The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 8 of 8 for CEBPB and GATA2. (0.09 seconds) |
Localization of 54 rat genes, and definition of new synteny groups conserved in the human and the … - Full text - MIT Libraries
IM Genome - Mammalian Genome, 2000 - springerlink.com
... (1999) A (Rasgrf3?) Cebpb 1.4 kg rat cDNA (6.8) b — Poli et al. (1990) A ...
ATCTTGACCTGCGTGGGCGTGA Chr 4 Gata2 3.1 kb mouse cDNA (L4) b — Minegishi et al. ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... CEBPB YY1 88.8 ER P300 38.1 AP4 RFX1 22.6 NFAT STAT 307.9 AML1 LMO2COM 88.4 PAX3
WHN 37.4 ELK1 HSF2 22.4 ATF XBP1 306.2 CREB HNF1 87.4 ETS2 IRF1 36.9 GATA2 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... N” artifacts in TRANSFAC ® TFBS family Description GATA1 02 GATA-binding factor
1 GATA1 03 GATA-binding factor 1 GATA1 04 GATA-binding factor 1 GATA2 01 GATA ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Multiplex Three-Dimensional Brain Gene Expression Mapping in a Mouse Model of Parkinson's Disease - Full text - MIT Libraries
VM Brown, A Ossadtchi, AH Khan, S Yee, G Lacan, WP … - Genome Research, 2002 - genome.org
... Potential binding sites are: (1) LMO2COM, (2) OCT1, (3) GATA2 and GATA3, (4) MYOD,
(5 ... HFH2, (26,27) HFH8 and HFH3, (28) HFH-3, (29) GATA, (30) CEBPB, (31) MYOD ...
Cited by 16 - Web Search - labs.pharmacology.ucla.edu - csb.yale.edu - dx.doi.org - all 8 versions »
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
... being up-regulated with myeloid differentiation, 6 whereas GATA1 and GATA2 are
down-regulated. 6,7 Disruption in the expression, sequence ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing … - Full text - MIT Libraries
ML Givens, R Kurotani, N Rave-Harel, NLG Miller, … - Molecular Endocrinology, 2004 - mend.endojournals.org
... factor binding sites were selected using weight matrices for the following factors
from the MatInspector (38) library: V$CEBPB.01, V$DLX1.01, V$GATA2.01, V ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
JBC Papers in Press. Published on October 24, 2001 as Manuscript M107795200
C Kumar-Sinha, S Varambally, A Sreekumar, AM … - jbc.org
Page 1. Molecular Cross-Talk Between the TRAIL and Interferon Signaling Pathways
Chandan Kumar-Sinha, Sooryanarayana Varambally, Arun ...
Web Search
Gene Expression Profiling of Leiomyoma and Myometrial Smooth Muscle Cells In Response to TGF-β
X Luo, L Ding, J Xu, N Chegini - Endocrinology (submitted), 2004 - endo.endojournals.org
Page 1. 1 Gene Expression Profiling of Leiomyoma and Myometrial Smooth Muscle Cells
In Response to TGF-β Xiaoping Luo, Li Ding, Jingxia Xu, and Nasser Chegini ...
Cited by 1 - Web Search - endo.endojournals.org
|
©2005 Google