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-813-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
ccactccctcgtcgatgttcacct
10.291
ccattggccatcaacaata
11.96-1
14-428-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgggcaacaatgcggttggtttgg
10.601
ccactggccatcgttggtg
9.82-1
22-715-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgggttacaccgaagatgccgttg
11.531
ccaattgtctccaaagttc
9.19-1
23-826-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
caactgcaactgcaaacataccaa
9.981
ccatgggccaaccaaagga
9.95-1

134 motifs = 118 126 0 0 thresholds = 9.133 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-683-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
gggcggtttttcactacc
9.20-1
cccaaagaggaaaaacatcaa
11.511
11-647-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
cctctttggggaaaagagaaa
12.891
11-647-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
ccgaatcaggaaaaggtcaac
10.221
12-247-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgcatgtgtttctgtggc
11.57-1
gtttgctgttaccacaaaggg
11.201
29-386-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtggcagtagttcttccc
9.561
cccttttgggtaacagcggac
11.701

135 motifs = 118 140 0 0 thresholds = 9.133 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-290-3424.345000e+03YLR353W4.215000e+03NaNNaNNaN
tggaagctttccagtcgc
11.35-1
ttaggaaggaaaataataaaga
9.381
10-683-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
gggcggtttttcactacc
9.20-1
tgtttacaaccgcccaaagagg
9.941
11-647-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
ctctttggggaaaagagaaata
12.921
11-647-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
caaaaaaggagatttgtaaata
13.861
11-647-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
tggatgaacttcggtgcc
9.13-1
caaaaaaggagatttgtaaata
13.861
12-247-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgcatgtgtttctgtggc
11.57-1
cacaaagggtaaaacgtcaata
11.971

136 motifs = 123 128 0 0 thresholds = 9.040 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-471-5492.989000e+03YGL021W1.995000e+03NaNNaNNaN
tcccacaattattcaa
11.90-1
gtagatgcaagggcttctgagac
12.951
12-226-2685.551000e+03YOR025W5.449000e+03NaNNaNNaN
tccctcaattgcgggt
9.50-1
tgcactgcatgtgtttctgtggc
8.261
23-797-8371.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccccccatgggccaa
10.20-1
gagacaactgcaactgcaactgc
11.791
23-797-8491.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccccccatgggccaa
10.20-1
gagacaactgcaactgcaactgc
11.79-1
29-844-8304.635000e+03YMR032W4.512000e+03NaNNaNNaN
tagctgccttgtcgga
9.211
gaagctgcatgagcgtcgctgac
10.281

137 motifs = 124 128 0 0 thresholds = 8.970 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
13-403-3326.163000e+03YPL242C6.071000e+03NaNNaNNaN
cactcgggaccac
9.73-1
gacaattctgcctttgcatttga
10.671
20-685-6525.680000e+02YCL063W6.040000e+02NaNNaNNaN
cagtaggcaccac
10.04-1
gctgttgcagcagcaaaaccggc
12.881
23-474-4141.613000e+03YKL130C3.580000e+03NaNNaNNaN
cagttggacccac
9.86-1
gacggtttagcttctgcattggc
12.791
23-474-4951.613000e+03YKL130C3.580000e+03NaNNaNNaN
cagttggacccac
9.86-1
ggaagtgcaacagttggacccac
10.181
29-896-8304.635000e+03YMR032W4.512000e+03NaNNaNNaN
cattagggtcaat
8.97-1
gaagctgcatgagcgtcgctgac
10.281

138 motifs = 127 144 0 0 thresholds = 8.346 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-564-6632.989000e+03YGL021W1.995000e+03NaNNaNNaN
gagggagaatacagag
8.611
gggtttggtggtgatg
10.211
12-587-6815.551000e+03YOR025W5.449000e+03NaNNaNNaN
gaggatgacgatgagg
9.741
ggcggtgtccattttg
11.621
20-699-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
cattctcttctttgtc
9.73-1
caaaaccggcattacc
10.68-1
23-369-3571.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatgatgataatg
11.231
ggcgatgatgatgatg
10.051

139 motifs = 50 135 0 0 thresholds = 6.445 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-55-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
cctttttggtaa
11.36-1
2-184-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
cctttttggtaa
11.36-1
8-503-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaagg
11.361
11-772-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
ccgtttaggaaa
9.51-1
22-252-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
cctttttgggaa
10.21-1
29-213-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccttttgggtaa
10.95-1

140 motifs = 58 60 0 0 thresholds = 8.547 ||9.277 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-626-5643.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
cgtcaacggtaactt
9.281
20-132-2225.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
acatttccgctgggg
9.80-1
25-221-1894.074000e+03YLR084C3.935000e+03NaNNaNNaN
aaaaaaagaaa
10.551
catcatcagaagtct
11.301
29-223-2684.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccgaagcggaagcgt
9.901
29-282-2684.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccgaagcggaagcgt
9.901
32-251-2336.360000e+03YPR156C6.278000e+03NaNNaNNaN
tttgctctttt
9.11-1
n
NaNNaN
32-296-2336.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

141 motifs = 99 108 0 0 thresholds = 8.494 ||8.604 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-758-7492.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatcgtt
10.42-1
catcgccatcgttggtaaagcc
11.031
2-960-9512.989000e+03YGL021W1.995000e+03NaNNaNNaN
cttctccttctgt
9.87-1
cttctccttctgttgttttgcc
11.171
3-688-6595.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatcggc
9.23-1
ctttccagtcgtcgaacgtgcc
8.811
22-704-6433.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
cgcttccatcttcgatgcctcc
10.061
23-363-4471.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatggcgatg
9.961
gggacgtttagcgacggtttag
9.071
31-614-6056.062000e+03YPL141C5.969000e+03NaNNaNNaN
catatccatcttt
10.05-1
catatccatcttttttactccc
12.061

142 motifs = 24 126 0 0 thresholds = 6.571 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-643-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
cgggtaa
8.37-1
cccgatttggaaaaaggtaaa
14.571
8-576-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
cgggtag
7.291
tctatatgttgcccgggtagg
8.39-1
8-576-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
cgggtag
7.291
tctatatgttgcccgggtagg
8.391
8-592-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacccg
8.371
tctatatgttgcccgggtagg
8.39-1
8-657-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacccg
8.371
tctatatgttgcccgggtagg
8.391
11-793-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgggtaa
8.37-1
ccgaatcaggaaaaggtcaac
10.221
12-224-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
cgggtaa
8.37-1
gtttgctgttaccacaaaggg
11.201
14-210-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
cgggtag
7.29-1
tttatccttttccaatagcgg
10.981
17-164-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
cgggtgg
6.66-1
gtttattattccccaagagag
10.001
28-228-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
cgggtag
7.29-1
ccagattaggaaagaacataa
10.751

143 motifs = 50 58 0 0 thresholds = 6.445 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-140-904.121000e+03YLR131C3.983000e+03NaNNaNNaN
gcaaacaaa
8.301
gaagaaaaaaa
9.091
2-55-1112.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaagataaa
10.791
2-100-1112.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaagataaa
10.791
2-100-1902.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaagataaa
10.791
2-184-1112.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
aaaaagataaa
10.791
2-184-1902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
aaaaagataaa
10.791
4-175-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
4-191-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
5-536-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaaggtaaa
10.691
5-578-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaaggtaaa
10.691
6-577-5834.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ttttttttttt
10.91-1
6-577-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ttttttttttt
10.91-1
8-156-2194.603000e+03YMR001C4.479000e+03NaNNaNNaN
gtacacaaa
6.471
aaaaaagaaaa
10.811
8-156-2254.603000e+03YMR001C4.479000e+03NaNNaNNaN
gtacacaaa
6.471
aaaaaagaaaa
10.811
10-636-6263.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
caaagaggaaa
8.691
10-715-6263.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
caaagaggaaa
8.691
12-184-1745.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
caaagggtaaa
8.931
13-182-1956.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaaagaggaaa
9.751
13-239-1956.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaaagaggaaa
9.751
15-573-5911.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
tttactctttt
9.85-1
16-135-881.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
tttttttcttg
8.91-1
16-184-881.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
tttttttcttg
8.91-1
16-490-4841.065000e+03YHR023W2.624000e+03NaNNaNNaN
ctaaacaaa
7.501
aaaaagataaa
10.791
18-249-3202.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
aaaaaggtaaa
10.691
18-314-3202.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
aaaaaggtaaa
10.691
19-166-1564.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1724.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1814.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
20-79-1325.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
gaaaagagaaa
9.811
20-286-3795.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
aaaaagagaaa
10.701
20-364-3795.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
aaaaagagaaa
10.701
21-225-1691.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
caaaagggaaa
9.531
21-225-1921.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
caaaagggaaa
9.531
22-252-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttt
10.37-1
23-184-1971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
ttttttttttt
10.91-1
23-837-8811.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
aaaaaaataaa
10.651
23-960-8811.613000e+03YKL130C3.580000e+03NaNNaNNaN
gtaaagaaa
7.171
aaaaaaataaa
10.651
29-89-1314.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcaaacaat
7.821
gaaagaggaaa
8.871
29-213-1314.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
gaaagaggaaa
8.871
29-213-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tttcccttttg
9.53-1
29-213-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tttcccttttg
9.53-1
29-434-4824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
tttgcttcttt
8.87-1
30-95-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
aatgtttat
7.39-1
aaaaaaaaaaa
10.911
30-201-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
aaaaaaaaaaa
10.911
31-382-3886.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaaggtaaa
10.691
31-454-3776.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaaggtaaa
10.691
31-454-3886.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaaggtaaa
10.691
31-805-8116.062000e+03YPL141C5.969000e+03NaNNaNNaN
ataaagaaa
6.461
aaaaaaataaa
10.651

144 motifs = 69 99 0 0 thresholds = 8.609 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-7582.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
catcgccatcgtt
10.42-1
12-379-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
catcaccttcctt
10.61-1
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
gaagatgccgttg
9.001
30-927-9675.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctgcagtggacca
8.631
ctactccatcttt
10.61-1

145 motifs = 50 146 0 0 thresholds = 6.445 ||9.895 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-443-3442.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcaacaaa
6.471
aggatgatgcccaaggtagaact
11.631
9-562-604YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
gtaccgcccacaggtactctgct
10.891
25-451-4904.074000e+03YLR084C3.935000e+03NaNNaNNaN
tttggttac
6.47-1
agcatggtcccgattggtgtacg
11.261
29-434-3384.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
ggtgcccctttcggtagtttgcg
10.781

146 motifs = 61 78 0 0 thresholds = 9.103 ||8.229 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-268-2793.852000e+03YJR092W3.372000e+03NaNNaNNaN
gaaataggcgatgata
11.151
ttccgctgcagga
10.671
12-348-3895.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttccttagc
9.64-1
tccttcagaggta
10.90-1
29-661-5804.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcagcgactttttc
10.99-1
ttctacagctgaa
9.35-1
31-328-4266.062000e+03YPL141C5.969000e+03NaNNaNNaN
tttcaaccccttcatc
10.26-1
tcctaaaaaagca
8.98-1

147 motifs = 69 123 0 0 thresholds = 8.609 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-545-4712.989000e+03YGL021W1.995000e+03NaNNaNNaN
atgcaagggcttc
8.611
tcccacaattattcaa
11.90-1
14-905-9636.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaaaggatac
10.691
tccctccattttacaa
10.55-1
17-414-3852.557000e+03YDR150W1.135000e+03NaNNaNNaN
tcctcccctgaag
9.09-1
aggcctagttgaggga
10.331
30-927-8765.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctgcagtggacca
8.631
tcccacaactacacca
11.21-1

148 motifs = 71 126 0 0 thresholds = 9.133 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-541-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctctgtcaaaa
10.31-1
tctatatgttgcccgggtagg
8.39-1
8-541-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctctgtcaaaa
10.31-1
tctatatgttgcccgggtagg
8.391
10-657-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
gctctcacaaaa
9.73-1
cccaaagaggaaaaacatcaa
11.511
17-183-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
ctttgacggaga
10.021
gtttattattccccaagagag
10.001
20-534-4775.680000e+02YCL063W6.040000e+02NaNNaNNaN
ttttgaaggagc
10.321
cctttccggggaagaattgac
9.981

149 motifs = 77 128 0 0 thresholds = 8.340 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-355-4005.116000e+03YNL172W5.001000e+03NaNNaNNaN
ggccccttcg
8.98-1
gtcaatgcaagggctcccgcccc
11.431
11-993-8966.323000e+03YPR119W6.238000e+03NaNNaNNaN
ctaaggtgcc
8.341
gcgagtgcattagcacagtggaa
7.921
13-799-7016.163000e+03YPL242C6.071000e+03NaNNaNNaN
cgaatgcgcc
9.111
gagttttgtactgttacatcaac
9.861
25-588-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
cgaaggtgac
8.341
ggcagaactacaaaggcaattac
10.671

150 motifs = 82 129 0 0 thresholds = 8.818 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-830-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
ttttccactcc
9.08-1
ccattggccatcaacaata
11.96-1
5-591-6813.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatttggaaaa
10.371
ccattggtcatcctacgag
9.44-1
19-662-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
ttcttcaaacc
9.75-1
ccagtggacttgttaacta
9.12-1
19-776-7594.529000e+03YML064C4.404000e+03NaNNaNNaN
ttcttcaaacc
9.75-1
ccagtggacttgttaacta
9.12-1
23-887-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggttgaaaaa
9.851
ccatgggccaaccaaagga
9.95-1

151 motifs = 83 130 0 0 thresholds = 9.139 ||9.214 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-841-9303.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
ttgttgctgcagtt
9.241
12-458-5555.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgccgaagatcagggt
10.171
ctggtgctgcagtt
11.741
19-446-3964.529000e+03YML064C4.404000e+03NaNNaNNaN
agcgtggcaatcatca
9.78-1
cacaccggcaccac
9.31-1
27-789-8034.497000e+03YML034W4.371000e+03NaNNaNNaN
agcttgttcatcacca
10.68-1
cactacgacaccag
10.52-1

152 motifs = 99 134 0 0 thresholds = 8.494 ||9.795 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-688-7625.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatcggc
9.23-1
aaacttgctgctagggctatca
13.961
12-351-3145.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttcctt
10.61-1
tgtctgctcttcctgcttcttc
9.801
22-704-7613.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
aagaaggctgttaaggctgccg
11.481
23-363-3961.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatggcgatg
9.961
gcattggcagcaagagcaaaca
10.091
23-363-4201.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatggcgatg
9.961
gcattggcagcaagagcaaaca
10.091

153 motifs = 127 133 0 0 thresholds = 8.346 ||8.661 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-435-3425.116000e+03YNL172W5.001000e+03NaNNaNNaN
gagggggagaatgatg
9.681
ccttcgcttcgctgcccca
11.87-1
10-296-2373.340000e+03YGR108W2.350000e+03NaNNaNNaN
gaagaagatactaggg
10.391
tcggccaaacttgagcagg
11.981
17-179-2462.557000e+03YDR150W1.135000e+03NaNNaNNaN
gacggagatgcgggtg
9.711
ttggctcactccgggcagg
9.801
23-360-4491.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatgatgataatg
11.231
tggggacgtttagcgacgg
9.781
23-369-4491.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatgatgataatg
11.231
tggggacgtttagcgacgg
9.781

154 motifs = 75 99 0 0 thresholds = 7.403 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-7582.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.60-1
catcgccatcgtt
10.42-1
6-787-7954.345000e+03YLR353W4.215000e+03NaNNaNNaN
tcctccgctctcg
8.57-1
cttacccttcctc
8.94-1
12-398-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagaggtaaa
7.941
catcaccttcctt
10.61-1
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.82-1
gaagatgccgttg
9.001
29-361-2694.635000e+03YMR032W4.512000e+03NaNNaNNaN
tccccctctcgag
8.53-1
accgaagcggaag
8.491

155 motifs = 115 127 0 0 thresholds = 8.577 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-544-5642.989000e+03YGL021W1.995000e+03NaNNaNNaN
tgcaagggcttctgagac
9.771
gagggagaatacagag
8.611
3-395-4355.116000e+03YNL172W5.001000e+03NaNNaNNaN
tgcaagggctcccgcccc
9.571
gagggggagaatgatg
9.681
12-557-5875.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgctggtgctgcagttta
10.331
gaggatgacgatgagg
9.741
20-653-6995.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagcagcaaa
11.191
cattctcttctttgtc
9.73-1
23-413-3601.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttagcttctgcattggca
9.34-1
gacgatgatgataatg
11.231
23-413-3691.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttagcttctgcattggca
9.34-1
gacgatgatgataatg
11.231

156 motifs = 58 70 0 0 thresholds = 8.547 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-111-1892.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
aaaagataaaca
9.521
2-190-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
aaaacgtaaaca
12.001
4-197-1805.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaata
10.271
6-608-5824.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
aaaaggtaaaca
12.561
7-321-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaagaggcaaa
9.011
aaaacgtaaata
9.711
11-161-1776.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttccttttg
9.89-1
tgttttcctttt
9.79-1
12-174-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
caaagggtaaa
8.931
aaaacgtcaata
8.071
13-195-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaaagaggaaa
9.751
aaagtgtaaaca
11.021
16-484-4951.065000e+03YHR023W2.624000e+03NaNNaNNaN
aaaaagataaa
10.791
aaaggctaaaca
8.171
19-156-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
19-181-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
20-132-965.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
aaaatgtaaaca
12.471
21-169-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
21-169-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
21-192-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
29-131-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaaagaggaaa
8.871
aagttgtaaaca
8.541
29-131-2184.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaaagaggaaa
8.871
tatttccctttt
8.98-1
29-223-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
aagttgtaaaca
8.541
29-223-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tatttccctttt
8.98-1
29-282-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
aagttgtaaaca
8.541
29-282-2184.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tatttccctttt
8.98-1
30-176-2065.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
aaatagtaaaca
10.651
31-377-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaaca
12.561

157 motifs = 83 106 0 0 thresholds = 9.139 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-543-5795.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggttgatggacatggt
11.401
ctctggtgtcaactggatcagc
9.361
5-841-9403.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
gcttttggggttgttgctgcag
12.081
22-675-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
cttcagcggcagccttaacagc
11.71-1
22-675-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
gctgttaaggctgccgctgaag
11.711
22-747-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
cttcagcggcagccttaacagc
11.71-1
23-382-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
gctgacgatgatgataatgacg
9.371
23-382-4111.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
gtttagcttctgcattggcagc
8.681
27-789-8024.497000e+03YML034W4.371000e+03NaNNaNNaN
agcttgttcatcacca
10.68-1
catcatccactacgacaccagc
10.661
31-252-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
tgttgctgatcacggt
11.011
cacctgtttcaaccccttcatc
12.081

158 motifs = 11 118 0 0 thresholds = 7.124 ||9.133 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-632-6833.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
gggcggtttttcactacc
9.20-1
11-689-6476.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tggatgaacttcggtgcc
9.13-1
11-703-6476.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
tggatgaacttcggtgcc
9.13-1
12-166-2475.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
tgcatgtgtttctgtggc
11.57-1
29-291-3864.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
gtggcagtagttcttccc
9.561
29-313-3864.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
gtggcagtagttcttccc
9.561

159 motifs = 11 129 0 0 thresholds = 7.124 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-647-6025.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaccttaactggtga
7.201
taactctggtgtcaactgg
10.771
5-583-6813.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ccattggtcatcctacgag
9.44-1
5-597-6813.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ccattggtcatcctacgag
9.44-1
14-423-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
ccactggccatcgttggtg
9.82-1
26-583-5024.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
ccaattggcaagaaagctc
9.26-1

160 motifs = 62 128 0 0 thresholds = 8.515 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-870-9283.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatagtgatg
9.691
gttgctgcagttggctattactc
8.901
12-354-2685.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttc
10.18-1
tgcactgcatgtgtttctgtggc
8.261
23-360-4141.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
gacggtttagcttctgcattggc
12.791
25-561-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
ggaagtgatg
9.211
ggcagaactacaaaggcaattac
10.671

161 motifs = 80 116 0 0 thresholds = 9.703 ||9.616 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-342-2824.603000e+03YMR001C4.479000e+03NaNNaNNaN
aagcggcagtttcaaaga
11.761
ttctgctttttttcct
11.19-1
18-261-3162.553000e+03YDR146C1.131000e+03NaNNaNNaN
tctttctttctccctata
11.39-1
aggtaaacaataacaa
11.221
23-276-1951.613000e+03YKL130C3.580000e+03NaNNaNNaN
tcttcgtgcatgcctctt
10.89-1
tttttttttttttcat
9.77-1
30-268-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
tctcactttctgccgatt
11.47-1
cttaatatgatttcct
10.18-1
30-858-8875.003000e+03YNL058C4.886000e+03NaNNaNNaN
tattggaatgcactaaga
10.291
tttcttatgattccca
10.60-1

162 motifs = 104 123 0 0 thresholds = 8.780 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-300-2265.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttccctgttcgtttttc
10.48-1
tccctcaattgcgggt
9.50-1
18-321-4122.553000e+03YDR146C1.131000e+03NaNNaNNaN
gaaaaaggtaaacaata
12.271
tagcagcattgttgga
10.561
23-882-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gaaaaaaataaagaacc
9.551
tccccccatgggccaa
10.20-1
31-812-9106.062000e+03YPL141C5.969000e+03NaNNaNNaN
taaaaaaataaagaaaa
9.671
tccgaccacgggacaa
10.49-1

163 motifs = 126 135 0 0 thresholds = 8.394 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-591-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctatatgttgcccgggtagg
8.391
ttacctaaaagg
11.361
11-700-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgaatcaggaaaaggtcaac
10.221
ccgtttaggaaa
9.51-1
26-572-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.731
cctttcgggaaa
10.33-1
29-229-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
ccttttgggtaa
10.95-1

164 motifs = 3 118 0 0 thresholds = 4.837 ||9.133 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-810-8332.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
tggtgggattacggttac
9.86-1
6-358-2904.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
tggaagctttccagtcgc
11.35-1
12-339-2475.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
tgcatgtgtttctgtggc
11.57-1
20-620-6465.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
gcagcagcaaaaccggca
10.741
23-871-8431.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gcaactgcaaacatacca
10.141
23-871-9661.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gtcgcagtaaagaaagcc
10.321
29-374-3864.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
gtggcagtagttcttccc
9.561
29-397-3864.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
gtggcagtagttcttccc
9.561

165 motifs = 59 83 0 0 thresholds = 8.576 ||9.139 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-928-8413.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttgctgcagttg
10.361
ggatgttggacaagtt
9.351
12-925-9435.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctgctgatgttg
10.851
ggccgccgagcacgct
9.451
19-395-4464.529000e+03YML064C4.404000e+03NaNNaNNaN
caccggcaccacc
9.42-1
agcgtggcaatcatca
9.78-1
22-749-6753.587000e+03YJL051W3.103000e+03NaNNaNNaN
aaggctgccgctg
9.151
ggctgccgctgaaggt
10.421
23-354-3821.613000e+03YKL130C3.580000e+03NaNNaNNaN
catcgtcagcact
9.67-1
tgctgacgatgatgat
10.381

166 motifs = 98 106 0 0 thresholds = 8.863 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-489-5795.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
ctctggtgtcaactggatcagc
9.361
4-657-5795.200000e+02YCL014W5.570000e+02NaNNaNNaN
gacttgtctttgtcc
8.97-1
ctctggtgtcaactggatcagc
9.361
5-799-8373.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgcttacttttatcc
9.00-1
gttggacaagttgttgatgttc
9.331
12-169-775.551000e+03YOR025W5.449000e+03NaNNaNNaN
ggtaaaacgtcaata
10.601
gtggttagtggtgtaaaaactg
8.721
14-168-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttttcc
9.46-1
gggtagcccgatgatgcggctc
8.491
21-473-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
gtgaaaaagtaaaca
9.551
gatgaaaacgatggtgaaaaag
10.661

167 motifs = 69 94 0 0 thresholds = 8.609 ||8.391 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-270-2843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgcag
9.54-1
gaagcttccgctg
9.251
14-905-8796.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaaaggatac
10.691
gaagccacctttg
9.311
22-735-6503.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
gaagatgccgttg
9.851
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
gaagatgccgttg
9.851
29-438-4754.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
gtagctgccaaag
8.731

168 motifs = 121 141 0 0 thresholds = 8.435 ||8.805 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-865-8803.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgatgccagggt
10.361
tcgtattcttcctcg
9.93-1
12-560-5885.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgatgctggtgc
8.871
ggatgacgatgagga
10.161
12-685-5885.551000e+03YOR025W5.449000e+03NaNNaNNaN
tggtggcggtgt
8.471
ggatgacgatgagga
10.161
22-546-5183.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgttgccaaggc
9.861
tgatgaggataatga
9.801
23-410-3551.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcattggcagca
10.33-1
cgatgatgataatga
12.201
23-410-3761.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcattggcagca
10.33-1
cgatgatgataatga
12.201

169 motifs = 15 100 0 0 thresholds = 6.639 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-903-9403.852000e+03YJR092W3.372000e+03NaNNaNNaN
tccattgttc
6.651
gcttttggggttgttgctgcag
9.011
18-785-8482.553000e+03YDR146C1.131000e+03NaNNaNNaN
tctattgttt
7.281
ctgctactactttcgtacaaac
10.521
22-633-6473.587000e+03YJL051W3.103000e+03NaNNaNNaN
ccaattgtct
7.031
ctcacgcttccatcttcgatgc
10.701
24-505-5514.047000e+03YLR057W3.908000e+03NaNNaNNaN
ctcattgttt
6.941
ctacaactacggtcaattcacc
9.041

170 motifs = 70 114 0 0 thresholds = 7.941 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-177-1606.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgttttcctttt
9.79-1
tagattcttttaacgacattggaga
11.981
14-429-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
tatttacgattt
8.46-1
ttggcccactggccatcgttggtga
12.221
21-470-4941.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaaagtaaaca
11.911
atggaagtgatgaaaacgatggtga
14.641
29-283-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
tccccatcgagtggcagtagttctt
10.341

171 motifs = 80 132 0 0 thresholds = 9.703 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-187-1184.345000e+03YLR353W4.215000e+03NaNNaNNaN
tctaggcgattaccggta
9.70-1
tattttaattcaatttagactat
10.481
8-342-2724.603000e+03YMR001C4.479000e+03NaNNaNNaN
aagcggcagtttcaaaga
11.761
tgctttttttcctattttttcat
13.481
14-230-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tctatgctgctgcccata
9.95-1
aagcagaagcgaaaaataaaaag
10.911
14-230-3026.076000e+03YPL155C5.983000e+03NaNNaNNaN
tctatgctgctgcccata
9.95-1
ataagtagataacaataaaaaaa
11.111
30-268-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
tctcactttctgccgatt
11.47-1
ataaaacatttgtaaaaaaaaaa
13.531

172 motifs = 81 86 0 0 thresholds = 9.103 ||8.949 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-928-9383.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttgctgcagttgg
10.191
ttttggggttgttgctgcag
12.401
17-606-6162.557000e+03YDR150W1.135000e+03NaNNaNNaN
gcagctgcagtacg
10.861
taaggatttggcagctgcag
10.891
20-640-6595.680000e+02YCL063W6.040000e+02NaNNaNNaN
gctgttgcagcagc
9.83-1
ttgacatgctgttgcagcag
10.921
29-757-8404.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgtacttcaacttc
10.16-1
tgccttgtcggaagctgcat
9.541

173 motifs = 11 103 0 0 thresholds = 7.124 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-589-5114.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
gatttactcatccg
9.10-1
11-689-6426.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccctcgaggaaata
9.971
11-703-6426.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccctcgaggaaata
9.971
22-271-2613.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttttcctttttgg
9.51-1
26-583-5554.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cctttcgggaaata
10.011
29-218-2814.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
tatttcccttttgg
11.04-1
29-277-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
tatttcccttttgg
11.04-1
29-291-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttcccttttgg
11.04-1
29-291-2814.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttcccttttgg
11.04-1
29-313-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttcccttttgg
11.04-1
29-313-2814.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttcccttttgg
11.04-1
30-220-2105.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gatttcctaaagcg
10.01-1

174 motifs = 50 69 0 0 thresholds = 6.445 ||8.609 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-338-2703.852000e+03YJR092W3.372000e+03NaNNaNNaN
acaaacaaa
7.591
gcttccgctgcag
9.54-1
5-578-5323.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
atgcaaaggaaac
9.851
10-406-3793.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttgt
7.59-1
tcttcctctgcag
10.01-1
13-239-3366.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
tctgcctttgcat
9.11-1
15-573-6331.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
tgttcccttgaat
9.31-1
22-252-1723.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ttatcctttgaag
10.16-1
29-896-9814.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacata
7.881
gattcttttgaag
8.85-1

175 motifs = 103 138 0 0 thresholds = 8.603 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-628-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccaaagaggaaaaa
9.761
cccaaagaggaaa
10.81-1
11-642-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccctcgaggaaata
9.971
cccgtttaggaaa
10.12-1
15-202-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccaaaatggaaata
10.251
cccaaaatggaaa
10.60-1
22-261-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttttgg
9.51-1
tttcctttttggg
10.941
26-555-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
ttgcccgtttggg
9.61-1
26-555-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
cccaaacgggcaa
9.61-1
29-222-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-222-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
tttccggatgggg
10.33-1
29-222-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.331
29-222-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-281-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-281-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.331
29-281-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
32-655-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

176 motifs = 127 140 0 0 thresholds = 8.346 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-375-3233.084000e+03YGL116W2.089000e+03NaNNaNNaN
gaaagtgaaaaatgtg
10.631
cgaaagaggcaaaacgtaaata
14.111
9-307-209YBR038W2.730000e+02NaNNaNNaN
cccgtttatttccttc
9.79-1
tgtttatatatttcctatttga
14.841
10-296-2263.340000e+03YGR108W2.350000e+03NaNNaNNaN
gaagaagatactaggg
10.391
tttttacattcggccaaacttg
11.011
17-179-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
gacggagatgcgggtg
9.711
tgtttattattccccaagagag
13.061
30-276-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctcccttctcactttc
9.60-1
ctaaagcgggaaatagtaaaca
14.881

177 motifs = 58 126 0 0 thresholds = 8.547 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-190-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
ccctttttggtaaaacgtaaa
14.091
5-584-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
cccgatttggaaaaaggtaaa
14.571
11-509-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
gttaattttttgccaatttag
8.761
11-509-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
cctctttggggaaaagagaaa
12.891
11-543-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
gttaattttttgccaatttag
8.761
11-543-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
cctctttggggaaaagagaaa
12.891
14-170-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
tttatccttttccaatagcgg
10.981
18-320-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaaggtaaa
10.691
cctgtttaggaaaaaggtaaa
14.631
20-379-4775.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaaaagagaaa
10.701
cctttccggggaagaattgac
9.981
21-169-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttgacaaatttcctagttaag
8.571
21-192-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttgacaaatttcctagttaag
8.571
25-221-2814.074000e+03YLR084C3.935000e+03NaNNaNNaN
aaaaaaagaaa
10.551
ttgacaaattcccaaattagg
10.111
28-144-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
aaagaaagaaa
9.611
ccagattaggaaagaacataa
10.751
29-131-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaaagaggaaa
8.871
ctgtatgagggaaagaggaaa
8.711
29-131-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaaagaggaaa
8.871
cccttttgggtaacagcggac
11.701
29-223-1414.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ctgtatgagggaaagaggaaa
8.711
29-223-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
cccttttgggtaacagcggac
11.701
29-282-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
cccttttgggtaacagcggac
11.701
30-176-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
cctaaagcgggaaatagtaaa
9.461
32-645-6566.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

178 motifs = 65 138 0 0 thresholds = 9.209 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-628-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaagagacatt
10.841
cccgatttggaaa
10.48-1
8-529-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
aaaagggtcaaa
9.581
ttacctaaaaggg
8.851
16-198-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
aaaagggtaatt
10.801
cccaaaagggtaa
9.42-1
21-170-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttcccttttcggg
8.161
21-191-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttcccttttcggg
8.161
29-283-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ccccatccggaaa
10.33-1
29-283-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ccccatccggaaa
10.331
29-283-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ccccatccggaaa
10.33-1

179 motifs = 69 75 0 0 thresholds = 8.609 ||7.403 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-545-5692.989000e+03YGL021W1.995000e+03NaNNaNNaN
atgcaagggcttc
8.611
ccgcagagggaga
9.711
3-396-4405.116000e+03YNL172W5.001000e+03NaNNaNNaN
atgcaagggctcc
9.111
caagagaggggga
8.251
12-379-3985.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
cttcagaggtaaa
7.941
29-438-3614.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
tccccctctcgag
8.53-1

180 motifs = 85 116 0 0 thresholds = 8.241 ||9.616 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
22-640-6003.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttccatcttcgatgcctccgct
10.361
gtcaagttgatttcct
9.62-1
29-611-5464.635000e+03YMR032W4.512000e+03NaNNaNNaN
cctccaccagaagtctttcctat
9.051
tttgcgttggttccct
11.94-1
30-944-8875.003000e+03YNL058C4.886000e+03NaNNaNNaN
catcccaccagaaaataacccgt
10.521
tttcttatgattccca
10.60-1
32-572-5556.360000e+03YPR156C6.278000e+03NaNNaNNaN
gatccctgatccatagagccatt
9.78-1
n
NaNNaN

181 motifs = 65 126 0 0 thresholds = 9.209 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-628-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaagagacatt
10.841
cccgatttggaaaaaggtaaa
14.571
8-529-5914.603000e+03YMR001C4.479000e+03NaNNaNNaN
aaaagggtcaaa
9.581
tctatatgttgcccgggtagg
8.391
11-542-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaagagaaata
11.461
gttaattttttgccaatttag
8.761
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaagagaaata
11.461
cctctttggggaaaagagaaa
12.891
21-170-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttgacaaatttcctagttaag
8.571
21-191-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttgacaaatttcctagttaag
8.571
25-265-2814.074000e+03YLR084C3.935000e+03NaNNaNNaN
aattcctctttt
10.94-1
ttgacaaattcccaaattagg
10.111
29-283-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
cccttttgggtaacagcggac
11.701

182 motifs = 58 138 0 0 thresholds = 8.547 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-190-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaaagataaa
10.791
ccctttttggtaa
8.51-1
10-626-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
cccaaagaggaaa
10.81-1
19-156-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
cccagaagggaaa
9.19-1
19-172-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
cccagaagggaaa
9.19-1
19-181-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
cccagaagggaaa
9.19-1
21-169-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttcccttttcggg
8.161
21-192-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttcccttttcggg
8.161
22-262-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttt
10.37-1
tttcctttttggg
10.941
23-881-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
aaaaaaataaa
10.651
ccccatgggccaa
8.11-1
28-144-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
aaagaaagaaa
9.611
tttccagattagg
9.001
29-223-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1
29-223-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tttccggatgggg
10.33-1
29-223-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.331
29-223-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1
29-282-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1
29-282-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.331
29-282-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1
29-482-5374.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttgcttcttt
8.87-1
ccctatatgcaaa
9.01-1

183 motifs = 3 125 0 0 thresholds = 4.837 ||9.554 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-534-4414.121000e+03YLR131C3.983000e+03NaNNaNNaN
gttct
4.84-1
ggggcactgagagcggctc
10.211
17-86-502.557000e+03YDR150W1.135000e+03NaNNaNNaN
gttct
4.84-1
gacgcaacggtcaaggctt
10.071
22-938-8963.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
catcctctaccggtgctgc
11.40-1
23-871-7991.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
ccccctccccccatgggcc
9.64-1

184 motifs = 58 84 0 0 thresholds = 8.547 ||9.578 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
23-881-9621.613000e+03YKL130C3.580000e+03NaNNaNNaN
aaaaaaataaa
10.651
cagtaaagaaagcctcc
9.771
27-456-4994.497000e+03YML034W4.371000e+03NaNNaNNaN
ttttttttttt
10.91-1
taattctgcctgtagag
10.37-1
29-223-2684.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccgaagcggaagcgttc
11.621
29-282-2684.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccgaagcggaagcgttc
11.621
32-251-2336.360000e+03YPR156C6.278000e+03NaNNaNNaN
tttgctctttt
9.11-1
n
NaNNaN
32-296-2336.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

185 motifs = 98 132 0 0 thresholds = 8.863 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-108-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtaaaacgtaaaca
11.721
tttggtaaaacgtaaacaaaata
10.651
3-182-2495.116000e+03YNL172W5.001000e+03NaNNaNNaN
tatttacatttgcac
9.04-1
tactttttttcatttttatcgct
12.741
4-387-4455.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggacaaagataataa
10.661
tagtttatttttcacttttttct
10.251
4-489-4455.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tagtttatttttcacttttttct
10.251
6-585-5474.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
tttttttttttttcataagggaa
12.14-1
6-585-5994.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
tttttttttttttcataagggaa
12.141
11-545-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
agaaaggaaaaaaaatcaaaata
13.161
14-168-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttttcc
9.46-1
aagcagaagcgaaaaataaaaag
10.911
26-572-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.701
tattttatttctagataaaccct
11.361
26-580-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.70-1
tattttatttctagataaaccct
11.361
26-650-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
tattttatttctagataaaccct
11.361
30-209-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
gggaaatagtaaaca
8.881
ataaaacatttgtaaaaaaaaaa
13.531
30-514-4305.003000e+03YNL058C4.886000e+03NaNNaNNaN
tattggtattttgcc
10.77-1
tcttttttttaattctggaaaat
10.091

186 motifs = 126 138 0 0 thresholds = 8.394 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-532-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctatatgttgcccgggtagg
8.39-1
ttacctaaaaggg
8.851
8-591-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctatatgttgcccgggtagg
8.391
ttacctaaaaggg
8.851
8-591-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctatatgttgcccgggtagg
8.391
ttacctaaaaggg
8.851
11-700-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgaatcaggaaaaggtcaac
10.221
cccgtttaggaaa
10.12-1
21-134-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
ttgacaaatttcctagttaag
8.571
ttcccttttcggg
8.161
26-556-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.73-1
cccaaacgggcaa
9.61-1
26-572-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.731
ttgcccgtttggg
9.61-1
29-141-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ctgtatgagggaaagaggaaa
8.711
ccccatccggaaa
10.33-1
29-229-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
tttccggatgggg
10.33-1
29-229-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
ccccatccggaaa
10.331
29-229-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
ccccatccggaaa
10.33-1
29-288-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
ccccatccggaaa
10.33-1

187 motifs = 15 90 0 0 thresholds = 6.639 ||8.732 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-903-8403.852000e+03YJR092W3.372000e+03NaNNaNNaN
tccattgttc
6.651
gatgttggacaagttgttgatgttcatc
11.571
14-254-3496.076000e+03YPL155C5.983000e+03NaNNaNNaN
tccattgttc
6.651
cttctccgccctatccttttctgccatc
12.57-1
22-633-5633.587000e+03YJL051W3.103000e+03NaNNaNNaN
ccaattgtct
7.031
gttgacttgatcgaatatgttgccaagg
8.951
24-505-4444.047000e+03YLR057W3.908000e+03NaNNaNNaN
ctcattgttt
6.941
gatgctaaggagacctgggacgctcaag
9.511
24-505-4804.047000e+03YLR057W3.908000e+03NaNNaNNaN
ctcattgttt
6.941
gatgctaaggagacctgggacgctcaag
9.511
31-411-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaacaatcga
7.08-1
gatcaacacctgtttcaaccccttcatc
11.51-1

188 motifs = 98 126 0 0 thresholds = 8.863 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-350-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggcaaaatgtaaaca
12.701
ctcaaaacggcaaaatgtaaa
9.661
7-272-3243.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
ccgaaagaggcaaaacgtaaa
12.251
11-545-4466.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
gttaattttttgccaatttag
8.761
26-572-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.701
gttaattttgtcccaaacggg
11.73-1
26-580-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.70-1
gttaattttgtcccaaacggg
11.73-1
26-650-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
gttaattttgtcccaaacggg
11.73-1
26-650-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
gttaattttgtcccaaacggg
11.731
32-641-6566.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

189 motifs = 62 145 0 0 thresholds = 8.515 ||8.792 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-657-5672.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtgatg
9.891
gcagagggagaa
9.451
7-394-4223.084000e+03YGL116W2.089000e+03NaNNaNNaN
cttcacttcc
8.52-1
ttctttttctgc
9.67-1
12-354-3205.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttc
10.18-1
tgctcttcctgc
10.08-1
23-360-4141.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
gcagcaagagca
10.591

190 motifs = 79 128 0 0 thresholds = 7.791 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-355-4005.116000e+03YNL172W5.001000e+03NaNNaNNaN
ctatcgggccccttcg
8.86-1
gtcaatgcaagggctcccgcccc
11.431
19-408-3954.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
ggcggcttcacaccggcaccacc
9.651
23-585-4951.613000e+03YKL130C3.580000e+03NaNNaNNaN
atacggtgcctgttgc
8.87-1
ggaagtgcaacagttggacccac
10.181
32-768-6936.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
ggcttcgtcactgcggcaatgtc
9.29-1

191 motifs = 90 108 0 0 thresholds = 8.732 ||8.604 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-675-7492.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtctaattgggtttggtggtgatg
12.571
catcgccatcgttggtaaagcc
11.031
14-349-4266.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttctccgccctatccttttctgccatc
12.57-1
actggccatcgttggtgatgcc
11.23-1
14-489-4266.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttggcccactggccatcgttggtgatg
13.071
actggccatcgttggtgatgcc
11.23-1
14-489-4616.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttggcccactggccatcgttggtgatg
13.071
actggccatcgttggtgatgcc
11.231
22-563-6433.587000e+03YJL051W3.103000e+03NaNNaNNaN
gttgacttgatcgaatatgttgccaagg
8.951
cgcttccatcttcgatgcctcc
10.061
23-369-4471.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatgatgataatgacgatggcgatg
9.521
gggacgtttagcgacggtttag
9.071

192 motifs = 126 137 0 0 thresholds = 8.394 ||8.871 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-594-6273.852000e+03YJR092W3.372000e+03NaNNaNNaN
cccgatttggaaaaaggtaaa
14.571
aaagagacat
9.621
15-203-1371.368000e+03YIL106W2.938000e+03NaNNaNNaN
cccaaaatggaaatatcaaaa
12.061
aaagagcctt
9.281
20-477-5635.680000e+02YCL063W6.040000e+02NaNNaNNaN
cctttccggggaagaattgac
9.981
atggcacttt
9.43-1
32-656-5816.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

193 motifs = 58 114 0 0 thresholds = 8.547 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-597-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
gaagagataaa
8.971
attatgtcttggtcatctttggtgg
10.121
4-197-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaaaggtaaa
10.691
tcaccatcgtggtgctctttgtcat
15.031
11-176-1606.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttccttttg
9.89-1
tagattcttttaacgacattggaga
11.981
11-509-5666.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
atggaaaatataacctctttgggga
14.031
11-543-5666.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
atggaaaatataacctctttgggga
14.031
21-471-4941.420000e+03YIL158W2.990000e+03NaNNaNNaN
gaaaaagtaaa
9.661
atggaagtgatgaaaacgatggtga
14.641
21-571-4941.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaggaggaaa
8.821
atggaagtgatgaaaacgatggtga
14.641
29-282-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tccccatcgagtggcagtagttctt
10.341

194 motifs = 3 98 0 0 thresholds = 4.837 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-912-9904.121000e+03YLR131C3.983000e+03NaNNaNNaN
agaac
4.841
tggtggattttgacc
9.02-1
4-739-6575.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
gacttgtctttgtcc
8.97-1
5-894-7993.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
tgcttacttttatcc
9.00-1
9-179-216YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tgtttatatatttcc
9.49-1
12-128-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
ggtaaaacgtcaata
10.601
12-339-3725.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
ggccaaagttcatca
10.431
14-245-1686.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tgtttatccttttcc
9.46-1
21-406-4731.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
gtgaaaaagtaaaca
9.551
21-892-9061.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggtaaaatctcacta
9.141
21-923-9061.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggtaaaatctcacta
9.141
22-93-573.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
taattgcatttgccc
10.22-1
22-191-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ggaaataagtaaaca
9.231
22-290-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ggaaataagtaaaca
9.231
22-340-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ggaaataagtaaaca
9.231
26-527-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
gggttaattttgtcc
9.701
26-527-5804.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
gggttaattttgtcc
9.70-1
32-622-6416.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-622-6496.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

195 motifs = 3 122 0 0 thresholds = 4.837 ||10.183 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
25-639-6354.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
ctacaaaggcaattacccacagattg
13.161
29-374-4094.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
caacaaggagttctccccatcgagtg
13.751
29-397-4094.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
caacaaggagttctccccatcgagtg
13.751
31-875-9346.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
cgacaagggctccgaccacgggacaa
13.321
32-622-7016.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

196 motifs = 11 137 0 0 thresholds = 7.124 ||8.871 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-6273.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaagagacat
9.621
5-597-6273.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaagagacat
9.621
15-206-1371.368000e+03YIL106W2.938000e+03NaNNaNNaN
cttcccaaaatggaaa
9.651
aaagagcctt
9.281
27-220-2494.497000e+03YML034W4.371000e+03NaNNaNNaN
ttactgttttaggaag
8.90-1
aaagagccct
10.071
32-659-5816.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

197 motifs = 79 121 0 0 thresholds = 7.791 ||8.435 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-704-7575.116000e+03YNL172W5.001000e+03NaNNaNNaN
cgaaggcgccactggg
8.81-1
tgctgctagggc
10.071
3-786-7575.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttggcagccattggc
9.78-1
tgctgctagggc
10.071
12-622-5605.551000e+03YOR025W5.449000e+03NaNNaNNaN
ctgaggagactttggc
9.13-1
tgatgctggtgc
8.871
12-622-6855.551000e+03YOR025W5.449000e+03NaNNaNNaN
ctgaggagactttggc
9.13-1
tggtggcggtgt
8.471
12-949-9265.551000e+03YOR025W5.449000e+03NaNNaNNaN
gaaagtggccgccgag
9.761
tgctgctgatgt
9.211
19-408-3974.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
acaccggcacca
9.72-1
22-633-5463.587000e+03YJL051W3.103000e+03NaNNaNNaN
cttgggtgacactcac
9.42-1
tgttgccaaggc
9.861

198 motifs = 83 99 0 0 thresholds = 9.139 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
21-325-3511.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggatgaagatcacgtt
11.561
catgaaggagatg
8.531
22-675-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
gaagatgccgttg
9.001
22-747-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
ggctgccgctgaaggt
10.421
gaagatgccgttg
9.001
23-382-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
gacgatggcgatg
9.961
31-252-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
tgttgctgatcacggt
11.011
caaccccttcatc
9.24-1

199 motifs = 11 82 0 0 thresholds = 7.124 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-219-298YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
ggtctgaaaag
9.191
12-734-6385.551000e+03YOR025W5.449000e+03NaNNaNNaN
tttcccctttggcaca
7.53-1
ttttccaaatc
10.37-1
16-204-3011.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
ggtgtgaaaaa
9.611
24-169-1324.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
gagctggaaaa
8.931
26-583-6454.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
ttttccaagtc
9.68-1

200 motifs = 126 132 0 0 thresholds = 8.394 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-116-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccctttttggtaaaacgtaaa
14.091
tttggtaaaacgtaaacaaaata
10.651
11-446-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
gttaattttttgccaatttag
8.761
agaaaggaaaaaaaatcaaaata
13.161
11-552-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
cctctttggggaaaagagaaa
12.891
agaaaggaaaaaaaatcaaaata
13.161
14-160-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatccttttccaatagcgg
10.981
aagcagaagcgaaaaataaaaag
10.911
16-201-1351.065000e+03YHR023W2.624000e+03NaNNaNNaN
cccaaaagggtaattgcgtaa
10.021
tgttttgattgttcattgtttat
12.891
26-556-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.73-1
tattttatttctagataaaccct
11.361
26-572-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.731
tattttatttctagataaaccct
11.361
28-205-1864.588000e+03YML119W4.464000e+03NaNNaNNaN
ccagattaggaaagaacataa
10.751
aggaaagaacataaataaaaaca
13.331
30-216-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
cctaaagcgggaaatagtaaa
9.461
ataaaacatttgtaaaaaaaaaa
13.531
32-656-6446.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

201 motifs = 62 127 0 0 thresholds = 8.515 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-657-5642.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtgatg
9.891
gagggagaatacagag
8.611
7-394-3753.084000e+03YGL116W2.089000e+03NaNNaNNaN
cttcacttcc
8.52-1
gaaagtgaaaaatgtg
10.631
8-809-8334.603000e+03YMR001C4.479000e+03NaNNaNNaN
catcaccatc
10.27-1
cactgttattgccttc
9.77-1
21-492-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggaagtgatg
9.211
gatgaaaacgatggtg
10.011
23-360-3691.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
gacgatgatgataatg
11.231
24-896-8874.047000e+03YLR057W3.908000e+03NaNNaNNaN
cttcactttc
8.90-1
cactttcatctttttc
11.63-1

202 motifs = 34 62 0 0 thresholds = 5.648 ||8.515 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-96-1843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gccgctgtgcat
5.65-1
gatcaccttc
9.02-1
7-317-3943.084000e+03YGL116W2.089000e+03NaNNaNNaN
aggcaaaacgta
5.731
cttcacttcc
8.52-1
8-870-8094.603000e+03YMR001C4.479000e+03NaNNaNNaN
ccgaacctcgga
8.141
catcaccatc
10.27-1
21-548-4921.420000e+03YIL158W2.990000e+03NaNNaNNaN
acgaacaaagga
5.941
ggaagtgatg
9.211
25-658-5614.074000e+03YLR084C3.935000e+03NaNNaNNaN
tccatgttgccc
6.95-1
ggaagtgatg
9.211

203 motifs = 50 136 0 0 thresholds = 6.445 ||9.126 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
16-490-4201.065000e+03YHR023W2.624000e+03NaNNaNNaN
ctaaacaaa
7.501
cttatcaaaag
10.53-1
21-225-1881.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
cttctcaaaag
9.94-1
29-896-8284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacata
7.881
cttgtcggaag
9.28-1
30-95-385.003000e+03YNL058C4.886000e+03NaNNaNNaN
aatgtttat
7.39-1
cttgtcaaaag
10.63-1

204 motifs = 70 135 0 0 thresholds = 7.941 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-189-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaagataaaca
9.521
cctttttggtaa
11.36-1
11-690-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
ccgtttaggaaa
9.51-1
11-767-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
ccgtttaggaaa
9.51-1
12-166-1805.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaacgtcaata
8.071
ttaccacaaagg
10.611
29-204-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ccttttgggtaa
10.95-1
29-218-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccttttgggtaa
10.95-1

205 motifs = 70 106 0 0 thresholds = 7.941 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-166-775.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaacgtcaata
8.071
gtggttagtggtgtaaaaactg
8.721
14-171-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
gggtagcccgatgatgcggctc
8.491
21-470-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaaagtaaaca
11.911
gatgaaaacgatggtgaaaaag
10.661
22-809-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgtttccgttgt
8.73-1
cttcagcggcagccttaacagc
11.71-1
22-809-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgtttccgttgt
8.73-1
gctgttaaggctgccgctgaag
11.711
31-387-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cacctgtttcaaccccttcatc
12.081

206 motifs = 58 107 0 0 thresholds = 8.547 ||9.839 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-597-5692.989000e+03YGL021W1.995000e+03NaNNaNNaN
gaagagataaa
8.971
ccgcagagggagaata
9.851
15-591-6101.368000e+03YIL106W2.938000e+03NaNNaNNaN
tttactctttt
9.85-1
tcttctacgcctcttg
10.34-1
26-768-7104.180000e+03YLR190W4.046000e+03NaNNaNNaN
tttactttttg
9.47-1
tctactccttctgttg
11.98-1
29-282-3614.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tcttccccctctcgag
10.69-1
29-482-5794.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttgcttcttt
8.87-1
tcttctacagctgaaa
9.84-1

207 motifs = 72 98 0 0 thresholds = 8.401 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-327-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gacacttttggt
10.45-1
ggcaaaatgtaaaca
12.701
1-327-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gacacttttggt
10.45-1
ggcaaaatgtaaaca
12.701
3-132-1825.116000e+03YNL172W5.001000e+03NaNNaNNaN
gacatttttggt
10.46-1
tatttacatttgcac
9.04-1
10-629-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
ggaaaaacatcaaca
11.761
23-269-1761.613000e+03YKL130C3.580000e+03NaNNaNNaN
accaaaagtgca
9.611
tgtttgtattttccc
11.75-1

208 motifs = 82 138 0 0 thresholds = 8.818 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-591-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatttggaaaa
10.371
cccgatttggaaa
10.48-1
9-298-219YBR038W2.730000e+02NaNNaNNaN
ggtctgaaaag
9.191
tttcctatttgag
8.291
23-887-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gggttgaaaaa
9.851
ccccatgggccaa
8.11-1
26-645-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttttccaagtc
9.68-1
cccaaacgggcaa
9.61-1

209 motifs = 116 138 0 0 thresholds = 9.616 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-309-219YBR038W2.730000e+02NaNNaNNaN
ttcccgtttatttcct
11.18-1
tttcctatttgag
8.291
19-168-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
aggtaaacaagaaaag
11.431
cccagaagggaaa
9.19-1
29-546-5374.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttgcgttggttccct
11.94-1
ccctatatgcaaa
9.01-1
32-555-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

210 motifs = 3 128 0 0 thresholds = 4.837 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-894-9283.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gttgctgcagttggctattactc
8.901
12-339-2685.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
tgcactgcatgtgtttctgtggc
8.261
13-664-7016.163000e+03YPL242C6.071000e+03NaNNaNNaN
gttct
4.84-1
gagttttgtactgttacatcaac
9.861
14-496-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ggctcctgtatctctgcaattac
8.711
20-620-6525.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
gctgttgcagcagcaaaaccggc
12.881
22-93-713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
gtaattgcatttgcccttgagca
9.721
23-871-8371.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gagacaactgcaactgcaactgc
11.791
23-871-8491.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gagacaactgcaactgcaactgc
11.79-1
25-639-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
ggcagaactacaaaggcaattac
10.671
32-622-6936.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
ggcttcgtcactgcggcaatgtc
9.29-1

211 motifs = 79 92 0 0 thresholds = 7.791 ||7.901 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
19-408-3984.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
ttcacaccggcacc
9.65-1
23-585-5951.613000e+03YKL130C3.580000e+03NaNNaNNaN
atacggtgcctgttgc
8.87-1
ggtgcctgttgcag
10.241
27-919-9294.497000e+03YML034W4.371000e+03NaNNaNNaN
gtttggtgccattttc
9.59-1
ggtgccattttcca
9.611
29-349-3594.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
ggtgcccctttcgg
9.431

212 motifs = 59 74 0 0 thresholds = 8.576 ||9.204 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-559-5465.551000e+03YOR025W5.449000e+03NaNNaNNaN
gatgctggtgctg
10.101
gctggtgctgca
9.50-1
22-749-7363.587000e+03YJL051W3.103000e+03NaNNaNNaN
aaggctgccgctg
9.151
gctgccgctgaa
10.22-1
23-354-4211.613000e+03YKL130C3.580000e+03NaNNaNNaN
catcgtcagcact
9.67-1
tgcattggcagc
9.591
23-384-4211.613000e+03YKL130C3.580000e+03NaNNaNNaN
agtgctgacgatg
9.671
tgcattggcagc
9.591
28-43-564.588000e+03YML119W4.464000e+03NaNNaNNaN
cacctgcagcctt
9.01-1
tgcacctgcagc
9.721

213 motifs = 78 86 0 0 thresholds = 8.229 ||8.949 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-279-2273.852000e+03YJR092W3.372000e+03NaNNaNNaN
ttccgctgcagga
10.671
tactaggtcgaatgctacag
9.261
16-800-8091.065000e+03YHR023W2.624000e+03NaNNaNNaN
tactgctgcagga
10.761
ttacccgaatactgctgcag
10.741
20-701-6595.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgtcgctgtagga
10.361
ttgacatgctgttgcagcag
10.921
22-744-7533.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgccgctgaaggt
9.091
tgttaaggctgccgctgaag
10.171

214 motifs = 58 85 0 0 thresholds = 8.547 ||8.241 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-448-3675.116000e+03YNL172W5.001000e+03NaNNaNNaN
tttattttttt
10.65-1
gctcccgccccaaaagttcctat
11.351
5-584-6693.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
catcctacgagaaacgcccccct
8.241
20-379-3025.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaaaagagaaa
10.701
gttcctcctcatattgtcccttt
10.411
24-155-1144.047000e+03YLR057W3.908000e+03NaNNaNNaN
gaaaaaaaaaa
10.031
acaggcaaataggaagctggaag
11.091
31-811-9056.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaaataaa
10.651
gctccgaccacgggacaaccctt
8.671
32-645-5726.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
gatccctgatccatagagccatt
9.78-1

215 motifs = 90 128 0 0 thresholds = 8.732 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-840-9283.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatgttggacaagttgttgatgttcatc
11.571
gttgctgcagttggctattactc
8.901
7-715-7943.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttcatccacgataccatattattccac
11.67-1
gggtatgttactattgcatcaac
12.361
13-403-3326.163000e+03YPL242C6.071000e+03NaNNaNNaN
cattttcaacgcaagcactcgggaccac
8.73-1
gacaattctgcctttgcatttga
10.671
14-489-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttggcccactggccatcgttggtgatg
13.071
ggctcctgtatctctgcaattac
8.711
23-369-4141.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatgatgataatgacgatggcgatg
9.521
gacggtttagcttctgcattggc
12.791

216 motifs = 1 140 0 0 thresholds = 7.416 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-462-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gaatagccgcccaaaaa
10.421
tcaaaacggcaaaatgtaaaca
14.491
5-641-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
attgtcggcgggtaatt
7.50-1
ccgatttggaaaaaggtaaaca
15.841
12-239-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttctgtggcgggtatcc
7.58-1
cacaaagggtaaaacgtcaata
11.971
22-323-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
aacgtcggcggttaaaa
7.96-1
ctttttgggaaataagtaaaca
15.071

217 motifs = 50 101 0 0 thresholds = 6.445 ||8.486 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-175-2205.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
gccaagaccta
8.88-1
4-191-2205.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
gccaagaccta
8.88-1
10-636-6443.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ggcacgacctt
10.48-1
10-715-6443.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
ggcacgacctt
10.48-1
16-950-9631.065000e+03YHR023W2.624000e+03NaNNaNNaN
attgtttag
7.01-1
aaggtcatggc
9.351
16-990-9631.065000e+03YHR023W2.624000e+03NaNNaNNaN
attgtttag
7.01-1
aaggtcatggc
9.351
17-145-2242.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
ggcaggacctt
9.56-1

218 motifs = 72 138 0 0 thresholds = 8.401 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-629-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
cccaaagaggaaa
10.81-1
15-203-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cccaaaatggaa
8.401
cccaaaatggaaa
10.60-1
16-201-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
cccaaaagggta
8.901
cccaaaagggtaa
9.42-1
22-260-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
tttcctttttggg
10.941
29-221-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ccccatccggaaa
10.33-1
29-221-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
tttccggatgggg
10.33-1
29-221-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ccccatccggaaa
10.331
29-221-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ccccatccggaaa
10.33-1
29-280-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1
29-280-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.331
29-280-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1
29-346-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
tttccggatgggg
10.33-1
29-346-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.331
29-346-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1

219 motifs = 9 140 0 0 thresholds = 7.094 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-452-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
ccaaaaataccggggca
7.461
tcaaaacggcaaaatgtaaaca
14.491
9-114-209YBR038W2.730000e+02NaNNaNNaN
ggccccagtctatttaa
7.32-1
tgtttatatatttcctatttga
14.841
12-127-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
gaactatatctggcgta
7.491
cacaaagggtaaaacgtcaata
11.971
14-225-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tcattatatgcgggtag
7.111
tgtttatccttttccaatagcg
13.931

220 motifs = 59 114 0 0 thresholds = 8.576 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-928-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttgctgcagttg
10.361
tctccattgttctcgtattcttcct
13.501
13-830-9146.163000e+03YPL242C6.071000e+03NaNNaNNaN
catcatcagccgt
9.06-1
tctccaatgatatagaaaatgtatt
12.621
20-961-9445.680000e+02YCL063W6.040000e+02NaNNaNNaN
cacctccaccaac
9.18-1
ccaccaacgctgcatactatgcctt
11.771
23-354-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
catcgtcagcact
9.67-1
acgatgatgataatgacgatggcga
12.361
23-384-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
agtgctgacgatg
9.671
acgatgatgataatgacgatggcga
12.361

221 motifs = 3 137 0 0 thresholds = 4.837 ||8.871 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-327-2682.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
aaagagacct
9.561
16-749-6791.065000e+03YHR023W2.624000e+03NaNNaNNaN
agaac
4.841
agggcacttt
9.37-1
17-767-8432.557000e+03YDR150W1.135000e+03NaNNaNNaN
agaac
4.841
aaagagcctt
9.281
20-620-5635.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
atggcacttt
9.43-1
24-117-1704.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
atggctcttt
10.12-1
32-622-5816.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

222 motifs = 3 131 0 0 thresholds = 4.837 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-912-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
cttccagggtcccgataac
9.64-1
4-975-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
cttccagggtcccgataac
9.64-1
4-986-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
cttccagggtcccgataac
9.64-1
5-894-8873.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
ctccattgttctcgtattc
10.46-1
14-496-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
gatttgggcaacaatgcgg
11.301
29-374-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
tctcgagggtgcccctttc
10.46-1
29-397-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
tctcgagggtgcccctttc
10.46-1
32-622-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

223 motifs = 58 65 0 0 thresholds = 8.547 ||9.209 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-584-6283.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
aaaagagacatt
10.841
11-509-5426.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
aaaagagaaata
11.461
15-591-5551.368000e+03YIL106W2.938000e+03NaNNaNNaN
tttactctttt
9.85-1
ttttactctttt
10.59-1
20-132-1395.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
aaaagagaaaaa
11.201
20-379-3015.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaaaagagaaa
10.701
attgtccctttt
10.35-1
21-169-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
11.241
21-192-1701.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
11.241
24-155-1694.047000e+03YLR057W3.908000e+03NaNNaNNaN
gaaaaaaaaaa
10.031
aatggctctttt
9.92-1
25-221-2654.074000e+03YLR084C3.935000e+03NaNNaNNaN
aaaaaaagaaa
10.551
aattcctctttt
10.94-1
28-144-604.588000e+03YML119W4.464000e+03NaNNaNNaN
aaagaaagaaa
9.611
ttttactctttt
10.59-1
29-223-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
tatttccctttt
11.24-1
32-251-2966.360000e+03YPR156C6.278000e+03NaNNaNNaN
tttgctctttt
9.11-1
ttttccactttt
9.21-1

224 motifs = 50 71 0 0 thresholds = 6.445 ||9.133 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-503-5414.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
tctctgtcaaaa
10.31-1
9-562-550YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ctttgagtgagc
10.301
10-636-6573.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
gctctcacaaaa
9.73-1
10-715-6573.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttctttac
7.17-1
gctctcacaaaa
9.73-1
16-950-8901.065000e+03YHR023W2.624000e+03NaNNaNNaN
attgtttag
7.01-1
gcttttacaaag
9.13-1
17-145-1832.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
ctttgacggaga
10.021

225 motifs = 98 116 0 0 thresholds = 8.863 ||9.616 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-585-6064.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
tttttttttttttcat
9.77-1
9-216-309YBR038W2.730000e+02NaNNaNNaN
tgtttatatatttcc
9.49-1
ttcccgtttatttcct
11.18-1
11-545-5076.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
aggaaaaaaaatcaaa
12.091
23-176-1951.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
tttttttttttttcat
9.77-1
32-641-5556.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-649-5556.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

226 motifs = 58 112 0 0 thresholds = 8.547 ||9.601 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-321-3313.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaagaggcaaa
9.011
ttgattgccgaaagag
10.241
22-262-2543.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttt
10.37-1
cctttttgggaaataa
9.84-1
23-197-2751.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttttttttttt
10.91-1
taacataccaaaagtg
9.911
29-282-3354.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ttttcttccagaagag
11.801

227 motifs = 3 80 0 0 thresholds = 4.837 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-807-7564.121000e+03YLR131C3.983000e+03NaNNaNNaN
agaac
4.841
tctcagaatgtcccaata
10.72-1
4-912-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
tcttccagggtcccgata
10.47-1
4-975-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
tcttccagggtcccgata
10.47-1
4-986-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
tcttccagggtcccgata
10.47-1
8-327-3424.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
aagcggcagtttcaaaga
11.761
14-245-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tctatgctgctgcccata
9.95-1
23-291-2761.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
tcttcgtgcatgcctctt
10.89-1

228 motifs = 99 100 0 0 thresholds = 8.494 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-795-7804.345000e+03YLR353W4.215000e+03NaNNaNNaN
cttacccttcctc
8.94-1
cttcctccgctctcgtcttgtg
8.971
9-763-754YBR038W2.730000e+02NaNNaNNaN
cttcagcctcctt
8.76-1
cttcagcctccttctgtgtttc
10.391
22-704-6473.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
ctcacgcttccatcttcgatgc
10.701
22-704-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
gctgttaaggctgccgctgaag
9.551
29-269-2784.635000e+03YMR032W4.512000e+03NaNNaNNaN
accgaagcggaag
8.491
taacagcggaccgaagcggaag
8.821
30-967-9585.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctactccatcttt
10.61-1
ctactccatctttcatcccacc
10.161

229 motifs = 74 106 0 0 thresholds = 9.204 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-546-5655.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaagaat
9.251
12-546-5905.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaagaat
9.251
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
ctgttgcagcagcaaaaccggc
9.121
22-736-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
cttcagcggcagccttaacagc
11.71-1
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctgaag
11.711
23-421-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gctgacgatgatgataatgacg
9.371
23-421-4111.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gtttagcttctgcattggcagc
8.681

230 motifs = 98 127 0 0 thresholds = 8.863 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-585-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
catttttttttttttc
9.51-1
7-316-3753.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
gaaagtgaaaaatgtg
10.631
9-216-307YBR038W2.730000e+02NaNNaNNaN
tgtttatatatttcc
9.49-1
cccgtttatttccttc
9.79-1
21-473-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
gtgaaaaagtaaaca
9.551
gatgaaaacgatggtg
10.011
30-209-2765.003000e+03YNL058C4.886000e+03NaNNaNNaN
gggaaatagtaaaca
8.881
ctcccttctcactttc
9.60-1

231 motifs = 83 141 0 0 thresholds = 9.139 ||8.805 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-841-8803.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
tcgtattcttcctcg
9.93-1
19-829-8834.529000e+03YML064C4.404000e+03NaNNaNNaN
accttgaacttcatcg
10.24-1
ccttgaacttcatcg
10.26-1
23-382-3551.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
cgatgatgataatga
12.201
27-789-7384.497000e+03YML034W4.371000e+03NaNNaNNaN
agcttgttcatcacca
10.68-1
ccatcttgttcatcg
10.11-1
31-252-3276.062000e+03YPL141C5.969000e+03NaNNaNNaN
tgttgctgatcacggt
11.011
tcaaccccttcatcg
9.88-1

232 motifs = 50 112 0 0 thresholds = 6.445 ||9.601 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-562-585YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ttgactgccataagcg
10.231
11-772-8126.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
ttttattccaaatgcg
11.521
23-184-2751.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
taacataccaaaagtg
9.911
29-434-3354.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
ttttcttccagaagag
11.801

233 motifs = 80 102 0 0 thresholds = 9.703 ||8.294 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-342-2714.603000e+03YMR001C4.479000e+03NaNNaNNaN
aagcggcagtttcaaaga
11.761
ctattttttcatc
9.87-1
18-261-1622.553000e+03YDR146C1.131000e+03NaNNaNNaN
tctttctttctccctata
11.39-1
gaagacaaaaagg
11.071
18-261-1832.553000e+03YDR146C1.131000e+03NaNNaNNaN
tctttctttctccctata
11.39-1
gaagacaaaaagg
11.071
23-276-1941.613000e+03YKL130C3.580000e+03NaNNaNNaN
tcttcgtgcatgcctctt
10.89-1
ccttttttttttt
8.351
23-276-2031.613000e+03YKL130C3.580000e+03NaNNaNNaN
tcttcgtgcatgcctctt
10.89-1
ccttttttttttt
8.35-1
30-268-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
tctcactttctgccgatt
11.47-1
aaaaaaaaaaatg
8.371

234 motifs = 117 121 0 0 thresholds = 7.961 ||8.435 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-747-8262.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatcgttggtaaagccat
11.411
tggtggcatggc
8.711
3-813-7575.116000e+03YNL172W5.001000e+03NaNNaNNaN
ccactccctcgtcgatgttcacct
10.291
tgctgctagggc
10.071
14-788-6986.076000e+03YPL155C5.983000e+03NaNNaNNaN
ttgaaggtatcggtttaggcgacg
7.981
accttgccatca
9.14-1
23-365-4101.613000e+03YKL130C3.580000e+03NaNNaNNaN
atgatgataatgacgatggcgatg
12.301
gcattggcagca
10.33-1
23-449-4101.613000e+03YKL130C3.580000e+03NaNNaNNaN
tggggacgtttagcgacggtttag
8.611
gcattggcagca
10.33-1

235 motifs = 34 113 0 0 thresholds = 5.648 ||8.807 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
17-374-3542.557000e+03YDR150W1.135000e+03NaNNaNNaN
agggaaaaagga
5.821
ggatttgcatttg
10.52-1
22-614-6933.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
gaagatgccgttg
9.10-1
23-750-7281.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
ggagttgccatta
8.81-1
23-750-8481.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
caactgcaactgc
10.021
25-658-6324.074000e+03YLR084C3.935000e+03NaNNaNNaN
tccatgttgccc
6.95-1
caaaggcaattac
11.031
25-727-6324.074000e+03YLR084C3.935000e+03NaNNaNNaN
aggcattgtgga
6.201
caaaggcaattac
11.031

236 motifs = 59 99 0 0 thresholds = 8.576 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
22-749-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
aaggctgccgctg
9.151
gaagatgccgttg
9.001
23-354-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
catcgtcagcact
9.67-1
gacgatggcgatg
9.961
23-384-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
agtgctgacgatg
9.671
gacgatggcgatg
9.961
30-874-9675.003000e+03YNL058C4.886000e+03NaNNaNNaN
caactacaccaac
9.54-1
ctactccatcttt
10.61-1
31-257-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
actgctgttgctg
9.941
caaccccttcatc
9.24-1

237 motifs = 61 70 0 0 thresholds = 9.103 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
14-477-4296.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatcgttggtgatg
10.201
tatttacgattt
8.46-1
16-419-4951.065000e+03YHR023W2.624000e+03NaNNaNNaN
gaaaaggtcgctgaaa
10.871
aaaggctaaaca
8.171
21-483-4701.420000e+03YIL158W2.990000e+03NaNNaNNaN
gaaaacgatggtgaaa
11.731
aaaaagtaaaca
11.911
31-328-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
tttcaaccccttcatc
10.26-1
aaaaggtaaaca
12.561

238 motifs = 69 104 0 0 thresholds = 8.609 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-532-5853.852000e+03YJR092W3.372000e+03NaNNaNNaN
atgcaaaggaaac
9.851
gaaaaaggtaaacaaca
11.551
12-379-3005.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
ttccctgttcgtttttc
10.48-1
15-633-6411.368000e+03YIL106W2.938000e+03NaNNaNNaN
tgttcccttgaat
9.31-1
tcctcttgcctttgttc
11.00-1
22-172-2593.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttatcctttgaag
10.16-1
gaaataagtaaacaata
9.741

239 motifs = 2 98 0 0 thresholds = 6.900 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
ggcaaaatgtaaaca
12.701
1-408-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
ggcaaaatgtaaaca
12.701
2-144-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
ggtaaaacgtaaaca
11.721
5-620-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
ggaaaaaggtaaaca
12.791
12-210-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
ggtaaaacgtcaata
10.601
14-230-1686.076000e+03YPL155C5.983000e+03NaNNaNNaN
taatgtcattatatgcgggtag
8.041
tgtttatccttttcc
9.46-1

240 motifs = 11 116 0 0 thresholds = 7.124 ||9.616 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-589-5794.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcat
9.77-1
6-589-6064.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcat
9.77-1
9-219-309YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
ttcccgtttatttcct
11.18-1
11-542-5076.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
aggaaaaaaaatcaaa
12.091
18-382-3162.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
aggtaaacaataacaa
11.221
31-439-3846.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
aggtaaacaagagaaa
12.301

241 motifs = 34 108 0 0 thresholds = 5.648 ||8.604 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-870-8034.603000e+03YMR001C4.479000e+03NaNNaNNaN
ccgaacctcgga
8.141
gtgataaatgaagagggaatcg
10.331
14-736-6656.076000e+03YPL155C5.983000e+03NaNNaNNaN
gccatggtgccg
8.65-1
gggccaagaagggttggaccgg
9.431
22-614-6433.587000e+03YJL051W3.103000e+03NaNNaNNaN
tccaaagttcgt
6.30-1
cgcttccatcttcgatgcctcc
10.061
23-750-7321.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
ccggatcatcttcggagttgcc
9.231
23-750-7991.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
ccaccccctccccccatgggcc
9.121

242 motifs = 50 74 0 0 thresholds = 6.445 ||9.204 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-719-7075.200000e+02YCL014W5.570000e+02NaNNaNNaN
aatgtttgc
7.04-1
gctgcttcagca
9.20-1
5-338-2713.852000e+03YJR092W3.372000e+03NaNNaNNaN
acaaacaaa
7.591
gcttccgctgca
10.22-1
22-252-2283.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
gctgcctttgca
9.30-1
23-405-4211.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacaaa
8.301
tgcattggcagc
9.591

243 motifs = 104 108 0 0 thresholds = 8.780 ||8.604 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-455-5515.200000e+02YCL014W5.570000e+02NaNNaNNaN
tttttagtttatttttc
8.86-1
ggaatgtaggttgatggacatg
9.051
14-295-3526.076000e+03YPL155C5.983000e+03NaNNaNNaN
aaaaaaaaacaagacaa
9.111
ctccgccctatccttttctgcc
10.021
15-641-7101.368000e+03YIL106W2.938000e+03NaNNaNNaN
tcctcttgcctttgttc
11.00-1
ggcggcacaggagatgtttcag
9.731
23-882-7991.613000e+03YKL130C3.580000e+03NaNNaNNaN
gaaaaaaataaagaacc
9.551
ccaccccctccccccatgggcc
9.121

244 motifs = 99 102 0 0 thresholds = 8.494 ||8.294 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-795-8134.345000e+03YLR353W4.215000e+03NaNNaNNaN
cttacccttcctc
8.94-1
tatttttctcttt
9.76-1
8-806-7944.603000e+03YMR001C4.479000e+03NaNNaNNaN
catcaccatcttc
10.64-1
gaagagggaatcg
8.801
12-351-2935.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttcctt
10.61-1
tttttccctcttc
8.79-1
21-351-3951.420000e+03YIL158W2.990000e+03NaNNaNNaN
catgaaggagatg
8.531
gaagaagaaagag
10.961
22-704-6523.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
cgcttccatcttc
8.55-1
26-712-6884.180000e+03YLR190W4.046000e+03NaNNaNNaN
ctactccttctgt
9.43-1
cccttttttctta
9.26-1

245 motifs = 3 106 0 0 thresholds = 4.837 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-894-8373.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gttggacaagttgttgatgttc
9.331
5-894-9403.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gcttttggggttgttgctgcag
12.081
12-128-775.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
gtggttagtggtgtaaaaactg
8.721
14-245-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
gggtagcccgatgatgcggctc
8.491
17-86-1852.557000e+03YDR150W1.135000e+03NaNNaNNaN
gttct
4.84-1
gtctttgacggagatgcgggtg
9.051
20-620-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
ctgttgcagcagcaaaaccggc
9.121
21-406-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
gatgaaaacgatggtgaaaaag
10.661
23-291-3631.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
gctgacgatgatgataatgacg
9.371
24-371-4264.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
gaggtcgaaggtgatgataatg
10.671
24-524-4264.047000e+03YLR057W3.908000e+03NaNNaNNaN
gttct
4.84-1
gaggtcgaaggtgatgataatg
10.671
27-720-8024.497000e+03YML034W4.371000e+03NaNNaNNaN
gttct
4.84-1
catcatccactacgacaccagc
10.661
31-235-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
gttct
4.84-1
cacctgtttcaaccccttcatc
12.081
31-397-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
agaac
4.841
cacctgtttcaaccccttcatc
12.081
32-394-3296.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

246 motifs = 3 135 0 0 thresholds = 4.837 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-483-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaagg
11.361
8-567-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaagg
11.361
12-128-1805.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
ttaccacaaagg
10.611
22-191-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaa
10.21-1
22-290-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaa
10.21-1
22-340-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaa
10.21-1
26-449-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
cctttcgggaaa
10.33-1
26-527-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
cctttcgggaaa
10.33-1
29-374-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ccttttgggtaa
10.95-1

247 motifs = 70 99 0 0 thresholds = 7.941 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
9-748-763YBR038W2.730000e+02NaNNaNNaN
tgtttccaatct
7.94-1
cttcagcctcctt
8.76-1
26-769-7124.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtttacttttt
11.91-1
ctactccttctgt
9.43-1
29-204-2694.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
accgaagcggaag
8.491
29-218-2694.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
accgaagcggaag
8.491
29-283-2694.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
accgaagcggaag
8.491
31-387-3286.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaggtaaaca
12.561
caaccccttcatc
9.24-1

248 motifs = 132 140 0 0 thresholds = 9.994 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-93-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
tttggtaaaacgtaaacaaaata
10.651
cctttttggtaaaacgtaaaca
14.761
6-420-3424.345000e+03YLR353W4.215000e+03NaNNaNNaN
tttttttattgcgcgtaagcgat
9.991
ttaggaaggaaaataataaaga
9.381
11-511-4476.323000e+03YPR119W6.238000e+03NaNNaNNaN
agaaaggaaaaaaaatcaaaata
13.161
ggttaattttttgccaatttag
9.721
11-511-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
agaaaggaaaaaaaatcaaaata
13.161
ctctttggggaaaagagaaata
12.921
14-135-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
aagcagaagcgaaaaataaaaag
10.911
tgtttatccttttccaatagcg
13.931
26-605-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
tattttatttctagataaaccct
11.361
ccaaacgggcaaaatataaata
13.831
30-188-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
ataaaacatttgtaaaaaaaaaa
13.531
ctaaagcgggaaatagtaaaca
14.881

249 motifs = 83 104 0 0 thresholds = 9.139 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-543-4465.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggttgatggacatggt
11.401
tttttagtttatttttc
8.86-1
4-543-4555.200000e+02YCL014W5.570000e+02NaNNaNNaN
ggttgatggacatggt
11.401
tttttagtttatttttc
8.86-1
5-841-8953.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
tactctctccattgttc
11.02-1
21-325-3921.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggatgaagatcacgtt
11.561
gaagaaagagtacaaaa
11.131
24-424-3304.047000e+03YLR057W3.908000e+03NaNNaNNaN
ggtcgaaggtgatgat
9.141
ttgtctcatcttttttc
12.20-1

250 motifs = 3 100 0 0 thresholds = 4.837 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-807-7724.121000e+03YLR131C3.983000e+03NaNNaNNaN
agaac
4.841
cttgtacctcggtctccctgtc
9.961
5-894-9403.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gcttttggggttgttgctgcag
9.011
13-664-7586.163000e+03YPL242C6.071000e+03NaNNaNNaN
gttct
4.84-1
gtcttggagaagggtgattcag
9.341
19-846-8694.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
cttcatcgactctcaacttgac
10.521
19-900-8694.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
cttcatcgactctcaacttgac
10.521
24-524-5514.047000e+03YLR057W3.908000e+03NaNNaNNaN
gttct
4.84-1
ctacaactacggtcaattcacc
9.041
27-408-3904.497000e+03YML034W4.371000e+03NaNNaNNaN
agaac
4.841
ctagaactcctttctcatcatc
10.881
29-374-2784.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
taacagcggaccgaagcggaag
8.821

251 motifs = 1 98 0 0 thresholds = 7.416 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-462-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gaatagccgcccaaaaa
10.421
ggcaaaatgtaaaca
12.701
5-641-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
attgtcggcgggtaatt
7.50-1
ggaaaaaggtaaaca
12.791
12-239-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttctgtggcgggtatcc
7.58-1
ggtaaaacgtcaata
10.601
22-323-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
aacgtcggcggttaaaa
7.96-1
ggaaataagtaaaca
9.231

252 motifs = 98 102 0 0 thresholds = 8.863 ||8.294 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-585-5534.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
cattttttttttt
8.37-1
6-585-6114.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
cattttttttttt
8.37-1
12-372-2935.551000e+03YOR025W5.449000e+03NaNNaNNaN
ggccaaagttcatca
10.431
tttttccctcttc
8.79-1
21-473-3951.420000e+03YIL158W2.990000e+03NaNNaNNaN
gtgaaaaagtaaaca
9.551
gaagaagaaagag
10.961
23-176-1941.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
ccttttttttttt
8.351
23-176-2031.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
ccttttttttttt
8.35-1
26-650-6884.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
cccttttttctta
9.26-1
26-766-6884.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtttactttttgac
9.68-1
cccttttttctta
9.26-1
30-209-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
gggaaatagtaaaca
8.881
aaaaaaaaaaatg
8.371
30-514-4255.003000e+03YNL058C4.886000e+03NaNNaNNaN
tattggtattttgcc
10.77-1
gaagaaaaaacaa
10.281
32-641-5636.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-649-5636.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

253 motifs = 99 117 0 0 thresholds = 8.494 ||7.961 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-758-7472.989000e+03YGL021W1.995000e+03NaNNaNNaN
catcgccatcgtt
10.42-1
catcgccatcgttggtaaagccat
11.411
2-960-9492.989000e+03YGL021W1.995000e+03NaNNaNNaN
cttctccttctgt
9.87-1
cttctccttctgttgttttgccat
12.451
9-763-752YBR038W2.730000e+02NaNNaNNaN
cttcagcctcctt
8.76-1
cttcagcctccttctgtgtttcca
8.751
22-704-7153.587000e+03YJL051W3.103000e+03NaNNaNNaN
gaagatgccgttg
9.001
tgggttacaccgaagatgccgttg
11.531
23-363-4491.613000e+03YKL130C3.580000e+03NaNNaNNaN
gacgatggcgatg
9.961
tggggacgtttagcgacggtttag
8.611
29-269-3524.635000e+03YMR032W4.512000e+03NaNNaNNaN
accgaagcggaag
8.491
cttccccctctcgagggtgcccct
10.021
30-967-9565.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctactccatcttt
10.61-1
ctactccatctttcatcccaccag
9.051

254 motifs = 62 102 0 0 thresholds = 8.515 ||8.294 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-657-5972.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtgatg
9.891
gaagagataaaag
8.881
8-809-7944.603000e+03YMR001C4.479000e+03NaNNaNNaN
catcaccatc
10.27-1
gaagagggaatcg
8.801
12-354-2935.551000e+03YOR025W5.449000e+03NaNNaNNaN
catcaccttc
10.18-1
tttttccctcttc
8.79-1
21-492-3951.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggaagtgatg
9.211
gaagaagaaagag
10.961
24-420-3234.047000e+03YLR057W3.908000e+03NaNNaNNaN
gaaggtgatg
10.181
tttttctttcttt
9.42-1
24-896-8904.047000e+03YLR057W3.908000e+03NaNNaNNaN
cttcactttc
8.90-1
cactttcatcttt
9.30-1


Questions? --> kreiman@mit.edu

HOME