Scholar Home  
 
 Advanced Scholar Search
Scholar Preferences
Scholar Help

The "AND" operator is unnecessary -- we include all search terms by default. [details]

 Scholar Results 1 - 3 of 3 for HSF1 and CREB1. (0.05 seconds) 

Biology and functions of human leukocyte antigen-G in health and sickness - Full text - MIT Libraries
C Menier, J McCluskey, ED Carosella - Tissue Antigens, 2003 - ingentaconnect.com
... Basal transcriptional complex p50 p50 Sp1 Sp1 HSE HSF1 –480 GAS ISRE IRF1 –732
–746 ... CRE –770 –930 –1380 CREB1 ATF1 c-Jun CREB1 CREB1 ATF1 HindIII ...
Web Search - www-dsv.cea.fr

Reactive Oxygen Species Stimulates Receptor Activator of NF-{kappa} B Ligand Expression in … - Full text - MIT Libraries
X Bai, D Lu, A Liu, Z Zhang, X Li, Z Zou, W Zeng, … - J. Biol. Chem, 2005 - jbc.org
... was determined to be unique to the mouse CREB1 and human ... reverse,
tcacacaacttcagtaggttcaggtgatgggc, 64 °C, 437 bp; human HSF1, forward, ...
Web Search - jbc.org - ncbi.nlm.nih.gov

The spatial organization of lipid synthesis in the yeast Saccharomyces cerevisiae derived from large … - Full text - MIT Libraries
K Natter, P Leitner, A Faschinger, H Wolinski, S … - Molecular & Cellular Proteomics, 2005 - mcponline.org
Page 1. The spatial organization of lipid synthesis in the yeast Saccharomyces
cerevisiae derived from large-scale green fluorescent ...
Cited by 1 - Web Search - mcponline.highwire.org - depts.washington.edu - ncbi.nlm.nih.gov - all 9 versions »




 


Google Home - About Google - About Google Scholar

©2005 Google