Location of motif pairs/triplets/quadruplets in each transcript within the cluster set

t=transcript number

p=position of last motif with respect to ATG for each motif

affy=affymetrix probe id

nm=refseq accession number

ug=unigene accession number

chr=chromosome

pos=chromosomal position

strand=strand

Saccharomyces Cerevisiae

1 motifs = 50 126 0 0 thresholds = 6.445 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ctcaaaacggcaaaatgtaaa
9.661
2-100-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ccctttttggtaaaacgtaaa
14.091
5-578-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaaaaggtaaa
14.571
9-224-208YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tttatatatttcctatttgag
12.531
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaaaacatcaa
11.511
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
gtttgctgttaccacaaaggg
11.201
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaattgcgtaa
10.021
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
gtttattattccccaagagag
10.001
18-314-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
cctgtttaggaaaaaggtaaa
14.631
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
taaagatttttcctttttggg
9.001
29-213-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
cccttttgggtaacagcggac
11.701
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
cctaaagcgggaaatagtaaa
9.461

2 motifs = 50 140 0 0 thresholds = 6.445 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
tcaaaacggcaaaatgtaaaca
14.491
2-100-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
cctttttggtaaaacgtaaaca
14.761
5-578-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ccgatttggaaaaaggtaaaca
15.841
9-224-209YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcctatttga
14.841
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
tgtttacaaccgcccaaagagg
9.941
12-184-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
cacaaagggtaaaacgtcaata
11.971
13-182-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
tgtttattattccccaagagag
13.061
18-314-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ctgtttaggaaaaaggtaaaca
15.591
22-252-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ctttttgggaaataagtaaaca
15.071
23-184-1691.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttcccgttttga
10.971
29-213-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ctctttgggcaagttgtaaaca
14.631
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
ctaaagcgggaaatagtaaaca
14.881

3 motifs = 70 140 0 0 thresholds = 7.941 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
tcaaaacggcaaaatgtaaaca
14.491
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ccgatttggaaaaaggtaaaca
15.841
7-313-3233.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
cgaaagaggcaaaacgtaaata
14.111
9-219-209YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tgtttatatatttcctatttga
14.841
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaacgtcaata
8.071
cacaaagggtaaaacgtcaata
11.971
13-187-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaagtgtaaaca
11.021
ctaaaagaggaaagtgtaaaca
12.291
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tgtttatccttttccaatagcg
13.931
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctgtttaggaaaaaggtaaaca
15.591
21-145-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
tgttgacaaatttcctagttaa
13.151
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
ctttttgggaaataagtaaaca
15.071
29-204-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ctctttgggcaagttgtaaaca
14.631
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ctctttgggcaagttgtaaaca
14.631
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
ctaaagcgggaaatagtaaaca
14.881

4 motifs = 11 98 0 0 thresholds = 7.124 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ggtaaaacgtaaaca
11.721
4-647-6575.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaccttaactggtga
7.201
gacttgtctttgtcc
8.97-1
5-597-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ggaaaaaggtaaaca
12.791
7-327-3163.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
ggcaaaacgtaaata
11.821
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
ggaaaaacatcaaca
11.761
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ggaaataagtaaaca
9.231
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gggttaattttgtcc
9.701
30-220-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gggaaatagtaaaca
8.881
32-659-6416.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-659-6496.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

5 motifs = 70 126 0 0 thresholds = 7.941 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
ctcaaaacggcaaaatgtaaa
9.661
2-105-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
ccctttttggtaaaacgtaaa
14.091
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cccgatttggaaaaaggtaaa
14.571
7-313-3243.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
ccgaaagaggcaaaacgtaaa
12.251
9-219-208YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tttatatatttcctatttgag
12.531
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
ccgaatcaggaaaaggtcaac
10.221
14-171-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tttatccttttccaatagcgg
10.981
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cctgtttaggaaaaaggtaaa
14.631
21-145-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttgacaaatttcctagttaag
8.571
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cccttttgggtaacagcggac
11.701
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
cctaaagcgggaaatagtaaa
9.461

6 motifs = 50 98 0 0 thresholds = 6.445 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-367-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
2-100-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ggtaaaacgtaaaca
11.721
5-578-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ggaaaaaggtaaaca
12.791
6-577-5854.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
cgaaaaaggtaaaca
9.461
9-224-216YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcc
9.49-1
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ggaaaaacatcaaca
11.761
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
ggtaaaacgtcaata
10.601
18-314-3222.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaaaaggtaaaca
12.791
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaataagtaaaca
9.231
23-184-1761.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttccc
11.75-1
30-201-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gggaaatagtaaaca
8.881

7 motifs = 11 140 0 0 thresholds = 7.124 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tgtttatatatttcctatttga
14.841
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
tgtttacaaccgcccaaagagg
9.941
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
ctctttggggaaaagagaaata
12.921
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
cacaaagggtaaaacgtcaata
11.971
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
ctgtttaggaaaaaggtaaaca
15.591
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ctttttgggaaataagtaaaca
15.071
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ctctttgggcaagttgtaaaca
14.631
32-659-6486.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

8 motifs = 11 70 0 0 thresholds = 7.124 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
aaaacgtaaaca
12.001
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaggtaaaca
12.561
7-327-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
aaaacgtaaata
9.711
11-703-6906.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
aaaaggtcaaca
10.921
22-271-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
aataagtaaaca
10.521
29-218-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
aagttgtaaaca
8.541
30-220-2065.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
aaatagtaaaca
10.651

9 motifs = 11 50 0 0 thresholds = 7.124 ||6.445 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1002.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaacaaa
9.371
5-597-5783.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
6-589-5774.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
gtaaacatt
8.111
12-166-1845.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
tatgtttgc
7.53-1
16-204-1841.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
gtaaacatt
8.111
22-271-2523.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gtaaacaat
8.881
30-220-2015.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gtaaacata
8.591
31-439-4546.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
gtaaacaaa
9.371

10 motifs = 50 138 0 0 thresholds = 6.445 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-503-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaaggg
8.851
10-636-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaa
10.81-1
11-772-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
cccgtttaggaaa
10.12-1
16-184-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaa
9.42-1
22-252-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttcctttttggg
10.941
29-213-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccccatccggaaa
10.33-1

11 motifs = 50 58 0 0 thresholds = 6.445 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-100-1112.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaagataaa
10.791
2-184-1902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
aaaaagataaa
10.791
4-175-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
4-191-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
5-578-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaaggtaaa
10.691
6-577-5834.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ttttttttttt
10.91-1
10-636-6263.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
caaagaggaaa
8.691
12-184-1745.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
caaagggtaaa
8.931
13-182-1956.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaaagaggaaa
9.751
15-573-5911.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
tttactctttt
9.85-1
16-490-4841.065000e+03YHR023W2.624000e+03NaNNaNNaN
ctaaacaaa
7.501
aaaaagataaa
10.791
18-314-3202.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
aaaaaggtaaa
10.691
19-166-1564.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1724.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1814.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
20-364-3795.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
aaaaagagaaa
10.701
22-252-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttt
10.37-1
23-184-1971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
ttttttttttt
10.91-1
29-213-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tttcccttttg
9.53-1
31-382-3886.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaaggtaaa
10.691
31-805-8116.062000e+03YPL141C5.969000e+03NaNNaNNaN
ataaagaaa
6.461
aaaaaaataaa
10.651

12 motifs = 95 131 0 0 thresholds = 9.232 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-670-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtcatctttggtggtc
9.27-1
gtcttggtcatctttggtg
10.531
11-671-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
ggtcaacaacgaagttc
10.56-1
gaaaaggtcaacaacgaag
12.341
14-412-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
gatttgggcaacaatgcgg
11.301
29-325-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaagagcaccgattgcc
11.111
tctcgagggtgcccctttc
10.46-1
32-591-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

13 motifs = 11 58 0 0 thresholds = 7.124 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-750-7364.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
tttctcctttc
9.12-1
5-597-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaaggtaaa
10.691
6-589-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
ttttttttttt
10.91-1
22-271-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttttcctttt
10.37-1
24-169-1554.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
gaaaaaaaaaa
10.031
29-291-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

14 motifs = 72 140 0 0 thresholds = 8.401 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-107-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccctttttggt
10.21-1
cctttttggtaaaacgtaaaca
14.761
10-629-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
tgtttacaaccgcccaaagagg
9.941
22-260-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
ctttttgggaaataagtaaaca
15.071
29-221-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ctctttgggcaagttgtaaaca
14.631

15 motifs = 50 72 0 0 thresholds = 6.445 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-100-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
gccctttttggt
10.21-1
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaa
9.501
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggta
8.901
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ttcctttttggg
9.32-1
29-213-2214.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ttcccttttggg
9.31-1

16 motifs = 72 138 0 0 thresholds = 8.401 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-629-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
cccaaagaggaaa
10.81-1
15-203-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cccaaaatggaa
8.401
cccaaaatggaaa
10.60-1
16-201-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
cccaaaagggta
8.901
cccaaaagggtaa
9.42-1
22-260-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
tttcctttttggg
10.941
29-221-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ccccatccggaaa
10.33-1
29-280-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.331
29-280-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1

17 motifs = 11 138 0 0 thresholds = 7.124 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ccctttttggtaa
8.51-1
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaa
10.48-1
10-632-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
cccaaagaggaaa
10.81-1
11-703-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
15-206-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cttcccaaaatggaaa
9.651
cccaaaatggaaa
10.60-1
16-204-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
cccaaaagggtaa
9.42-1
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttcctttttggg
10.941
26-583-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cccaaacgggcaa
9.61-1
28-194-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
tttccagattagg
9.001
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccccatccggaaa
10.33-1
29-277-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.331
29-277-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.33-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttccggatgggg
10.33-1
29-313-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.331
29-313-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.33-1
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

18 motifs = 11 126 0 0 thresholds = 7.124 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaaaaggtaaa
14.571
9-219-208YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tttatatatttcctatttgag
12.531
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
cctctttggggaaaagagaaa
12.891
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgaatcaggaaaaggtcaac
10.221
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
cctgtttaggaaaaaggtaaa
14.631
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
taaagatttttcctttttggg
9.001
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gttaattttgtcccaaacggg
11.731
28-194-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
ccagattaggaaagaacataa
10.751
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
cccttttgggtaacagcggac
11.701
29-277-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
cccttttgggtaacagcggac
11.701

19 motifs = 58 70 0 0 thresholds = 8.547 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-197-1805.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaata
10.271
7-321-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaagaggcaaa
9.011
aaaacgtaaata
9.711
11-161-1776.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttccttttg
9.89-1
tgttttcctttt
9.79-1
12-174-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
caaagggtaaa
8.931
aaaacgtcaata
8.071
13-195-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaaagaggaaa
9.751
aaagtgtaaaca
11.021
16-484-4951.065000e+03YHR023W2.624000e+03NaNNaNNaN
aaaaagataaa
10.791
aaaggctaaaca
8.171
19-156-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
19-181-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
21-169-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
21-169-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
29-223-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
aagttgtaaaca
8.541
31-377-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaaca
12.561

20 motifs = 62 114 0 0 thresholds = 8.515 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-691-6745.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatc
9.58-1
tcaccatcggcaaagtacctttcca
9.721
4-313-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
gatcaccatc
9.11-1
tcaccatcgtggtgctctttgtcat
15.031
5-870-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatagtgatg
9.691
tctccattgttctcgtattcttcct
13.501
23-360-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
acgatgatgataatgacgatggcga
12.361

21 motifs = 11 104 0 0 thresholds = 7.124 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaaacgtaaacaaaa
9.111
5-597-5853.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gaaaaaggtaaacaaca
11.551
22-271-2593.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gaaataagtaaacaata
9.741
24-169-1544.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
aaaaaaaaaacagaaaa
9.751
32-659-6406.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

22 motifs = 11 135 0 0 thresholds = 7.124 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
cctttttggtaa
11.36-1
12-166-1805.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
ttaccacaaagg
10.611
22-271-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
cctttttgggaa
10.21-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccttttgggtaa
10.95-1

23 motifs = 70 138 0 0 thresholds = 7.941 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-767-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
cccgtttaggaaa
10.12-1
15-200-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
cccaaaatggaaa
10.60-1
21-191-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttcccttttcggg
8.161
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
tttcctttttggg
10.941
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1
29-283-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.331
29-283-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1

24 motifs = 3 138 0 0 thresholds = 4.837 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-483-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
19-145-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
agaac
4.841
cccagaagggaaa
9.19-1
22-290-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttggg
10.941
26-527-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttgcccgtttggg
9.61-1
28-193-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
agaac
4.841
tttccagattagg
9.001
32-622-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

25 motifs = 70 143 0 0 thresholds = 7.941 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-582-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctcctccgaaaaagg
10.351
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
ccttttccaatagcg
9.05-1
15-200-2081.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
tacttcccaaaatgg
11.061
21-191-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
cgcttctcaaaaggg
11.371

26 motifs = 74 106 0 0 thresholds = 9.204 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-546-5655.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaagaat
9.251
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
ctgttgcagcagcaaaaccggc
9.121
22-736-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
cttcagcggcagccttaacagc
11.71-1
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctgaag
11.711
23-421-4111.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gtttagcttctgcattggcagc
8.681

27 motifs = 74 142 0 0 thresholds = 9.204 ||9.159 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-271-2843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgca
10.22-1
gaagcttccgctgcaggaaa
11.921
12-546-5595.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaaga
10.261
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
gttgcagcagcaaaaccggc
9.751
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctga
11.101

28 motifs = 138 140 0 0 thresholds = 8.111 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccctttttggtaa
8.51-1
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cccgatttggaaa
10.48-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgag
8.291
tgtttatatatttcctatttga
14.841
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-751-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
26-569-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
cccaaacgggcaa
9.61-1
ccaaacgggcaaaatataaata
13.831

29 motifs = 79 92 0 0 thresholds = 7.791 ||7.901 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
19-408-3984.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
ttcacaccggcacc
9.65-1
23-585-5951.613000e+03YKL130C3.580000e+03NaNNaNNaN
atacggtgcctgttgc
8.87-1
ggtgcctgttgcag
10.241
27-919-9294.497000e+03YML034W4.371000e+03NaNNaNNaN
gtttggtgccattttc
9.59-1
ggtgccattttcca
9.611
29-349-3594.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
ggtgcccctttcgg
9.431

30 motifs = 62 127 0 0 thresholds = 8.515 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-394-3753.084000e+03YGL116W2.089000e+03NaNNaNNaN
cttcacttcc
8.52-1
gaaagtgaaaaatgtg
10.631
8-809-8334.603000e+03YMR001C4.479000e+03NaNNaNNaN
catcaccatc
10.27-1
cactgttattgccttc
9.77-1
21-492-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggaagtgatg
9.211
gatgaaaacgatggtg
10.011
23-360-3691.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
gacgatgatgataatg
11.231
24-896-8874.047000e+03YLR057W3.908000e+03NaNNaNNaN
cttcactttc
8.90-1
cactttcatctttttc
11.63-1

31 motifs = 113 128 0 0 thresholds = 8.807 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-278-2685.551000e+03YOR025W5.449000e+03NaNNaNNaN
cagtggcaaatgc
10.021
tgcactgcatgtgtttctgtggc
8.261
22-54-713.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaattgcatttg
10.24-1
gtaattgcatttgcccttgagca
9.721
23-848-8371.613000e+03YKL130C3.580000e+03NaNNaNNaN
caactgcaactgc
10.021
gagacaactgcaactgcaactgc
11.791
25-632-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
caaaggcaattac
11.031
ggcagaactacaaaggcaattac
10.671

32 motifs = 3 80 0 0 thresholds = 4.837 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-975-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
tcttccagggtcccgata
10.47-1
8-327-3424.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
aagcggcagtttcaaaga
11.761
14-245-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tctatgctgctgcccata
9.95-1
23-291-2761.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
tcttcgtgcatgcctctt
10.89-1

33 motifs = 50 103 0 0 thresholds = 6.445 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-406-3923.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttgt
7.59-1
gatttcctcattcg
11.80-1
10-636-6283.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ccaaagaggaaaaa
9.761
22-252-2613.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttttgg
9.51-1
29-213-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tatttcccttttgg
11.04-1
30-201-2105.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gatttcctaaagcg
10.01-1

34 motifs = 103 138 0 0 thresholds = 8.603 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-628-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccaaagaggaaaaa
9.761
cccaaagaggaaa
10.81-1
15-202-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccaaaatggaaata
10.251
cccaaaatggaaa
10.60-1
22-261-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttttgg
9.51-1
tttcctttttggg
10.941
26-555-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
ttgcccgtttggg
9.61-1
26-555-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
cccaaacgggcaa
9.61-1
29-222-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-281-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.331
29-281-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
32-655-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

35 motifs = 75 78 0 0 thresholds = 7.403 ||8.229 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-270-2793.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgcag
10.51-1
ttccgctgcagga
10.671
10-379-3883.340000e+03YGR108W2.350000e+03NaNNaNNaN
tcttcctctgcag
10.91-1
ttcctctgcagaa
9.131
12-398-3895.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagaggtaaa
7.941
tccttcagaggta
10.90-1
22-735-7443.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.82-1
tgccgctgaaggt
9.091

36 motifs = 3 114 0 0 thresholds = 4.837 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-274-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
tcaccatcgtggtgctctttgtcat
15.031
5-894-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
tctccattgttctcgtattcttcct
13.501
14-496-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ttggcccactggccatcgttggtga
12.221
29-397-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
tccccatcgagtggcagtagttctt
10.341

37 motifs = 58 143 0 0 thresholds = 8.547 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-736-7154.121000e+03YLR131C3.983000e+03NaNNaNNaN
tttctcctttc
9.12-1
cacttcagaaatcag
10.021
6-583-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
6-608-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
14-170-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
ccttttccaatagcg
9.05-1
21-192-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
cgcttctcaaaaggg
11.371

38 motifs = 99 100 0 0 thresholds = 8.494 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-795-7804.345000e+03YLR353W4.215000e+03NaNNaNNaN
cttacccttcctc
8.94-1
cttcctccgctctcgtcttgtg
8.971
9-763-754YBR038W2.730000e+02NaNNaNNaN
cttcagcctcctt
8.76-1
cttcagcctccttctgtgtttc
10.391
29-269-2784.635000e+03YMR032W4.512000e+03NaNNaNNaN
accgaagcggaag
8.491
taacagcggaccgaagcggaag
8.821
30-967-9585.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctactccatcttt
10.61-1
ctactccatctttcatcccacc
10.161

39 motifs = 24 67 0 0 thresholds = 6.571 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-657-6524.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacccg
8.371
gcgttacccg
9.06-1
12-224-2465.551000e+03YOR025W5.449000e+03NaNNaNNaN
cgggtaa
8.37-1
cgggtatccc
10.091
14-210-2156.076000e+03YPL155C5.983000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagccc
9.631
18-733-7382.553000e+03YDR146C1.131000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagcca
9.401
28-228-2334.588000e+03YML119W4.464000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagcgc
8.941
28-622-6174.588000e+03YML119W4.464000e+03NaNNaNNaN
ttacccg
8.371
tggttacccg
9.53-1

40 motifs = 58 138 0 0 thresholds = 8.547 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-626-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
cccaaagaggaaa
10.81-1
21-169-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttcccttttcggg
8.161
21-192-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
ttcccttttcggg
8.161
22-262-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttt
10.37-1
tttcctttttggg
10.941
29-223-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1
29-282-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.331
29-282-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
ccccatccggaaa
10.33-1


Questions? --> kreiman@mit.edu

HOME