Location of motif pairs/triplets/quadruplets in each transcript within the cluster set

t=transcript number

p=position of last motif with respect to ATG for each motif

affy=affymetrix probe id

nm=refseq accession number

ug=unigene accession number

chr=chromosome

pos=chromosomal position

strand=strand

Saccharomyces Cerevisiae

1 motifs = 50 126 0 0 thresholds = 6.445 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ctcaaaacggcaaaatgtaaa
9.661
2-100-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ccctttttggtaaaacgtaaa
14.091
5-578-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaaaaggtaaa
14.571
8-503-5324.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
tctatatgttgcccgggtagg
8.39-1
9-224-208YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tttatatatttcctatttgag
12.531
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaaaacatcaa
11.511
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
gtttgctgttaccacaaaggg
11.201
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaattgcgtaa
10.021
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
gtttattattccccaagagag
10.001
18-314-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
cctgtttaggaaaaaggtaaa
14.631
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
taaagatttttcctttttggg
9.001
29-213-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
cccttttgggtaacagcggac
11.701
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
cctaaagcgggaaatagtaaa
9.461

2 motifs = 70 140 0 0 thresholds = 7.941 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
tcaaaacggcaaaatgtaaaca
14.491
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ccgatttggaaaaaggtaaaca
15.841
7-313-3233.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
cgaaagaggcaaaacgtaaata
14.111
9-219-209YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tgtttatatatttcctatttga
14.841
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
caaaaaaggagatttgtaaata
13.861
11-690-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
caaaaaaggagatttgtaaata
13.861
11-767-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaacgtcaata
8.071
cacaaagggtaaaacgtcaata
11.971
13-187-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaagtgtaaaca
11.021
ctaaaagaggaaagtgtaaaca
12.291
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tgtttatccttttccaatagcg
13.931
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctgtttaggaaaaaggtaaaca
15.591
21-145-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
tgttgacaaatttcctagttaa
13.151
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
ctttttgggaaataagtaaaca
15.071
29-204-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ctctttgggcaagttgtaaaca
14.631
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ctctttgggcaagttgtaaaca
14.631
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
ctaaagcgggaaatagtaaaca
14.881

3 motifs = 50 140 0 0 thresholds = 6.445 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
tcaaaacggcaaaatgtaaaca
14.491
2-100-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
cctttttggtaaaacgtaaaca
14.761
5-578-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ccgatttggaaaaaggtaaaca
15.841
9-224-209YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcctatttga
14.841
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
tgtttacaaccgcccaaagagg
9.941
11-772-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
caaaaaaggagatttgtaaata
13.861
12-184-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
cacaaagggtaaaacgtcaata
11.971
13-182-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
13-239-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
17-145-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
tgtttattattccccaagagag
13.061
18-314-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ctgtttaggaaaaaggtaaaca
15.591
20-79-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
cgcataaggaaacaaggacaca
9.411
22-252-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ctttttgggaaataagtaaaca
15.071
23-184-1691.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttcccgttttga
10.971
29-213-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ctctttgggcaagttgtaaaca
14.631
30-201-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
ctaaagcgggaaatagtaaaca
14.881

4 motifs = 50 138 0 0 thresholds = 6.445 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-536-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
cccgatttggaaa
10.48-1
8-503-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaaggg
8.851
8-503-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
ttacctaaaaggg
8.851
10-636-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaaa
10.81-1
11-772-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tatgtttac
8.59-1
cccgtttaggaaa
10.12-1
16-184-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggtaa
9.42-1
19-166-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
cccagaagggaaa
9.19-1
21-225-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
ttcccttttcggg
8.161
22-252-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttcctttttggg
10.941
23-837-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
ccccatgggccaa
8.11-1
29-213-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ccccatccggaaa
10.33-1

5 motifs = 70 126 0 0 thresholds = 7.941 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-372-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
aaaatgtaaaca
12.471
ctcaaaacggcaaaatgtaaa
9.661
2-105-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
aaaacgtaaaca
12.001
ccctttttggtaaaacgtaaa
14.091
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cccgatttggaaaaaggtaaa
14.571
7-313-3243.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaaacgtaaata
9.711
ccgaaagaggcaaaacgtaaa
12.251
9-219-208YBR038W2.730000e+02NaNNaNNaN
tgtttatatatt
8.04-1
tttatatatttcctatttgag
12.531
11-690-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
aaaaggtcaaca
10.921
ccgaatcaggaaaaggtcaac
10.221
14-171-1606.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
tttatccttttccaatagcgg
10.981
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cctgtttaggaaaaaggtaaa
14.631
21-145-1341.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttgacaaatttcctagttaag
8.571
29-204-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
cccttttgggtaacagcggac
11.701
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
cccttttgggtaacagcggac
11.701
30-206-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaatagtaaaca
10.651
cctaaagcgggaaatagtaaa
9.461

6 motifs = 11 98 0 0 thresholds = 7.124 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ggtaaaacgtaaaca
11.721
4-647-6575.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaccttaactggtga
7.201
gacttgtctttgtcc
8.97-1
5-597-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ggaaaaaggtaaaca
12.791
7-327-3163.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
ggcaaaacgtaaata
11.821
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
ggaaaaacatcaaca
11.761
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ggaaataagtaaaca
9.231
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gggttaattttgtcc
9.701
30-220-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gggaaatagtaaaca
8.881
32-659-6416.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN
32-659-6496.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

7 motifs = 11 140 0 0 thresholds = 7.124 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tgtttatatatttcctatttga
14.841
10-632-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
tgtttacaaccgcccaaagagg
9.941
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
ctctttggggaaaagagaaata
12.921
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
11-689-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
11-703-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
caaaaaaggagatttgtaaata
13.861
12-166-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
cacaaagggtaaaacgtcaata
11.971
18-319-3292.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
ctgtttaggaaaaaggtaaaca
15.591
22-257-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
ctttttgggaaataagtaaaca
15.071
29-218-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ctctttgggcaagttgtaaaca
14.631
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ctctttgggcaagttgtaaaca
14.631
32-659-6486.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

8 motifs = 50 98 0 0 thresholds = 6.445 ||8.863 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-323-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-367-3504.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
1-367-3754.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
ggcaaaatgtaaaca
12.701
2-100-1082.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
ggtaaaacgtaaaca
11.721
5-578-5863.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
ggaaaaaggtaaaca
12.791
6-577-5854.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
cgaaaaaggtaaaca
9.461
9-224-216YBR038W2.730000e+02NaNNaNNaN
tttgtttat
8.65-1
tgtttatatatttcc
9.49-1
10-636-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ggaaaaacatcaaca
11.761
12-184-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
ggtaaaacgtcaata
10.601
18-314-3222.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaaaaggtaaaca
12.791
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ggaaataagtaaaca
9.231
23-184-1761.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
tgtttgtattttccc
11.75-1
30-201-2095.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gggaaatagtaaaca
8.881

9 motifs = 11 135 0 0 thresholds = 7.124 ||9.254 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
cctttttggtaa
11.36-1
11-703-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgtttaggaaa
9.51-1
12-166-1805.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
ttaccacaaagg
10.611
22-271-2583.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
cctttttgggaa
10.21-1
26-583-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cctttcgggaaa
10.33-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccttttgggtaa
10.95-1
29-313-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccttttgggtaa
10.95-1

10 motifs = 138 140 0 0 thresholds = 8.111 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccctttttggtaa
8.51-1
cctttttggtaaaacgtaaaca
14.761
5-583-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cccgatttggaaa
10.48-1
ccgatttggaaaaaggtaaaca
15.841
9-219-209YBR038W2.730000e+02NaNNaNNaN
tttcctatttgag
8.291
tgtttatatatttcctatttga
14.841
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-689-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
11-751-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
cccgtttaggaaa
10.12-1
caaaaaaggagatttgtaaata
13.861
21-177-1351.420000e+03YIL158W2.990000e+03NaNNaNNaN
ttcccttttcggg
8.161
tgttgacaaatttcctagttaa
13.151
26-545-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
ttgcccgtttggg
9.61-1
ccaaacgggcaaaatataaata
13.831
26-569-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
cccaaacgggcaa
9.61-1
ccaaacgggcaaaatataaata
13.831
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatgggg
10.33-1
ctctttgggcaagttgtaaaca
14.631

11 motifs = 95 131 0 0 thresholds = 9.232 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-670-6902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtcatctttggtggtc
9.27-1
gtcttggtcatctttggtg
10.531
11-671-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
ggtcaacaacgaagttc
10.56-1
gaaaaggtcaacaacgaag
12.341
14-412-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
gatttgggcaacaatgcgg
11.301
14-463-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
ggccatcgttggtgatg
11.01-1
gatttgggcaacaatgcgg
11.301
29-325-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gaagagcaccgattgcc
11.111
tctcgagggtgcccctttc
10.46-1
32-591-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

12 motifs = 135 140 0 0 thresholds = 9.254 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-105-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
cctttttggtaa
11.36-1
cctttttggtaaaacgtaaaca
14.761
11-751-7286.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccgtttaggaaa
9.51-1
caaaaaaggagatttgtaaata
13.861
22-258-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
cctttttgggaa
10.21-1
ctttttgggaaataagtaaaca
15.071
26-545-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaa
10.33-1
ccaaacgggcaaaatataaata
13.831
29-277-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ctctttgggcaagttgtaaaca
14.631

13 motifs = 11 50 0 0 thresholds = 7.124 ||6.445 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1002.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaacaaa
9.371
5-583-5363.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
5-597-5783.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gtaaacaac
6.901
6-589-5774.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
gtaaacatt
8.111
8-535-5034.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagggtca
10.531
ataaagaaa
6.461
12-166-1845.551000e+03YOR025W5.449000e+03NaNNaNNaN
ttaccacaaagggtaa
7.64-1
tatgtttgc
7.53-1
16-204-1841.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
gtaaacatt
8.111
22-271-2523.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gtaaacaat
8.881
30-220-2015.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gtaaacata
8.591
31-439-4546.062000e+03YPL141C5.969000e+03NaNNaNNaN
cttcctaaaaaagcaa
7.811
gtaaacaaa
9.371

14 motifs = 11 70 0 0 thresholds = 7.124 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
aaaacgtaaaca
12.001
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaggtaaaca
12.561
7-327-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
aaaacgtaaata
9.711
11-703-6906.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
aaaaggtcaaca
10.921
22-271-2573.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
aataagtaaaca
10.521
29-218-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
aagttgtaaaca
8.541
29-313-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttccctttt
8.98-1
30-220-2065.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
aaatagtaaaca
10.651

15 motifs = 115 127 0 0 thresholds = 8.577 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-544-5642.989000e+03YGL021W1.995000e+03NaNNaNNaN
tgcaagggcttctgagac
9.771
gagggagaatacagag
8.611
3-395-4355.116000e+03YNL172W5.001000e+03NaNNaNNaN
tgcaagggctcccgcccc
9.571
gagggggagaatgatg
9.681
12-557-5875.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgctggtgctgcagttta
10.331
gaggatgacgatgagg
9.741
20-653-6995.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagcagcaaa
11.191
cattctcttctttgtc
9.73-1
23-413-3691.613000e+03YKL130C3.580000e+03NaNNaNNaN
ttagcttctgcattggca
9.34-1
gacgatgatgataatg
11.231

16 motifs = 50 58 0 0 thresholds = 6.445 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-100-1112.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaagataaa
10.791
2-184-1902.989000e+03YGL021W1.995000e+03NaNNaNNaN
ataaacaaa
8.651
aaaaagataaa
10.791
4-175-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
4-191-1975.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
aaaaaggtaaa
10.691
5-536-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaaggtaaa
10.691
5-578-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gtaaacaac
6.901
aaaaaggtaaa
10.691
6-577-5834.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ttttttttttt
10.91-1
6-577-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
gtaaacatt
8.111
ttttttttttt
10.91-1
10-636-6263.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
caaagaggaaa
8.691
12-184-1745.551000e+03YOR025W5.449000e+03NaNNaNNaN
tatgtttgc
7.53-1
caaagggtaaa
8.931
13-182-1956.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaaagaggaaa
9.751
13-239-1956.163000e+03YPL242C6.071000e+03NaNNaNNaN
attgtttat
8.17-1
aaaagaggaaa
9.751
15-573-5911.368000e+03YIL106W2.938000e+03NaNNaNNaN
gtacacaaa
6.471
tttactctttt
9.85-1
16-135-881.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
tttttttcttg
8.91-1
16-490-4841.065000e+03YHR023W2.624000e+03NaNNaNNaN
ctaaacaaa
7.501
aaaaagataaa
10.791
18-314-3202.553000e+03YDR146C1.131000e+03NaNNaNNaN
gtaaacaat
8.881
aaaaaggtaaa
10.691
19-166-1564.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1724.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
19-166-1814.529000e+03YML064C4.404000e+03NaNNaNNaN
gtaaacaag
6.901
gaaaaagcaaa
8.921
20-364-3795.680000e+02YCL063W6.040000e+02NaNNaNNaN
ataaacatt
7.391
aaaaagagaaa
10.701
21-225-1921.420000e+03YIL158W2.990000e+03NaNNaNNaN
ataaagaaa
6.461
caaaagggaaa
9.531
22-252-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttt
10.37-1
23-184-1971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tttgtttgt
7.59-1
ttttttttttt
10.91-1
23-837-8811.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
aaaaaaataaa
10.651
29-89-1314.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcaaacaat
7.821
gaaagaggaaa
8.871
29-213-2234.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tttcccttttg
9.53-1
29-434-4824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacatt
7.391
tttgcttcttt
8.87-1
30-201-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
aaaaaaaaaaa
10.911
31-382-3886.062000e+03YPL141C5.969000e+03NaNNaNNaN
gtaaacaaa
9.371
aaaaaggtaaa
10.691
31-805-8116.062000e+03YPL141C5.969000e+03NaNNaNNaN
ataaagaaa
6.461
aaaaaaataaa
10.651

17 motifs = 11 138 0 0 thresholds = 7.124 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
ccctttttggtaa
8.51-1
5-597-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaa
10.48-1
8-535-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagggtca
10.531
ttacctaaaaggg
8.851
10-632-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccgcccaaagaggaaa
9.591
cccaaagaggaaa
10.81-1
11-703-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
11-703-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
cccgtttaggaaa
10.12-1
15-206-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cttcccaaaatggaaa
9.651
cccaaaatggaaa
10.60-1
16-204-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
tagcccaaaagggtaa
10.201
cccaaaagggtaa
9.42-1
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttcctttttggg
10.941
26-583-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
ttgcccgtttggg
9.61-1
26-583-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
cccaaacgggcaa
9.61-1
28-194-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
tttccagattagg
9.001
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
ccccatccggaaa
10.33-1
29-277-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.33-1
29-277-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.331
29-277-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
ccccatccggaaa
10.33-1
29-291-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttccggatgggg
10.33-1
29-313-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttccggatgggg
10.33-1
29-313-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.331
29-313-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
ccccatccggaaa
10.33-1
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

18 motifs = 62 114 0 0 thresholds = 8.515 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-657-6952.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtggtgatg
9.891
attatgtcttggtcatctttggtgg
10.121
3-691-6745.116000e+03YNL172W5.001000e+03NaNNaNNaN
cttcaccatc
9.58-1
tcaccatcggcaaagtacctttcca
9.721
4-313-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
gatcaccatc
9.11-1
tcaccatcgtggtgctctttgtcat
15.031
5-870-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gatagtgatg
9.691
tctccattgttctcgtattcttcct
13.501
23-360-3711.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
acgatgatgataatgacgatggcga
12.361

19 motifs = 108 129 0 0 thresholds = 8.604 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
3-815-7755.116000e+03YNL172W5.001000e+03NaNNaNNaN
ccactccctcgtcgatgttcac
11.071
ccattggccatcaacaata
11.96-1
14-426-4666.076000e+03YPL155C5.983000e+03NaNNaNNaN
actggccatcgttggtgatgcc
11.23-1
ccactggccatcgttggtg
9.82-1
15-710-6941.368000e+03YIL106W2.938000e+03NaNNaNNaN
ggcggcacaggagatgtttcag
9.731
tttcagagaagtctactgg
10.371
22-643-6163.587000e+03YJL051W3.103000e+03NaNNaNNaN
cgcttccatcttcgatgcctcc
10.061
ccaattgtctccaaagttc
9.19-1

20 motifs = 74 142 0 0 thresholds = 9.204 ||9.159 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-271-2843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgca
10.22-1
gaagcttccgctgcaggaaa
11.921
12-546-5595.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaaga
10.261
12-546-5905.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaaga
10.261
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
gttgcagcagcaaaaccggc
9.751
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctga
11.101
23-421-3901.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gcggaaagtgctgacgatga
11.371

21 motifs = 2 50 140 0 thresholds = 6.900 ||6.445 ||9.292 ||NaN ||
tp1p2p3nmllugchrposstrandseq1score1strand1seq2score2strand2seq3score3strand3
1-408-367-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
gtaaacatt
8.111
tcaaaacggcaaaatgtaaaca
14.491
2-144-100-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
gtaaacaaa
9.371
cctttttggtaaaacgtaaaca
14.761
5-620-578-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
gtaaacaac
6.901
ccgatttggaaaaaggtaaaca
15.841
13-220-182-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291
13-220-239-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
attgtttat
8.17-1
ctaaaagaggaaagtgtaaaca
12.291

22 motifs = 63 106 0 0 thresholds = 9.512 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-62-775.551000e+03YOR025W5.449000e+03NaNNaNNaN
aaaactgaaggga
10.441
gtggttagtggtgtaaaaactg
8.721
14-260-2146.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtcctcagtttt
12.10-1
gggtagcccgatgatgcggctc
8.491
20-609-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
aaacctgaggaga
12.171
ctgttgcagcagcaaaaccggc
9.121
22-680-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
tctcctctgattt
11.23-1
cttcagcggcagccttaacagc
11.71-1

23 motifs = 65 138 0 0 thresholds = 9.209 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-628-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaagagacatt
10.841
cccgatttggaaa
10.48-1
8-529-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
aaaagggtcaaa
9.581
ttacctaaaaggg
8.851
16-198-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
aaaagggtaatt
10.801
cccaaaagggtaa
9.42-1
21-170-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttcccttttcggg
8.161
21-191-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
11.241
ttcccttttcggg
8.161
29-283-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ccccatccggaaa
10.331
29-283-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
11.24-1
ccccatccggaaa
10.33-1

24 motifs = 58 70 0 0 thresholds = 8.547 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-197-1805.200000e+02YCL014W5.570000e+02NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaata
10.271
6-608-5824.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
aaaaggtaaaca
12.561
7-321-3133.084000e+03YGL116W2.089000e+03NaNNaNNaN
aaagaggcaaa
9.011
aaaacgtaaata
9.711
11-161-1776.323000e+03YPR119W6.238000e+03NaNNaNNaN
ttttccttttg
9.89-1
tgttttcctttt
9.79-1
12-174-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
caaagggtaaa
8.931
aaaacgtcaata
8.071
13-195-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
aaaagaggaaa
9.751
aaagtgtaaaca
11.021
16-484-4951.065000e+03YHR023W2.624000e+03NaNNaNNaN
aaaaagataaa
10.791
aaaggctaaaca
8.171
19-156-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
19-181-1714.529000e+03YML064C4.404000e+03NaNNaNNaN
gaaaaagcaaa
8.921
aaaaggtaaaca
12.561
20-132-965.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
aaaatgtaaaca
12.471
21-169-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
21-169-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
21-192-1451.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
8.981
29-223-2044.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttg
9.53-1
aagttgtaaaca
8.541
30-176-2065.003000e+03YNL058C4.886000e+03NaNNaNNaN
aaaaaaaaaaa
10.911
aaatagtaaaca
10.651
31-377-3876.062000e+03YPL141C5.969000e+03NaNNaNNaN
aaaaaggtaaa
10.691
aaaaggtaaaca
12.561

25 motifs = 34 123 0 0 thresholds = 5.648 ||9.040 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-380-4022.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccgaaaactgga
6.561
tcccaccattagacta
11.30-1
17-374-3852.557000e+03YDR150W1.135000e+03NaNNaNNaN
agggaaaaagga
5.821
aggcctagttgaggga
10.331
23-750-7971.613000e+03YKL130C3.580000e+03NaNNaNNaN
tccaggttccgg
6.24-1
tccccccatgggccaa
10.20-1
31-923-9106.062000e+03YPL141C5.969000e+03NaNNaNNaN
ccgaccacggga
6.421
tccgaccacgggacaa
10.49-1

26 motifs = 69 72 0 0 thresholds = 8.609 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-7552.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
gccatcgttggt
9.28-1
14-905-8666.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaaaggatac
10.691
gccacctttggt
10.73-1
22-735-7073.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
accgaagatgcc
9.151
29-981-9354.635000e+03YMR032W4.512000e+03NaNNaNNaN
gattcttttgaag
8.85-1
tacaactttggg
8.52-1

27 motifs = 69 99 0 0 thresholds = 8.609 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-7582.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.73-1
catcgccatcgtt
10.42-1
12-379-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagtggccaa
9.001
catcaccttcctt
10.61-1
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
gaagatgccgttg
9.001
30-927-9675.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctgcagtggacca
8.631
ctactccatcttt
10.61-1

28 motifs = 50 72 0 0 thresholds = 6.445 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-367-3274.121000e+03YLR131C3.983000e+03NaNNaNNaN
gtaaacatt
8.111
gacacttttggt
10.45-1
2-100-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtaaacaaa
9.371
gccctttttggt
10.21-1
10-636-6293.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
cccaaagaggaa
9.501
16-184-2011.065000e+03YHR023W2.624000e+03NaNNaNNaN
gtaaacatt
8.111
cccaaaagggta
8.901
22-252-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
ttcctttttggg
9.32-1
29-213-2214.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
ttcccttttggg
9.31-1
29-896-9354.635000e+03YMR032W4.512000e+03NaNNaNNaN
ataaacata
7.881
tacaactttggg
8.52-1

29 motifs = 2 140 0 0 thresholds = 6.900 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3824.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
tcaaaacggcaaaatgtaaaca
14.491
2-144-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
cctttttggtaaaacgtaaaca
14.761
5-620-5933.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
ccgatttggaaaaaggtaaaca
15.841
12-210-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
cacaaagggtaaaacgtcaata
11.971
13-220-1976.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
ctaaaagaggaaagtgtaaaca
12.291

30 motifs = 11 104 0 0 thresholds = 7.124 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-1072.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
gtaaaacgtaaacaaaa
9.111
5-597-5853.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
gaaaaaggtaaacaaca
11.551
7-327-3693.084000e+03YGL116W2.089000e+03NaNNaNNaN
ttgccgaaagaggcaa
7.871
gaaaaatgtgaagtgca
10.391
11-542-5056.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
gaaaaaaaatcaaaata
9.861
22-271-2593.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gaaataagtaaacaata
9.741
24-169-1544.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
aaaaaaaaaacagaaaa
9.751
32-659-6406.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

31 motifs = 11 132 0 0 thresholds = 7.124 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-119-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ttgccctttttggtaa
7.491
tttggtaaaacgtaaacaaaata
10.651
6-589-5474.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcataagggaa
12.14-1
6-589-5994.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
tttttttttttttcataagggaa
12.141
11-542-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
agaaaggaaaaaaaatcaaaata
13.161
26-583-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
tattttatttctagataaaccct
11.361
27-220-1904.497000e+03YML034W4.371000e+03NaNNaNNaN
ttactgttttaggaag
8.90-1
tgtttttgttttggtttcaattt
11.231
30-220-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
ataaaacatttgtaaaaaaaaaa
13.531
32-659-6446.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

32 motifs = 70 138 0 0 thresholds = 7.941 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-767-7516.323000e+03YPR119W6.238000e+03NaNNaNNaN
tgtttacatatt
11.08-1
cccgtttaggaaa
10.12-1
15-200-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
cccaaaatggaaa
10.60-1
19-171-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
aaaaggtaaaca
12.561
cccagaagggaaa
9.19-1
21-145-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttcccttttcggg
8.161
21-191-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
ttcccttttcggg
8.161
22-257-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
aataagtaaaca
10.521
tttcctttttggg
10.941
29-204-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
aagttgtaaaca
8.541
ccccatccggaaa
10.33-1
29-218-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1
29-283-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.331
29-283-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttccctttt
8.98-1
ccccatccggaaa
10.33-1

33 motifs = 72 140 0 0 thresholds = 8.401 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-107-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
gccctttttggt
10.21-1
cctttttggtaaaacgtaaaca
14.761
10-258-2263.340000e+03YGR108W2.350000e+03NaNNaNNaN
ggcaattttggt
9.24-1
tttttacattcggccaaacttg
11.011
10-629-6213.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
tgtttacaaccgcccaaagagg
9.941
22-260-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
ctttttgggaaataagtaaaca
15.071
29-221-2284.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ctctttgggcaagttgtaaaca
14.631

34 motifs = 11 131 0 0 thresholds = 7.124 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
11-703-6916.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
gaaaaggtcaacaacgaag
12.341
14-423-4326.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttacgatttgggcaa
7.14-1
gatttgggcaacaatgcgg
11.301
29-313-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tctcgagggtgcccctttc
10.46-1
32-659-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

35 motifs = 50 129 0 0 thresholds = 6.445 ||9.123 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-443-3942.989000e+03YGL021W1.995000e+03NaNNaNNaN
gtcaacaaa
6.471
ccattagactacttcgacg
9.66-1
4-175-2185.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
ccagttgccaagacctagg
9.21-1
4-191-2185.200000e+02YCL014W5.570000e+02NaNNaNNaN
gtaaataaa
7.071
ccagttgccaagacctagg
9.21-1
9-562-515YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ccatttgactgccataagc
10.04-1
9-562-572YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ccatttgactgccataagc
10.04-1
23-837-7891.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcaaacata
7.531
ccatgggccaaccaaagga
9.95-1

36 motifs = 72 138 0 0 thresholds = 8.401 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-629-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
cccaaagaggaa
9.501
cccaaagaggaaa
10.81-1
15-203-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
cccaaaatggaa
8.401
cccaaaatggaaa
10.60-1
16-201-1901.065000e+03YHR023W2.624000e+03NaNNaNNaN
cccaaaagggta
8.901
cccaaaagggtaa
9.42-1
22-260-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
ttcctttttggg
9.32-1
tttcctttttggg
10.941
29-221-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttcccttttggg
9.31-1
ccccatccggaaa
10.33-1
29-280-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1
29-280-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.331
29-280-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1
29-346-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
gcccctttcggt
9.02-1
ccccatccggaaa
10.33-1

37 motifs = 3 114 0 0 thresholds = 4.837 ||9.717 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-274-2965.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
tcaccatcgtggtgctctttgtcat
15.031
5-894-8823.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
tctccattgttctcgtattcttcct
13.501
11-202-1606.323000e+03YPR119W6.238000e+03NaNNaNNaN
gttct
4.84-1
tagattcttttaacgacattggaga
11.981
13-945-9146.163000e+03YPL242C6.071000e+03NaNNaNNaN
agaac
4.841
tctccaatgatatagaaaatgtatt
12.621
14-496-4886.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ttggcccactggccatcgttggtga
12.221
29-397-3734.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
tccccatcgagtggcagtagttctt
10.341

38 motifs = 3 144 0 0 thresholds = 4.837 ||10.052 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-810-7642.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
caatactcacatcgcc
10.35-1
20-620-6255.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
caaaaccggcattacc
10.68-1
21-134-1661.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ggcggtggtcgtgttg
12.871
22-191-2143.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
caaaacgcacataccc
11.30-1

39 motifs = 83 121 0 0 thresholds = 9.139 ||8.435 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-841-8653.852000e+03YJR092W3.372000e+03NaNNaNNaN
ggatgttggacaagtt
9.351
tgatgccagggt
10.361
12-943-9265.551000e+03YOR025W5.449000e+03NaNNaNNaN
ggccgccgagcacgct
9.451
tgctgctgatgt
9.211
19-446-3974.529000e+03YML064C4.404000e+03NaNNaNNaN
agcgtggcaatcatca
9.78-1
acaccggcacca
9.72-1
23-382-4101.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgctgacgatgatgat
10.381
gcattggcagca
10.33-1

40 motifs = 11 58 0 0 thresholds = 7.124 ||8.547 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-750-7364.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
tttctcctttc
9.12-1
1-764-7364.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
tttctcctttc
9.12-1
5-597-5843.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaaaggtaaa
10.691
6-589-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
ttttttttttt
10.91-1
11-542-5096.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
gaaaagagaaa
9.811
22-271-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
tttttcctttt
10.37-1
24-169-1554.047000e+03YLR057W3.908000e+03NaNNaNNaN
tttcctattctagtga
7.601
gaaaaaaaaaa
10.031
29-291-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
29-313-2824.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tttcccttttg
9.53-1
30-220-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
aaaaaaaaaaa
10.911
32-659-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

41 motifs = 3 112 0 0 thresholds = 4.837 ||9.601 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-78-1193.340000e+03YGR108W2.350000e+03NaNNaNNaN
agaac
4.841
ttagatcacaaaagcg
10.121
22-290-2543.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
cctttttgggaaataa
9.84-1
23-291-2751.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
taacataccaaaagtg
9.911
26-527-5424.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttttgtcccaaacggg
10.081
29-374-3354.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
ttttcttccagaagag
11.801

42 motifs = 3 138 0 0 thresholds = 4.837 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-483-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
8-567-5354.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
ttacctaaaaggg
8.851
9-179-219YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tttcctatttgag
8.291
19-145-1304.529000e+03YML064C4.404000e+03NaNNaNNaN
agaac
4.841
cccagaagggaaa
9.19-1
21-134-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
ttcccttttcggg
8.161
22-290-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
tttcctttttggg
10.941
26-527-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
ttgcccgtttggg
9.61-1
26-527-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttct
4.84-1
cccaaacgggcaa
9.61-1
28-193-2084.588000e+03YML119W4.464000e+03NaNNaNNaN
agaac
4.841
tttccagattagg
9.001
32-622-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

43 motifs = 69 94 0 0 thresholds = 8.609 ||8.391 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-270-2843.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgcag
9.54-1
gaagcttccgctg
9.251
14-905-8796.076000e+03YPL155C5.983000e+03NaNNaNNaN
cttcaaaggatac
10.691
gaagccacctttg
9.311
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.72-1
gaagatgccgttg
9.851
29-438-4754.635000e+03YMR032W4.512000e+03NaNNaNNaN
ggatccactgaat
9.38-1
gtagctgccaaag
8.731

44 motifs = 121 141 0 0 thresholds = 8.435 ||8.805 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-865-8803.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgatgccagggt
10.361
tcgtattcttcctcg
9.93-1
12-560-5885.551000e+03YOR025W5.449000e+03NaNNaNNaN
tgatgctggtgc
8.871
ggatgacgatgagga
10.161
22-546-5183.587000e+03YJL051W3.103000e+03NaNNaNNaN
tgttgccaaggc
9.861
tgatgaggataatga
9.801
23-410-3761.613000e+03YKL130C3.580000e+03NaNNaNNaN
gcattggcagca
10.33-1
cgatgatgataatga
12.201

45 motifs = 11 126 0 0 thresholds = 7.124 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-583-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
cccgatttggaaaaaggtaaa
14.571
9-219-208YBR038W2.730000e+02NaNNaNNaN
tttcctatttgagtat
7.281
tttatatatttcctatttgag
12.531
11-542-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
taacctctttggggaa
7.63-1
cctctttggggaaaagagaaa
12.891
11-689-7006.323000e+03YPR119W6.238000e+03NaNNaNNaN
cgaccgaatcaggaaa
7.77-1
ccgaatcaggaaaaggtcaac
10.221
18-319-3302.553000e+03YDR146C1.131000e+03NaNNaNNaN
aatcccaatccgggca
8.511
cctgtttaggaaaaaggtaaa
14.631
22-271-2603.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
taaagatttttcctttttggg
9.001
26-583-5564.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gttaattttgtcccaaacggg
11.73-1
26-583-5724.180000e+03YLR190W4.046000e+03NaNNaNNaN
tgtcccaaacgggcaa
11.081
gttaattttgtcccaaacggg
11.731
28-194-2054.588000e+03YML119W4.464000e+03NaNNaNNaN
tttccagattaggaaa
11.14-1
ccagattaggaaagaacataa
10.751
29-218-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttcccttttgggtaa
10.22-1
cccttttgggtaacagcggac
11.701
29-277-2294.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
cccttttgggtaacagcggac
11.701
29-277-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
tttccggatggggcaa
9.58-1
cccttttgggtaacagcggac
11.701
29-313-2884.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
cccttttgggtaacagcggac
11.701

46 motifs = 98 104 0 0 thresholds = 8.863 ||8.780 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-489-4465.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tttttagtttatttttc
8.86-1
4-489-4555.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tttttagtttatttttc
8.86-1
7-316-2713.084000e+03YGL116W2.089000e+03NaNNaNNaN
ggcaaaacgtaaata
11.821
gaaaaatgcaacgacaa
12.161
11-545-5056.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
gaaaaaaaatcaaaata
9.861
14-168-1256.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttttcc
9.46-1
gaaaaataaaaagaaat
9.691
23-176-1901.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgtttgtattttccc
11.75-1
ttttttttttttttttc
11.361
26-650-6914.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
ttttagtcccttttttc
11.47-1
32-649-6406.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

47 motifs = 75 99 0 0 thresholds = 7.403 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-733-7582.989000e+03YGL021W1.995000e+03NaNNaNNaN
gcttcccctgaag
10.60-1
catcgccatcgtt
10.42-1
6-787-7954.345000e+03YLR353W4.215000e+03NaNNaNNaN
tcctccgctctcg
8.57-1
cttacccttcctc
8.94-1
12-398-3515.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagaggtaaa
7.941
catcaccttcctt
10.61-1
22-735-7043.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.82-1
gaagatgccgttg
9.001

48 motifs = 50 103 0 0 thresholds = 6.445 ||8.603 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-406-3923.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttgt
7.59-1
gatttcctcattcg
11.80-1
10-636-6283.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
ccaaagaggaaaaa
9.761
20-79-425.680000e+02YCL063W6.040000e+02NaNNaNNaN
gtaaagaat
6.691
cgcataaggaaaca
9.951
22-252-2613.587000e+03YJL051W3.103000e+03NaNNaNNaN
gtaaacaat
8.881
tttttcctttttgg
9.51-1
29-213-2224.635000e+03YMR032W4.512000e+03NaNNaNNaN
gtaaacaat
8.881
tatttcccttttgg
11.04-1
30-201-2105.003000e+03YNL058C4.886000e+03NaNNaNNaN
gtaaacata
8.591
gatttcctaaagcg
10.01-1

49 motifs = 103 138 0 0 thresholds = 8.603 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
10-628-6183.340000e+03YGR108W2.350000e+03NaNNaNNaN
ccaaagaggaaaaa
9.761
cccaaagaggaaa
10.81-1
11-642-6896.323000e+03YPR119W6.238000e+03NaNNaNNaN
ccctcgaggaaata
9.971
cccgtttaggaaa
10.12-1
15-202-1921.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccaaaatggaaata
10.251
cccaaaatggaaa
10.60-1
22-261-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttttcctttttgg
9.51-1
tttcctttttggg
10.941
26-555-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
ttgcccgtttggg
9.61-1
26-555-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaata
10.011
cccaaacgggcaa
9.61-1
29-222-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-281-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
29-281-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.331
29-281-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
tatttcccttttgg
11.04-1
ccccatccggaaa
10.33-1
32-655-6456.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

50 motifs = 3 68 0 0 thresholds = 4.837 ||9.019 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-358-3854.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
tcaatcaccttc
10.99-1
12-339-3545.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
ttcatcaccttc
10.35-1
21-300-3481.420000e+03YIL158W2.990000e+03NaNNaNNaN
agaac
4.841
gaaggagatgta
9.971
24-371-4204.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
gaaggtgatgat
9.661
27-720-7334.497000e+03YML034W4.371000e+03NaNNaNNaN
gttct
4.84-1
gaaggagctggt
9.671

51 motifs = 135 138 0 0 thresholds = 9.254 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-535-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacctaaaagg
11.361
ttacctaaaaggg
8.851
22-258-2713.587000e+03YJL051W3.103000e+03NaNNaNNaN
cctttttgggaa
10.21-1
tttcctttttggg
10.941
26-545-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
cctttcgggaaa
10.33-1
cccaaacgggcaa
9.61-1
29-277-2324.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.33-1
29-277-2914.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.331
29-277-2994.635000e+03YMR032W4.512000e+03NaNNaNNaN
ccttttgggtaa
10.95-1
ccccatccggaaa
10.33-1

52 motifs = 98 132 0 0 thresholds = 8.863 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-108-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ggtaaaacgtaaaca
11.721
tttggtaaaacgtaaacaaaata
10.651
4-489-4455.200000e+02YCL014W5.570000e+02NaNNaNNaN
tggtggatttttacc
9.41-1
tagtttatttttcacttttttct
10.251
6-585-5474.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
tttttttttttttcataagggaa
12.14-1
6-585-5994.345000e+03YLR353W4.215000e+03NaNNaNNaN
cgaaaaaggtaaaca
9.461
tttttttttttttcataagggaa
12.141
11-545-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
gggaaaagagaaata
10.471
agaaaggaaaaaaaatcaaaata
13.161
14-168-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttttcc
9.46-1
aagcagaagcgaaaaataaaaag
10.911
26-572-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.701
tattttatttctagataaaccct
11.361
26-580-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaattttgtcc
9.70-1
tattttatttctagataaaccct
11.361
26-650-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gggttaagtttttcc
10.04-1
tattttatttctagataaaccct
11.361
30-209-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
gggaaatagtaaaca
8.881
ataaaacatttgtaaaaaaaaaa
13.531

53 motifs = 126 132 0 0 thresholds = 8.394 ||9.994 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-116-932.989000e+03YGL021W1.995000e+03NaNNaNNaN
ccctttttggtaaaacgtaaa
14.091
tttggtaaaacgtaaacaaaata
10.651
11-552-5116.323000e+03YPR119W6.238000e+03NaNNaNNaN
cctctttggggaaaagagaaa
12.891
agaaaggaaaaaaaatcaaaata
13.161
14-160-1356.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatccttttccaatagcgg
10.981
aagcagaagcgaaaaataaaaag
10.911
26-556-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.73-1
tattttatttctagataaaccct
11.361
26-572-6054.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.731
tattttatttctagataaaccct
11.361
28-205-1864.588000e+03YML119W4.464000e+03NaNNaNNaN
ccagattaggaaagaacataa
10.751
aggaaagaacataaataaaaaca
13.331
30-216-1885.003000e+03YNL058C4.886000e+03NaNNaNNaN
cctaaagcgggaaatagtaaa
9.461
ataaaacatttgtaaaaaaaaaa
13.531
32-656-6446.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

54 motifs = 2 70 0 0 thresholds = 6.900 ||7.941 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3724.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
aaaatgtaaaca
12.471
2-144-1052.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
aaaacgtaaaca
12.001
2-144-1892.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
aaaagataaaca
9.521
5-620-5833.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
aaaaggtaaaca
12.561
12-210-1665.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
aaaacgtcaata
8.071
13-220-1876.163000e+03YPL242C6.071000e+03NaNNaNNaN
tatttcgtatatagtgatttaa
10.521
aaagtgtaaaca
11.021
15-236-2001.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccactcgtataatatgacaaat
7.641
aaaatggaaata
8.881

55 motifs = 3 62 0 0 thresholds = 4.837 ||8.515 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-810-7612.989000e+03YGL021W1.995000e+03NaNNaNNaN
agaac
4.841
catcgccatc
8.92-1
4-274-3135.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
gatcaccatc
9.11-1
5-894-8703.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gatagtgatg
9.691
7-416-3943.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
cttcacttcc
8.52-1
7-430-3943.084000e+03YGL116W2.089000e+03NaNNaNNaN
gttct
4.84-1
cttcacttcc
8.52-1
12-339-3545.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
catcaccttc
10.18-1
19-900-9394.529000e+03YML064C4.404000e+03NaNNaNNaN
gttct
4.84-1
ggtagtgaag
8.611
24-371-4204.047000e+03YLR057W3.908000e+03NaNNaNNaN
agaac
4.841
gaaggtgatg
10.181

56 motifs = 70 143 0 0 thresholds = 7.941 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-582-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
aaaaggtaaaca
12.561
ctcctccgaaaaagg
10.351
14-171-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tgtttatccttt
8.08-1
ccttttccaatagcg
9.05-1
15-200-2081.368000e+03YIL106W2.938000e+03NaNNaNNaN
aaaatggaaata
8.881
tacttcccaaaatgg
11.061
21-191-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
aaaagggaaata
8.981
cgcttctcaaaaggg
11.371

57 motifs = 126 138 0 0 thresholds = 8.394 ||8.111 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-532-4964.603000e+03YMR001C4.479000e+03NaNNaNNaN
tctatatgttgcccgggtagg
8.39-1
ttacctaaaaggg
8.851
21-134-1771.420000e+03YIL158W2.990000e+03NaNNaNNaN
ttgacaaatttcctagttaag
8.571
ttcccttttcggg
8.161
26-556-5694.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.73-1
cccaaacgggcaa
9.61-1
26-572-5454.180000e+03YLR190W4.046000e+03NaNNaNNaN
gttaattttgtcccaaacggg
11.731
ttgcccgtttggg
9.61-1
29-229-2774.635000e+03YMR032W4.512000e+03NaNNaNNaN
cccttttgggtaacagcggac
11.701
tttccggatgggg
10.33-1

58 motifs = 3 128 0 0 thresholds = 4.837 ||7.918 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-894-9283.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
gttgctgcagttggctattactc
8.901
13-664-7016.163000e+03YPL242C6.071000e+03NaNNaNNaN
gttct
4.84-1
gagttttgtactgttacatcaac
9.861
14-496-5136.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
ggctcctgtatctctgcaattac
8.711
20-620-6525.680000e+02YCL063W6.040000e+02NaNNaNNaN
agaac
4.841
gctgttgcagcagcaaaaccggc
12.881
22-93-713.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
gtaattgcatttgcccttgagca
9.721
23-871-8371.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gagacaactgcaactgcaactgc
11.791
23-871-8491.613000e+03YKL130C3.580000e+03NaNNaNNaN
agaac
4.841
gagacaactgcaactgcaactgc
11.79-1
25-639-6214.074000e+03YLR084C3.935000e+03NaNNaNNaN
agaac
4.841
ggcagaactacaaaggcaattac
10.671

59 motifs = 2 126 0 0 thresholds = 6.900 ||8.394 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-408-3834.121000e+03YLR131C3.983000e+03NaNNaNNaN
ggttgtcataatatacgatata
7.811
ctcaaaacggcaaaatgtaaa
9.661
2-144-1162.989000e+03YGL021W1.995000e+03NaNNaNNaN
tatgatcgctcgtgacggatcg
7.511
ccctttttggtaaaacgtaaa
14.091
5-620-5943.852000e+03YJR092W3.372000e+03NaNNaNNaN
cattgtcgcgaggaacgaatag
7.161
cccgatttggaaaaaggtaaa
14.571
12-210-1695.551000e+03YOR025W5.449000e+03NaNNaNNaN
caacatcacgaacgacgtttat
8.261
gtttgctgttaccacaaaggg
11.201
15-236-2031.368000e+03YIL106W2.938000e+03NaNNaNNaN
ccactcgtataatatgacaaat
7.641
cccaaaatggaaatatcaaaa
12.061

60 motifs = 58 143 0 0 thresholds = 8.547 ||8.896 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-736-7154.121000e+03YLR131C3.983000e+03NaNNaNNaN
tttctcctttc
9.12-1
cacttcagaaatcag
10.021
6-583-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
6-608-5914.345000e+03YLR353W4.215000e+03NaNNaNNaN
ttttttttttt
10.91-1
ctcctccgaaaaagg
10.351
10-626-6693.340000e+03YGR108W2.350000e+03NaNNaNNaN
caaagaggaaa
8.691
cgttttcgagtaggg
9.34-1
14-170-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
tttatcctttt
10.10-1
ccttttccaatagcg
9.05-1
21-169-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
cgcttctcaaaaggg
11.371
21-192-1991.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
cgcttctcaaaaggg
11.371

61 motifs = 3 140 0 0 thresholds = 4.837 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-358-3424.345000e+03YLR353W4.215000e+03NaNNaNNaN
agaac
4.841
ttaggaaggaaaataataaaga
9.381
9-179-209YBR038W2.730000e+02NaNNaNNaN
agaac
4.841
tgtttatatatttcctatttga
14.841
12-128-1765.551000e+03YOR025W5.449000e+03NaNNaNNaN
agaac
4.841
cacaaagggtaaaacgtcaata
11.971
17-86-1302.557000e+03YDR150W1.135000e+03NaNNaNNaN
gttct
4.84-1
tgtttattattccccaagagag
13.061
18-89-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
18-114-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
18-149-1182.553000e+03YDR146C1.131000e+03NaNNaNNaN
agaac
4.841
cgttcttggagctaggtaaata
9.821
22-290-2673.587000e+03YJL051W3.103000e+03NaNNaNNaN
agaac
4.841
ctttttgggaaataagtaaaca
15.071
32-622-6486.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

62 motifs = 79 92 0 0 thresholds = 7.791 ||7.901 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
19-408-3984.529000e+03YML064C4.404000e+03NaNNaNNaN
cacaccggcaccacct
7.791
ttcacaccggcacc
9.65-1
23-585-5951.613000e+03YKL130C3.580000e+03NaNNaNNaN
atacggtgcctgttgc
8.87-1
ggtgcctgttgcag
10.241
27-919-9294.497000e+03YML034W4.371000e+03NaNNaNNaN
gtttggtgccattttc
9.59-1
ggtgccattttcca
9.611
29-349-3594.635000e+03YMR032W4.512000e+03NaNNaNNaN
cgagggtgcccctttc
11.18-1
ggtgcccctttcgg
9.431

63 motifs = 50 71 0 0 thresholds = 6.445 ||9.133 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-503-5414.603000e+03YMR001C4.479000e+03NaNNaNNaN
ataaagaaa
6.461
tctctgtcaaaa
10.31-1
9-562-550YBR038W2.730000e+02NaNNaNNaN
gtaaagaat
6.691
ctttgagtgagc
10.301
10-636-6573.340000e+03YGR108W2.350000e+03NaNNaNNaN
tttgtttac
9.37-1
gctctcacaaaa
9.73-1
17-145-1832.557000e+03YDR150W1.135000e+03NaNNaNNaN
tttgtttat
8.65-1
ctttgacggaga
10.021

64 motifs = 59 74 0 0 thresholds = 8.576 ||9.204 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-559-5465.551000e+03YOR025W5.449000e+03NaNNaNNaN
gatgctggtgctg
10.101
gctggtgctgca
9.50-1
22-749-7363.587000e+03YJL051W3.103000e+03NaNNaNNaN
aaggctgccgctg
9.151
gctgccgctgaa
10.22-1
23-384-4211.613000e+03YKL130C3.580000e+03NaNNaNNaN
agtgctgacgatg
9.671
tgcattggcagc
9.591
28-43-564.588000e+03YML119W4.464000e+03NaNNaNNaN
cacctgcagcctt
9.01-1
tgcacctgcagc
9.721

65 motifs = 74 106 0 0 thresholds = 9.204 ||8.489 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
12-546-5655.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaagaat
9.251
12-546-5905.551000e+03YOR025W5.449000e+03NaNNaNNaN
gctggtgctgca
9.50-1
gaggatgacgatgaggaagaat
9.251
20-653-6315.680000e+02YCL063W6.040000e+02NaNNaNNaN
tgctgttgcagc
9.711
ctgttgcagcagcaaaaccggc
9.121
22-736-7133.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
cttcagcggcagccttaacagc
11.71-1
22-736-7553.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaa
10.22-1
gctgttaaggctgccgctgaag
11.711
23-421-4111.613000e+03YKL130C3.580000e+03NaNNaNNaN
tgcattggcagc
9.591
gtttagcttctgcattggcagc
8.681

66 motifs = 3 73 0 0 thresholds = 4.837 ||8.401 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-274-2325.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
gagcgattgccagt
11.13-1
12-339-3755.551000e+03YOR025W5.449000e+03NaNNaNNaN
gttct
4.84-1
agtggccaaagttc
11.121
13-664-6896.163000e+03YPL242C6.071000e+03NaNNaNNaN
gttct
4.84-1
agtggcaatagtgc
11.611
14-496-4816.076000e+03YPL155C5.983000e+03NaNNaNNaN
agaac
4.841
actggccatcgttg
9.701
29-374-3874.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
agtggcagtagttc
10.921
29-397-3874.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
agtggcagtagttc
10.921

67 motifs = 11 50 58 0 thresholds = 7.124 ||6.445 ||8.547 ||NaN ||
tp1p2p3nmllugchrposstrandseq1score1strand1seq2score2strand2seq3score3strand3
6-589-577-6084.345000e+03YLR353W4.215000e+03NaNNaNNaN
cctccgaaaaaggtaa
8.021
gtaaacatt
8.111
ttttttttttt
10.91-1
22-271-252-2623.587000e+03YJL051W3.103000e+03NaNNaNNaN
tttcctttttgggaaa
10.60-1
gtaaacaat
8.881
tttttcctttt
10.37-1
30-220-201-1765.003000e+03YNL058C4.886000e+03NaNNaNNaN
tttcctaaagcgggaa
9.111
gtaaacata
8.591
aaaaaaaaaaa
10.911

68 motifs = 62 127 0 0 thresholds = 8.515 ||8.346 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
7-394-3753.084000e+03YGL116W2.089000e+03NaNNaNNaN
cttcacttcc
8.52-1
gaaagtgaaaaatgtg
10.631
8-809-8334.603000e+03YMR001C4.479000e+03NaNNaNNaN
catcaccatc
10.27-1
cactgttattgccttc
9.77-1
21-492-4861.420000e+03YIL158W2.990000e+03NaNNaNNaN
ggaagtgatg
9.211
gatgaaaacgatggtg
10.011
23-360-3691.613000e+03YKL130C3.580000e+03NaNNaNNaN
gatggcgatg
8.921
gacgatgatgataatg
11.231
24-896-8874.047000e+03YLR057W3.908000e+03NaNNaNNaN
cttcactttc
8.90-1
cactttcatctttttc
11.63-1

69 motifs = 75 78 0 0 thresholds = 7.403 ||8.229 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-270-2793.852000e+03YJR092W3.372000e+03NaNNaNNaN
gcttccgctgcag
10.51-1
ttccgctgcagga
10.671
10-379-3883.340000e+03YGR108W2.350000e+03NaNNaNNaN
tcttcctctgcag
10.91-1
ttcctctgcagaa
9.131
12-398-3895.551000e+03YOR025W5.449000e+03NaNNaNNaN
cttcagaggtaaa
7.941
tccttcagaggta
10.90-1
22-735-7443.587000e+03YJL051W3.103000e+03NaNNaNNaN
gctgccgctgaag
9.82-1
tgccgctgaaggt
9.091

70 motifs = 58 65 0 0 thresholds = 8.547 ||9.209 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
5-584-6283.852000e+03YJR092W3.372000e+03NaNNaNNaN
aaaaaggtaaa
10.691
aaaagagacatt
10.841
11-509-5426.323000e+03YPR119W6.238000e+03NaNNaNNaN
gaaaagagaaa
9.811
aaaagagaaata
11.461
15-591-5551.368000e+03YIL106W2.938000e+03NaNNaNNaN
tttactctttt
9.85-1
ttttactctttt
10.59-1
20-132-1395.680000e+02YCL063W6.040000e+02NaNNaNNaN
gaaaagagaaa
9.811
aaaagagaaaaa
11.201
21-169-1911.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
11.241
21-192-1701.420000e+03YIL158W2.990000e+03NaNNaNNaN
caaaagggaaa
9.531
aaaagggaaata
11.241
24-155-1694.047000e+03YLR057W3.908000e+03NaNNaNNaN
gaaaaaaaaaa
10.031
aatggctctttt
9.92-1
25-221-2654.074000e+03YLR084C3.935000e+03NaNNaNNaN
aaaaaaagaaa
10.551
aattcctctttt
10.94-1
32-251-2966.360000e+03YPR156C6.278000e+03NaNNaNNaN
tttgctctttt
9.11-1
ttttccactttt
9.21-1

71 motifs = 3 80 0 0 thresholds = 4.837 ||9.703 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-912-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
tcttccagggtcccgata
10.47-1
4-975-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
tcttccagggtcccgata
10.47-1
4-986-9605.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
tcttccagggtcccgata
10.47-1
8-327-3424.603000e+03YMR001C4.479000e+03NaNNaNNaN
agaac
4.841
aagcggcagtttcaaaga
11.761
14-245-2306.076000e+03YPL155C5.983000e+03NaNNaNNaN
gttct
4.84-1
tctatgctgctgcccata
9.95-1
23-291-2761.613000e+03YKL130C3.580000e+03NaNNaNNaN
gttct
4.84-1
tcttcgtgcatgcctctt
10.89-1

72 motifs = 3 131 0 0 thresholds = 4.837 ||9.525 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
4-912-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
cttccagggtcccgataac
9.64-1
4-975-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
gttct
4.84-1
cttccagggtcccgataac
9.64-1
4-986-9585.200000e+02YCL014W5.570000e+02NaNNaNNaN
agaac
4.841
cttccagggtcccgataac
9.64-1
5-894-8873.852000e+03YJR092W3.372000e+03NaNNaNNaN
gttct
4.84-1
ctccattgttctcgtattc
10.46-1
29-374-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
agaac
4.84-1
tctcgagggtgcccctttc
10.46-1
29-397-3494.635000e+03YMR032W4.512000e+03NaNNaNNaN
gttct
4.84-1
tctcgagggtgcccctttc
10.46-1
32-622-6116.360000e+03YPR156C6.278000e+03NaNNaNNaN
n
NaNNaN
n
NaNNaN

73 motifs = 11 65 0 0 thresholds = 7.124 ||9.209 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
1-750-7374.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
aatttctccttt
10.63-1
1-764-7374.121000e+03YLR131C3.983000e+03NaNNaNNaN
tgtcccaataaggcac
7.58-1
aatttctccttt
10.63-1
5-583-6283.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaagagacatt
10.841
5-597-6283.852000e+03YJR092W3.372000e+03NaNNaNNaN
tgacccgatttggaaa
9.68-1
aaaagagacatt
10.841
25-278-2654.074000e+03YLR084C3.935000e+03NaNNaNNaN
ttcccaaattaggcaa
8.14-1
aattcctctttt
10.94-1
29-313-2834.635000e+03YMR032W4.512000e+03NaNNaNNaN
ttgccccatccggaaa
9.581
tatttccctttt
11.24-1

74 motifs = 132 140 0 0 thresholds = 9.994 ||9.292 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
2-93-1152.989000e+03YGL021W1.995000e+03NaNNaNNaN
tttggtaaaacgtaaacaaaata
10.651
cctttttggtaaaacgtaaaca
14.761
11-511-5526.323000e+03YPR119W6.238000e+03NaNNaNNaN
agaaaggaaaaaaaatcaaaata
13.161
ctctttggggaaaagagaaata
12.921
14-135-1616.076000e+03YPL155C5.983000e+03NaNNaNNaN
aagcagaagcgaaaaataaaaag
10.911
tgtttatccttttccaatagcg
13.931
26-605-5794.180000e+03YLR190W4.046000e+03NaNNaNNaN
tattttatttctagataaaccct
11.361
ccaaacgggcaaaatataaata
13.831
30-188-2165.003000e+03YNL058C4.886000e+03NaNNaNNaN
ataaaacatttgtaaaaaaaaaa
13.531
ctaaagcgggaaatagtaaaca
14.881

75 motifs = 99 100 0 0 thresholds = 8.494 ||8.818 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
6-795-7804.345000e+03YLR353W4.215000e+03NaNNaNNaN
cttacccttcctc
8.94-1
cttcctccgctctcgtcttgtg
8.971
9-763-754YBR038W2.730000e+02NaNNaNNaN
cttcagcctcctt
8.76-1
cttcagcctccttctgtgtttc
10.391
29-269-2784.635000e+03YMR032W4.512000e+03NaNNaNNaN
accgaagcggaag
8.491
taacagcggaccgaagcggaag
8.821
30-967-9585.003000e+03YNL058C4.886000e+03NaNNaNNaN
ctactccatcttt
10.61-1
ctactccatctttcatcccacc
10.161

76 motifs = 24 67 0 0 thresholds = 6.571 ||8.494 ||NaN ||NaN ||
tp1p2nmllugchrposstrandseq1score1strand1seq2score2strand2
8-657-6524.603000e+03YMR001C4.479000e+03NaNNaNNaN
ttacccg
8.371
gcgttacccg
9.06-1
12-224-2465.551000e+03YOR025W5.449000e+03NaNNaNNaN
cgggtaa
8.37-1
cgggtatccc
10.091
14-210-2156.076000e+03YPL155C5.983000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagccc
9.631
18-733-7382.553000e+03YDR146C1.131000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagcca
9.401
28-228-2334.588000e+03YML119W4.464000e+03NaNNaNNaN
cgggtag
7.29-1
cgggtagcgc
8.941
28-622-6174.588000e+03YML119W4.464000e+03NaNNaNNaN
ttacccg
8.371
tggttacccg
9.53-1


Questions? --> kreiman@mit.edu

HOME