![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 61 for ARNT and NF1. (0.08 seconds) |
Did you mean: ARNDT and NF1
Genomic organization and expression of parkin in Drosophila melanogaster - Full text - MIT Libraries
YJ Bae, KS Park, SJ Kang - Exp Mol Med, 2003 - e-emm.org
... aaaaattgttttcaattgtg cgctttctgcgtgtccacgttttcctccgaatggctgccagctggt
gtttggcaacgcgtaagtaaacaacgattggcaacactgaagcatat AhR-Arnt GATA NF1 NF1 NF1 ...
Cited by 2 - View as HTML - Web Search - e-emm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
An SP 1-like 5'-GACCACGCC-3' sequence is critical for activity of the inflammatory phospholipase A 2 …
M Paradon, C Salvat, Q Fan, G Bereziat, JL Olivier - European Journal of Biochemistry, 1998 - blackwell-synergy.com
... mal regions of promoters binding both the Sp1 and CTF/NF1 factors [28, 29 ... receptor
(Ahr) and the aryl hydrocarbon receptor nuclear translo- cator (Arnt) [31] in ...
Cited by 2 - Web Search - content.febsjournal.org - ejbiochem.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Epigenetic regulation of 11ss-hydroxysteroid dehydrogenase type 2 expression - Full text - MIT Libraries
R Alikhani-Koopaei, F Fouladkou, FJ Frey, BM Frey - J. Clin. Invest, 2004 - jci.org
... Methylation of recognition sequences of transcription factors, including those for
Sp1/Sp3, Arnt, and nuclear factor 1 (NF1) diminished their DNA-binding ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - jci.org - ncbi.nlm.nih.gov
Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydrocarbon receptor mediates … - Full text - MIT Libraries
HP Ko, ST Okino, Q Ma, JP Whitlock Jr - Mol Cell Biol, 1996 - mcb.asm.org
... protein binding at the NF1 site and TATA box (Fig. 5A) and that the promoter fails
to exhibit a TCDD-induced increase in FIG. 3. Roles of AhR and Arnt in TCDD ...
Cited by 58 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Green Fluorescent Protein (GFP) as a Marker of Aryl Hydrocarbon Receptor (AhR) Function in … - Full text - MIT Libraries
GFP AhR-regulated, D Homogenizer, F Scientific - Environmental Health Perspectives, 2001 - ehp.niehs.nih.gov
... It was first important to determine whether AhR and Arnt were expressed during ... The
5 CYP1A1 promoter region includes a TATA box, Sp1, NF1 binding sites, and ...
Cited by 10 - View as HTML - Web Search - ehpnet1.niehs.nih.gov - ehis.niehs.nih.gov - csa.com - all 5 versions »
Transactivation Domains Facilitate Promoter Occupancy for the Dioxin-Inducible CYP1A1 Gene In Vivo
HP KO, ST OKINO, Q MA, JP WHITLOCK JR - Plasmid - mcb.asm.org
... indicate a binding site for the AhR-Arnt heterodimer. (B) Protein-DNA interactions
at the CYP1A1 promoter. Brackets indicate binding sites for NF1 and TBP. ...
Cited by 25 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of the rat Class 3 aldehyde dehydrogenase gene promoter - Full text - MIT Libraries
Y Xie, K Takimoto, HC Pitot, WK Miskimins, R … - Mol. Pharmacol, 1999 - nar.oupjournals.org
... This negative region is bound by NF1-like proteins and/or unique proteins. ... the
functional Ah receptor and Ah receptor nuclear translocator (Arnt) ( 15 , 16 ). ...
Cited by 4 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Induction of cytochromes P450
M Dickins - Curr Top Med Chem, 2004 - ingentaconnect.com
... ligand complex binds to the Ah receptor nuclear translocator (Arnt), forming a ... nuclear
receptor (NR) sites which sandwich a nuclear factor 1 (NF1) binding site ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Carolyn J. Mattingly, John A. McLachlan, and William A. Toscano, Jr.
BEHP Publications, VS Cart, C Opportunities, REHP … - Environmental Health Perspectives, 2001 - ehp.niehs.nih.gov
... It was first important to determine whether AhR and Arnt were expressed during ... The
5´ CYP1A1 promoter region includes a TATA box, Sp1, NF1 binding sites, and ...
Cached - Web Search - ehis.niehs.nih.gov - ehpnet1.niehs.nih.gov - ehp.niehs.nih.gov - all 6 versions » - Get it from MIT Libraries
Dioxin induces localized, graded changes in chromatin structure: implications for Cyp1A1 gene … - Full text - MIT Libraries
ST Okino, JP Whitlock Jr - Mol. Cell. Biol, 1995 - mcb.asm.org
... TATAAA sequence, at a recognition motif for the transcrip- tion factor NF1, and
at ... Thus, our findings indicate that the binding of AhR/Arnt to the enhancer is ...
Cited by 40 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms - Full text - MIT Libraries
ME Massari, C Murre, R Articles - Mol. Cell. Biol, 2000 - dx.doi.org
... AHR proteins containing acidic activation domains derived from VP16 or Arnt were
capable of ... disruption and allow occupancy of the TATA box and NF1 site at the ...
Cited by 292 - Web Search - mcb.asm.org - www-biology.ucsd.edu - sig.biostr.washington.edu - all 9 versions »
Characterization of Adjacent E-Box and Nuclear Factor 1-Like DNA Binding Sequence in the Human CYP1A …
MJ Narvaez, GR Anderson, GV Pickwell, LC … - doi.wiley.com
... CYP1A2) regulation, we have characterized a region of the promoter (+3 to −176)
that contains a single E-box and an adjacent nuclear factor 1 (NF1)-like DNA ...
Web Search
Molecular regulation of the endothelin-1 gene by hypoxia - Full text - MIT Libraries
K Yamashita, DJ Discher, J Hu, NH Bishopric, KA … - J. Biol. Chem, 2001 - intl.jbc.org
... transcription start site which binds the factors HIF-1 and ARNT (HIF-1 ... 3', with the
appropriate opposite strand primers; and NF1: 5'-AACAACATTGTCTGGGGCTGGAAT3 ...
Cited by 48 - Web Search - intl.jbc.org - jbc.org - ncbi.nlm.nih.gov
Negative regulation of rat hepatic aldehyde dehydrogenase 3 by glucocorticoids
R Lindahl, GH Xiao, KC Falkner, RA Prough - Adv Exp Med Biol, 1999 - ncbi.nlm.nih.gov
... cells does not include either the Ah receptor nor the prototypical ARNT protein
(Boesch et al ... 1057 to -991) responsive elements as well as the 2 NF1 sites (-916 ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
A novel computational approach for the prediction of networked transcription factors of Ah-receptor … - Full text - MIT Libraries
A Kel, S Reymann, V Matys, P Nettesheim, E … - Molecular Pharmacology, 2004 - molpharm.aspetjournals.org
... carbinol (I3C). The nuclear AhR complex is a heterodimer composed of the
AhR and AhR nuclear translocator (Arnt) proteins. Binding ...
Cited by 3 - Web Search - molpharm.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular pathogenesis of MDS
H Hirai - Int J Hematol, 2002 - haem.nus.edu.sg
... RAS gene mutations or inactivation of NF1 gene are thought to be critical events
in the ... TEL gene is also fused to ARNT, MN1, EVI-1 and ACS2 in MDS cases ...
Cited by 3 - View as HTML - Web Search - ishapd.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular Mechanisms of Myelodysplastic Syndrome - Full text - MIT Libraries
H Hirai - Japanese Journal of Clinical Oncology, 2003 - jjco.oupjournals.org
... RAS gene mutations or inactivation of NF1 gene are thought to be critical events
in the ... TEL gene is also fused to ARNT, MN1, EVI-1 and ACS2 in MDS cases ...
Cited by 5 - Web Search - jjco.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Global nature of dynamic protein-chromatin interactions in vivo: three-dimensional genome scanning … - Full text - MIT Libraries
RD Phair, P Scaffidi, C Elbi, J Vecerova, A Dey, K … - Mol. Cell. Biol, 2004 - pubmedcentral.nih.gov
... in the references cited in Table 1. Myc, Mad, Max, BRG, PCAF, and NF1 were in ... were
in the fast fraction, whereas more than 80% of PCAF or ARNT molecules made ...
Cited by 23 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Role of VHL Gene Mutation in Human Cancer - Full text - MIT Libraries
ML Lerman, B Zbar - J Clin Oncol - liv.med.utoronto.ca
... Neurofibromatosis type 1 NF1 17q11 Café-au-lait macules Neurofibromas Iris ... HIF genes
(also called the aryl hydrocarbon receptor nu- cleartranslocators[ARNT]). ...
View as HTML - Web Search
Some aspects of interindividual variations in the metabolism of xenobiotics - Full text - MIT Libraries
V Tamasi, L Vereczkey, A Falus, K Monostory - Inflammation Research, 2003 - springerlink.com
... AhR: aromatic hydrocarbon receptor; Hsp90: heat shock protein; Arnt: AhR nuclear ...
there is an enhancer sequence called PBRU, which con- tains a NF1 binding site ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - csa.com
Regulation of Pulmonary and Hepatic Cytochrome P4501A Expression in the Rat by Hyperoxia: … - Full text - MIT Libraries
XI Couroucli, SE Welty, RS Geske, B Moorthy - Regulation, 2002 - molpharm.aspetjournals.org
... elements; ARNT, aryl hydrocarbon receptor nuclear translocator; MPO, myeloperoxidase;
ANOVA, analyses of variance; MC, 3-methylcholanthrene; NF1, nuclear ...
Cited by 5 - Web Search - molpharm.aspetjournals.org - ncbi.nlm.nih.gov
Xenobiotic induction of cytochrome P450 2B1 (CYP2B1) is mediated by the orphan nuclear receptor … - Full text - MIT Libraries
R Muangmoonchai, D Smirlis, SC Wong, M Edwards, IR … - Biochem J, 2001 - biochemj.org
... BTE, basal transcription element; CAR, constitutive androstane receptor; CYP,
cytochrome P450; DRn, direct repeat with n bp spacing; NF1, nuclear factor 1; NR1 ...
Cited by 22 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Signaling components that drive circadian rhythms - Full text - MIT Libraries
GK Wang, A Sehgal - Curr. Opin. Neurobiol, 2002 - faculty.oxy.edu
... mitogen-activated protein kinase NAD/NADH nictonamide adenine dinucleotide nf1
neurofibromatosis-1 PDF ... and BMAL1 do not involve their PAS (Per/Arnt/Sim) domains ...
Cited by 6 - View as HTML - Web Search - life.kjist.ac.kr - ncbi.nlm.nih.gov
Genetica y medicina molecular en cardiologia
C PLURICELULAR - Rev Esp Cardiol, 2001 - doyma.es
Page 1. 91 CONSTITUCIÓN PLURICELULAR Y PROCESOS DE DIVISIÓN CELULAR La
información genética almacenada en una célula es requerida ...
View as HTML - Web Search
Identification of hypoxically inducible mRNAs in HeLa cells using differential display PCR
JF O’Rourke, CW Pugh, SM Bartlett, PJ Ratcliffe - Eur. J. Biochem, 1996 - blackwell-synergy.com
... drocarbon receptor; AK-3, adenylate kinase-3 ; ARNT, aryl hydrocarbon nuclear
translocator; DD, differential display ; EST, expressed sequence tag ; Glut-3 ...
Cited by 29 - Web Search - content.febsjournal.org - ejbiochem.org - ingentaconnect.com - all 6 versions » - Get it from MIT Libraries
The Aryl Hydrocarbon Receptor Complex
O Hankinson - Annual Review of Pharmacology and Toxicology, 1995 - pharmtox.annualreviews.org
... Proteins capable of binding the BTE (proximal NF1 site) and G box are ... by the observation
that XREs activate transcription in a TCDD- and ARNT-dependent fashion ...
Cited by 376 - Web Search - pharmtox.annualreviews.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Effect of hypoxia on cytochrome P450 activity and expression.
C Fradette, P Du Souich - Curr Drug Metab, 2004 - ingentaconnect.com
... Where ↓O 2 represents hypoxemia, AhR is the aryl hydrocarbon receptor, Arnt is
the aryl hydrocarbon receptor nuclear translocator, AhRR is the aryl ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... BRN2 TATA 257.1 HNF4 RORA1 80.4 CREB SRF 34.4 CHOP NF1 21.4 ... FREAC3 FREAC7 220.8 PBX1
TATA 66.3 SP1 USF 33.0 ARNT GRE 220.0 ATF P53 63.4 MZF1 SP1 32.8 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
In vitro hematopoietic and endothelial potential of flk-1 minus/minus embryonic stem cells and … - Full text - MIT Libraries
AC Schuh, P Faloon, QL Hu, M Bhimani, K Choi - Developmental Biology, 1999 - dx.doi.org
... Tie2-Cre-Induced Inactivation of a Conditional Mutant Nf1 Allele in ... and MC Simon
Multilineage embryonic hematopoiesis requires hypoxic ARNT activity Genes & Dev ...
Cited by 80 - Web Search - pnas.org - pubmedcentral.nih.gov - cellbio.wustl.edu - all 6 versions »
Genomic organization and putative promoters of highly conserved glutathione S-transferases …
S Pongjaroenkit, K Jirajaroenrat, C Boonchauy, U … - Insect Biochem. Molec. Biol, 2001 - mb.mahidol.ac.th
... specific transcription factor binding sites, two GATA binding sites and one NF1. ...
that could regulate xenobiotic metabolism, one AP-1 and two Arnt (Ah receptor ...
Cited by 13 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Ah receptor signaling pathways - Full text - MIT Libraries
JV Schmidt, CA Bradfield - Annual Review of Cell and Developmental Biology, 1996 - arjournals.annualreviews.org
... 73 ARNT Dimerizes With HIF-1α In Vivo . ... tion in this system: a TATA box, a G-box
element, and two binding sites for the transcription factor NF1 (Jones & ...
Cited by 242 - Web Search - mcardle.oncology.wisc.edu - ncbi.nlm.nih.gov - csa.com - all 7 versions »
Molecular cogs of the insect circadian clock
N Shirasu, Y Shimohigashi, Y Tominaga, M … - Zoolog Sci, 2003 - biolog-e.ls.biu.ac.il
... that mCLK interacts directly with another bHLH-PAS family protein, BMAL1 (brain
and mus- cle ARNT like protein 1 ... (2001) on the neurofibromatosis-1 (Nf1) gene. ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Phenobarbital-mediated changes in gene expression in the liver
UA Meyer, K Hoffmann - Drug Metabolism Reviews, 1999 - taylorandfrancis.metapress.com
... putative glucocorticoid response element as well as a nuclear factor 1 (NF1) site,
and ... In analogy to the AhR/Arnt model of dioxin induction, PB may affect the ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov - csa.com - Get it from MIT Libraries
Physiological and pathophysiological regulation of cytochrome P450 - Full text - MIT Libraries
ET Morgan, MB Sewer, H Iber, FJ Gonzalez, YH Lee, … - Drug Metab Dispos, 1998 - dmd.aspetjournals.org
... the C/EBPs, rat albumin gene D region binding protein, NF1, NFY, and HNF ... embryonic
lethality was found after disruption of the genes encoding ARNT (Maltepe et al ...
Cited by 26 - Web Search - dmd.aspetjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Helix-loop-helix proteins in mammary gland development and breast cancer
PY Desprez, T Sumida, JP Coppe - J. Mammary Gland Biol. Neoplasia, 2003 - kluweronline.com
... 49 Class VII AHR, ARNT, Sim HIF Biological ... 91). This element contains recognition
sites for SP-1 and NF1 transcrip- tion factors. Data ...
Cited by 6 - Web Search - springerlink.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Role of VHL Gene Mutation in Human Cancer - Full text - MIT Libraries
WY Kim, WG Kaelin - Journal of Clinical Oncology, 2004 - jco.org
... which is caused by loss of function mutation of the NF1 gene, and ... three HIFß genes
(also called the aryl hydrocarbon receptor nuclear translocators [ARNT]). ...
Cited by 3 - Web Search - dx.doi.org - jco.org - ncbi.nlm.nih.gov
Reactive oxygen species and regulation of gene expression - Full text - MIT Libraries
KT Turpaev - Biochemistry, 2002 - springerlink.com
Page 1. In cells of aerobic organisms not less than 95% of the oxygen consumed
is reduced by mitochondrial cytochrome oxidase, whereas ...
Cited by 26 - Web Search - kluweronline.com - ncbi.nlm.nih.gov - maik.ru
ANTHONY YH LU COMMEMORATIVE ISSUE - Full text - MIT Libraries
ET MORGAN, MB SEWER, H IBER, FJ GONZALEZ, YHUE LEE … - Drug Metabolism AND Disposition - dmd.aspetjournals.org
... the C/EBPs, rat albumin gene D region binding protein, NF1, NFY, and HNF ... embryonic
lethality was found after disruption of the genes encoding ARNT (Maltepe et al ...
Web Search
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... MEF-2 MEF2 03 Myogenic MADS factor MEF-2 MEF2 04 Myogenic MADS factor MEF-2 MINI20
B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Induction of phase I, II and III drug metabolism/transport by xenobiotics.
C Xu, CY Li, AN Kong - Arch Pharm Res, 2005 - apr.psk.or.kr
... MC), AhR translocates from the cytoplasm to the nucleus, heterodimerizes with Arnt,
and activates ... NR1 and NR2) as well as a nuclear factor 1 (NF1) binding site ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Chemical and Physiological Influences on Xenobiotic Metabolism
RL ROSE, E HODGSON - doi.wiley.com
Page 1. CHAPTER 9 Chemical and Physiological Influences on Xenobiotic
Metabolism RANDY L. ROSE and ERNEST HODGSON 9.1 INTRODUCTION ...
Web Search
Genetic analysis of the circadian system in Drosophila melanogaster and mammals - Full text - MIT Libraries
R Stanewsky - J Neurobiol, 2003 - doi.wiley.com
Page 1. Genetic Analysis of the Circadian System in Drosophila melanogaster
and Mammals Ralf Stanewsky Universität Regensburg, Institut ...
Cited by 37 - Web Search - ncbi.nlm.nih.gov - jcircadianrhythms.com - jcircadianrhythms.com
Conditional alleles in mice: Practical considerations for tissue-specific knockouts - Full text - MIT Libraries
KM Kwan - genesis, 2002 - doi.wiley.com
... Apc 18 (15.0) Œ Shibata et al., 1997 Arnt (aryl hydrocarbon receptor unclear
translocator) ... 15 (32.0) F de Alboran et al., 2001 Nf1 (neurofibromatosis type 1) ...
Cited by 27 - Web Search - tagc.univ-mrs.fr - biochem.wisc.edu - ncbi.nlm.nih.gov - all 6 versions »
Mapping and characterization of the mouse and human SS18 genes, two human SS18-like genes and a …
DRH de Bruijn, E Kater-Baats, M Eleveld, G Merkx, … - Cytogenet Cell Genet, 2001 - content.karger.com
... factors IK2, c-ETS I MZF1, LMO2 and GATA1, as well as the general transcription
factors AP2, AP4, SP1, NF1, GC1, TCF11, USF, GKLF, AP1, ARNT, delta-EF1 and ...
Cited by 7 - Web Search - content.karger.com - dx.doi.org - karger.com
Id proteins in epithelial cells - Full text - MIT Libraries
JP Coppe, AP Smith, PY Desprez - Exp Cell Res, 2003 - lbl.gov
... So far, the only bHLHs that are well identified in epidermis and have been shown
to dimerize and mediate signal transduction are Arnt and the dioxin receptor ...
Cited by 15 - View as HTML - Web Search - ncbi.nlm.nih.gov
UNIVERSIDAD COMPLUTENSE DE MADRID
RPORCY AMPC - tesis.sim.ucm.es
... primario es casi siempre inestable, en procariotas es degradado rápidamente o cortado
para originar los productos finales maduros (ARNr y ARNt), en eucariotas ...
View as HTML - Web Search
Towards a cellular and molecular understanding of neurulation - Full text - MIT Libraries
JF Colas, GC Schoenwolf - Developmental Dynamics, 2001 - doi.wiley.com
Page 1. REVIEWS A PEER REVIEWED FORUM Towards a Cellular and Molecular
Understanding of Neurulation JEAN-FRANÇOIS COLAS AND GARY ...
Cited by 43 - Web Search - doi.wiley.com - neuro.utah.edu - ncbi.nlm.nih.gov
Clock mechanisms in Drosophila - Full text - MIT Libraries
R Stanewsky - Cell and Tissue Research, 2002 - springerlink.com
... The genes Clk and cyc both encode transcription factors containing a PAS
protein-dimerization domain (for PER- ARNT-SIM; the founders of the PAS-protein ...
Cited by 30 - Web Search - public.iastate.edu - ncbi.nlm.nih.gov
Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily - Full text - MIT Libraries
LM Iyer, EV Koonin, L Aravind - Proteins Structure Function and Genetics, 2001 - doi.wiley.com
... 1–7 Several domains such as Per–Arnt– Sim domain (PAS), 4 cGMP Phosphodiesterase–
adenylyl cyclase–FhlA domain (GAF), 5 Aspartokinase–chorismate ...
Cited by 17 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Alteration of the levels of the M-type 6-phosphofructo-1-kinase mRNA isoforms during neonatal …
Y Mhaskar, G Armour, G Dunaway - Molecular and Cellular Biochemistry, 2000 - springerlink.com
... AP1, AP4, carbohydrate response ele- ment [30], deltaEF1 [31], NF1, nkx 2.5 [32 ... of
the aryl hydrocarbon receptor nu- clear translocator protein (ARNT) Mol Cell ...
Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Did you mean to search for: ARNDT and NF1
|
©2005 Google