![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 72 for CREB1 and SP1. (0.09 seconds) |
Alterations in transcription factor-binding activities to fibronectin promoter during aging of …
T Kumazaki, Y Mitsui - Mechanisms of Ageing and Development, 1996 - ingentaconnect.com
... supershift assays. Our results showed that AP-1 decreased with aging, but
Sp1 and CREB1 were unaffected. However, decreased binding ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The expanding role of Tax in transcription - Full text - MIT Libraries
C de la Fuente, F Kashanchi - Retrovirology, 2004 - dx.doi.org
... Each enhancer element (21-bp, CRE, AP1, SP1, κB, or SRE) was placed in an ... recruit
CREB binding protein (CBP) to the viral promoter [5]. Recently, CREB1 and ATF ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - bmc.ub.uni-potsdam.de - retrovirology.com - all 10 versions »
Biology and functions of human leukocyte antigen-G in health and sickness - Full text - MIT Libraries
C Menier, J McCluskey, ED Carosella - Tissue Antigens, 2003 - ingentaconnect.com
... putative locus control region; CRE, three functional CRE/TRE sites bound by CREB1,
ATF1, and ... The conserved X1 half of X box associates with RFX and Sp1 in vitro ...
Web Search - www-dsv.cea.fr
Alterations in the Expression of Transcription Factors and the Reduced Folate Carrier as a Novel … - Full text - MIT Libraries
L Rothem, A Aronheim, YG Assaraf - J Biol Chem, 2003 - jbc.org
... 2D). Transfection of AG2034 R2 and ZD9331 R1.5 cells with expression constructs
harboring CREB-1 (pRSV-CREB1) or Sp1 (pPacSp1) resulted in restoration of ...
Cited by 12 - Web Search - jbc.org - ncbi.nlm.nih.gov
CREB/PKA sensitive signalling pathways activate and maintain expression levels of the hepatitis B … - Full text - MIT Libraries
F Tacke, C Liedtke, S Bocklage, MP Manns, C … - Gut, 2005 - gut.bmjjournals.com
... shown). Supershift experiments were performed with antibodies directed against
Ets1/2, c-jun, SP1, CREB1, ATF1, ATF2, and ATF4. These ...
Web Search - gutjnl.com - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
HLA-G Transactivation by cAMP-response Element-binding Protein (CREB) - Full text - MIT Libraries
SJP Gobin, P Biesta, JEM de Steenwinkel, G Datema, … - J. Biol. Chem, 2002 - jbc.org
... in the upstream promoter region of HLA-G are binding sites for CREB1, ATF1, and
c ... results in the more restricted binding of NF- B p50 homodimers and Sp1 in the ...
Cited by 8 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
CREB/PKA sensitive signaling pathways activate
C Trautwein, F Tacke, C Liedtke, S Bocklage, T … - gut.bmjjournals.com
... Supershift experiments were performed with antibodies directed against Ets1/2,
c-jun, SP1, CREB1 and ATF1, 2 and 4. These experiments showed a reduction in ...
Web Search
Regulation of the transglutaminase 1 gene - Full text - MIT Libraries
A Medvedev, NA Saunders, H Matsuura, A Chistokhina … - J Biol Chem, 1999 - jbc.org
... Antibodies against Sp1, Sp2, Sp3, c-Jun, Ser 63 -phosphorylated c-Jun, JunB, JunD,
Fra-1, Fra-2, c-Fos, CREB1, CREB2, ATF-2, and ATF-4 were obtained from Santa ...
Cited by 24 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Activation of the Ferritin H Enhancer, FER-1, by the Cooperative Action of Members of the AP 1 and … - Full text - MIT Libraries
Y Tsuji, SV Torti, FM Torti - J Biol Chem, 1998 - jbc.org
... sc183x), anti-fra2 (Q-20, sc604x), anti-ATF1/CREB1 (25C10G, sc270x), anti-CREB
(C-21, sc186x, and 240, sc58x), anti-ATF1(C41-5.1, sc243x), anti-Sp1 (PEP2, sc59x ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Augmentation of human T cell leukaemia virus type I Tax transactivation by octamer binding sites - Full text - MIT Libraries
SJ Marriott, K Payne, LM Connor - Journal of General Virology, 1997 - vir.sgmjournals.org
... 3h CRE 5h CTAGAGGCTGACGTCAGAG 3h Oct 5h CTAGATGCTTTGCATTGCTTTGCAA 3h Sp1 5h
CTAGAGGGCGGGGGCGGGGGCGGA ... Ets, Gal–Tat, Gal–ATF1 and Gal–CREB1 plasmids were ...
Cited by 1 - Web Search - vir.sgmjournals.org - jgv.sgmjournals.org - ncbi.nlm.nih.gov
Human T-cell leukemia virus type I Tax protein transactivates RNA polymerase III promoter in vitro … - Full text - MIT Libraries
G Piras, J Dittmer, MF Radonovich, JN Brady - J Biol Chem, 1996 - jbc.org
... can be recognized by pol II transcription factors such as ATF and Sp1. ... site is located
within these sequences suggesting that the CREB1 recognition element is ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
Identification of the Elements Regulating the Expression of the Cell Adhesion Molecule MCAM/MUC18 - Full text - MIT Libraries
CS Mintz-Weber, JP Johnson - J. Biol. Chem, 2000 - jbc.org
... line MelJuSo (lane 1) were incubated in the presence of anti-Sp1 antibody (lane ... lane
2), indicating that one of the proteins binding to this sequence is CREB1. ...
Cited by 10 - Web Search - jbc.org - genomed-dna.com - ncbi.nlm.nih.gov
Identification of a minimal promoter sequence for the human arylamine N-acetyltransferase I gene … - Full text - MIT Libraries
NJ Butcher, A Arulpragasam, C Pope, RF Minchin - Biochem. J, 2003 - biochemj.org
... directed against NF-E2, Sp1, CREB1, c-rel, NF-κB and EGR-1 had little or
no effect. Anti- Biochemical Journal Immediate Publication. ...
Cited by 2 - View as HTML - Web Search
Inhibition of MuSK Expression by CREB Interacting with a CRE-Like Element and MyoD - Full text - MIT Libraries
CH Kim, WC Xiong, L Mei - Mol Cell Biol, 2005 - mcb.asm.org
... The mechanism by which CREB1 inhibits MyoD transactivation activity remains unclear. ...
Serum response factor, Sp1, muscle LIM protein, and the product of the ...
Web Search - mcb.asm.org - ncbi.nlm.nih.gov
Reduced folate carrier gene silencing in multiple antifolate-resistant tumor cell lines is due to a …
R Title - jbc.org
... element; CREB-1, CRE-binding protein 1; Sp1 and Sp3, specificity proteins 1 and
3; AP1 and ... o C with anti-CREB-1, -ATF-1, -Sp1, -Sp3, -c-Jun, ...
Cited by 7 - Web Search - 132.68.97.111 - biology.technion.ac.il - ncbi.nlm.nih.gov - all 7 versions » - Get it from MIT Libraries
Subject index
V Allfrey, B NF-k - regulation - doi.wiley.com
... embryonic expression 271 MEF2 271 HDAC5 271 congestive heart failure 144 CREB1 271
MEF2 ... 49, 54 RhoB apoptosis 241^242 cancer proliferation 241^242 Sp1 site 247 ...
Web Search - Get it from MIT Libraries
GEArray S Series Human Immunology Signaling Pathways Gene Array: AR-SAHS-605
FG Grouping, A Molecules, I ICAM, CS Molecules, C … - eurogentec.com
... Transcription Factors: ATF2, CEBPB, CREB1, CREBBP, EGFR, EGR1, EGR2, EGR3, ELK1,
ELK3 ... NFKB2, NFKBIB, NFKBIE, NR4A2, PCNA, RAF1, RELA, RPS6KA5, SP1, SP3, TP53. ...
View as HTML - Web Search - eurogentec.be
Bis-Anthracycline Antibiotics Inhibit Human Immunodeficiency Virus Type 1 Transcription - Full text - MIT Libraries
O Kutsch, DN Levy, PJ Bates, J Decker, BR Kosloff, … - Antimicrob Agents Chemother, 2004 - pubmedcentral.nih.gov
... dependent ability to compete with the binding of transcription factors to the
LTR-Sp1 probe. ... factors to NF-κB p50, NF-κB p65, c-rel, c-fos, CREB1, and ATF2 ...
Cited by 2 - Web Search - intl-aac.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Transcription Factors: Atf2, Cebpb, Creb1, Crebbp, Egr1, Egr2, Egr3, Elk1, Elk3,
Fkbp1b ... Nfkbil1, P300-ESTs, Raf1, Rel, Rela, Relb, Runx1, Runx2, Sp1, Sp3, Srf ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... Transcription Factors: ATF2, CEBPB, CREB1, CREBBP, EGR1, EGR2, EGR3, ELK1, ELK3,
EP300, FKBP1B ... NFKBIL2, NFRKB, RAF1, REL, RELA, RELB, RUNX1, RUNX2, SP1, SP3, SRF ...
View as HTML - Web Search - eurogentec.com
Induction of Grp78/BiP by Translational Block - Full text - MIT Libraries
S Luo, P Baumeister, S Yang, SF Abcouwer, AS Lee - J. Biol. Chem, 2003 - jbc.org
... were incubated at 4 °C overnight with 5 µl of anti-ATF1/CREB1 antibody (Santa ... contains
a CRE-like site, additional CCAAT motifs and several putative Sp1 sites ...
Cited by 11 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Functional Organization of the GluR 1 Glutamate Receptor Promoter - Full text - MIT Libraries
K Borges, R Dingledine - J Biol Chem, 2001 - jbc.org
... the reaction, 0.2 footprinting units (fpu) of human Sp1, 0.3 footprinting units
of human c-Jun (both Promega), or 0.5 µg of human CREB1-bZIP corresponding to ...
Cited by 6 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Transcriptional Regulation of the Human TLR9 Gene - Full text - MIT Libraries
F Takeshita, K Suzuki, S Sasaki, N Ishii, DM … - The Journal of Immunology, 2004 - jimmunol.org
... by preincubating nuclear extracts with anti-CREB1, -ATF2, -Ets1/2, -Ets2, -Elf1,
-Elk1, -Spi1 (PU.1), -C/EBP , -C/EBP , -C/EBP , -C/EBP , -C/EBP , or -Sp1 Abs. ...
Cited by 1 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
CREB/ATF proteins enhance the basal and CD154-and IL-4-induced transcriptional activity of the human …
A Bhushan, LR Covey - doi.wiley.com
Page 1. 0014-2980/01/0202-653$17.50+.50/0 © WILEY-VCH Verlag GmbH, D-69451
Weinheim, 2001 CREB/ATF proteins enhance the basal and CD154- ...
Web Search - doi.wiley.com
Opposite transcriptional effects of cyclic AMP-responsive elements in confluent or p27KIP- … - Full text - MIT Libraries
L Deleu, F Fuks, D Spitkovsky, R Horlein, S Faisst … - Mol. Cell. Biol, 1998 - mcb.asm.org
... region of the promoter, immediately upstream from the Ets- and Sp1-binding sites
(1, 17 ... Complexes A and B result from binding of CREB1 homodimers and CREB1/ATF1 ...
Cited by 21 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
CREB controls LAP/C/EBP transcription - Full text - MIT Libraries
M Niehof, MP Manns, C Trautwein - Mol. Cell. Biol, 1997 - mcb.asm.org
... The pCMV/SP1 expression vector and the p2xCRE-Luc, with two CREB binding sites linked ...
TGC CTG TGG TCA GAG AGC TAG-3 . The antibodies against CREB1, ATF1, ATF2 ...
Cited by 69 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Identification of a minimal promoter sequence for the human N-acetyltransferase Type I gene that … - Full text - MIT Libraries
NJ Butcher, A Arulpragasam, C Pope, RF Minchin - Biochem. J, 2003 - biochemj.org
... which recognizes c-Fos, Fos B, Fra-1 and Fra-2, completely shifted band I. Antibodies
directed against NF-E2 (nuclear factor E2), Sp1, CREB1 (cAMP-response ...
Cited by 3 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular triangulation: Bridging linkage and molecular-network information for identifying …
M Krauthammer, CA Kaufmann, TC Gilliam, A Rzhetsky - Proceedings of the National Academy of Sciences - pnas.org
... However, the nonsignificant P value for topology-subtracted importance hints that
SP1 affects multiple ... Examples are the top-ranked genes CREB1 and PLAT (9, 10 ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - mcb.mcgill.ca - statgen.ncsu.edu - all 8 versions » - Get it from MIT Libraries
Combinatorial control of the bradykinin B2 receptor promoter by p53, CREB, KLF-4, and CBP: … - Full text - MIT Libraries
Z Saifudeen, S Dipp, H Fan, SS El-Dahr - Am J Physiol Renal Physiol, 2005 - ajprenal.physiology.org
... with antibodies to p53 (Santa Cruz Biotechnology, sc-FL393; 2 µg), CREB1 (sc-58 ... 4
binding site from the p21 promoter (43) or a GC-rich Sp1 consensus sequence. ...
Cited by 1 - Web Search - ajprenal.physiology.org - ncbi.nlm.nih.gov
TAF II 250-dependent transcription of cyclin A is directed by ATF activator proteins - Full text - MIT Libraries
EH Wang, S Zou, R Tjian - Genes Dev, 1997 - genesdev.org
... in our purified preparations are the transcriptional activators ATF1, CREB1, and
ATFa2 ... Previously we had reported that Sp1- and VP16-mediated activation is ...
Cited by 64 - Web Search - depts.washington.edu - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Stimulated initiation of mitogen-activated protein kinase phosphatase-1 (MKP-1) gene transcription … - Full text - MIT Libraries
S RYSER, A MASSIHA, P Isabelle, W SCHLEGEL - Biochem. J, 2004 - bj.portlandpress.com
... Anti-CREB1 (CRE-binding protein; ab7540) was purchased from Abcam Limited (Cambridge,
UK), anti-Sp1 (sc−59), anti-Sp3 (sc−644) and anti-CBP (CREB-binding ...
Cited by 2 - View as HTML - Web Search - biochemj.org - biochemj.org - ncbi.nlm.nih.gov
Transcriptional Activation of the SH2D2A Gene Is Dependent on a Cyclic Adenosine 5'-Monophosphate- … - Full text - MIT Libraries
KZ Dai, FE Johansen, KM Kolltveit, HC Aasheim, Z … - The Journal of Immunology, 2004 - jimmunol.org
... Possible binding sites for NFAT and the transcription factor Sp1 as well as the ... the
four Abs against CRE binding transcription factors (Ab 1, anti-CREB1; Ab 2 ...
Cited by 2 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Roles of USF, Ikaros and Sp proteins in the transcriptional regulation of the human reduced folate … - Full text - MIT Libraries
M Liu, JR Whetstine, SG Payton, Y Ge, RM Flatley, … - Biochem. J, 2004 - biochemj.org
... and Creb1/ATF1) and the Sp family of DNA binding proteins (eg, Sp1, Sp3), respectively
[14]. Our results imply that cell-specific expression of these ...
Cited by 2 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Characterization of Human Constitutive Photomorphogenesis Protein 1, a RING Finger Ubiquitin Ligase … - Full text - MIT Libraries
E Bianchi, S Denti, R Catena, G Rossetti, S Polo, … - J Biol Chem, 2003 - jbc.org
... 0.8 µg of luciferase reporter constructs containing either the Sp1 responsive proximal ...
5B) but not with the other bZIP factors tested (c-Fos, CREB1, and CREM ...
Cited by 8 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
The plasminogen activator system: biology and regulation - Full text - MIT Libraries
JP Irigoyen, P Munoz-Canoves, L Montero, M … - Cell Mol Life Sci, 1999 - springerlink.com
Page 1. CMLS, Cell. Mol. Life Sci. 56 (1999) 104–132 1420-682X/99/020104-
29 $ 1.50+0.20/0 © Birkhäuser Verlag, Basel, 1999 Review ...
Cited by 69 - Web Search - ncbi.nlm.nih.gov
Analysis of DNase-I-hypersensitive sites at the 3'end of the cystic fibrosis transmembrane … - Full text - MIT Libraries
HN Nuthall, DS Moulin, C Huxley, A Harris - Biochem. J, 1999 - biochemj.org
... several potential binding sites for the ubiquitous transcription factor Sp1 and
other ... Consensus CREB1 (sc-2504) and AP-1 (sc-2501) oligonucleotides were ...
Cited by 13 - View as HTML - Web Search - imm.ox.ac.uk - biochemj.org - ncbi.nlm.nih.gov - all 5 versions »
Cyclin A Is a c-Jun Target Gene and Is Necessary for c-Jun-induced Anchorage-independent Growth in … - Full text - MIT Libraries
M Katabami, H Donninger, F Hommura, VD Leaner, I … - Journal of Biological Chemistry - jbc.org
... sc-187x); anti-ATF3 (sc-188x); anti-ATF4 (sc-200x); anti-CREB1 (sc-186x ... a variant
AP-1 site (at position –279), consensus ATF (–80), Sp1 (–197, –173 ...
Web Search - jbc.org - ncbi.nlm.nih.gov
Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression - Full text - MIT Libraries
DR Johnson - The Journal of Immunology, 2003 - jimmunol.org
... Surprisingly, both IRFs activated the control Sp1.TK.GL3 luciferase reporter gene (
50 ... The X enhancer binds RFX, CREB1, activating transcription factor 1, and ...
Cited by 4 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
A Novel Retinoic Acid-Responsive Element Regulates Retinoic Acid-Induced BLR1 Expression - Full text - MIT Libraries
J Wang, A Yen - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... RARα, RXRα, Oct1, Oct2, NTATc1, NFATc2, NFATc3, NFATc4, NFATc5, CREB1, and CREB2 ...
An EMSA kit, oligonucleotides for Sp1, early growth response factor 1 (EGR1 ...
Cited by 1 - Web Search - panomics.com - dx.doi.org - mcb.asm.org - all 6 versions »
Human hematopoietic cell specific nuclear protein MNDA interacts with the multifunctional … - Full text - MIT Libraries
J Xie, JA Briggs, RC Briggs - Journal of Cellular Biochemistry, 1998 - doi.wiley.com
... Recombi- nant Sp1 was produced from pBK-RSV-Sp1 (kindly provided by Dr. Michael
Waterman, Vanderbilt University, Nashville, TN) using the same procedure and ...
Cited by 13 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Estrogen up-regulation of p53 gene expression in MCF-7 breast cancer cells is mediated by calmodulin … - Full text - MIT Libraries
C Qin, T Nguyen, J Stewart, I Samudio, R Burghardt … - Mol Endocrinol, 2002 - mend.endojournals.org
... p53-6) is required for E2 responsiveness, and this sequence contains putative binding
sites for CTF-1/YY1, nuclear factor-Y (NF-Y), NF B, E2F, Sp1-like proteins ...
Cited by 10 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
TRANSCRIPTIONAL REGULATION BY THE PHOSPHORYLATION-DEPENDENT FACTOR CREB - Full text - MIT Libraries
B Mayr, M Montminy - Nature Reviews Molecular Cell Biology, 2001 - nature.com
... Bartsch, D., Casadio, A., Karl, K., Serodio, P. & Kandel, E. CREB1 encodes a nuclear
activator, a repressor, and a cytoplasmic modulator that form a regulatory ...
Cited by 259 - Web Search - nature.com - biochem.wisc.edu - ncbi.nlm.nih.gov - all 6 versions »
CREB trans-activates the murine H-K-ATPase {alpha} 2-subunit gene
X Xu, W Zhang, BC Kone - ajpcell.physiology.org
... Incubation with anti-CREB1 antibody caused a supershift of the DNA-protein complex
and ... 86/–60 oligonucleotide but not by the unrelated oligomer for Sp1 or a ...
Web Search - ajpcell.physiology.org
Stimulated initiation of MAP Kinase Phosphatase–1 (MKP-1) gene transcription involves the …
S Ryser, A Massiha, I Piuz, W Schlegel - bj.portlandpress.com
... Anti-Sp1 (sc-59), anti-Sp3 (sc-644) and anti-CBP (sc-369) were purchased from Santa
Cruz Biotechnologies; anti-CREB1 (ab7540) from Abcam and anti-pol II (8WG16 ...
View as HTML - Web Search - biochemj.org
Myc represses transcription through recruitment of DNA methyltransferase corepressor - Full text - MIT Libraries
C Brenner, R Deplus, C Didelot, A Loriot, E Vire, … - The EMBO Journal, 2005 - embojournal.npgjournals.com
... Left panel: HeLa nuclear extracts were immunoprecipitated using anti-Dnmt3a,
anti-CREB1 (used as negative control) or the beads only. ...
Cited by 5 - Web Search - nature.com - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Identification of c-Jun as a critical mediator for the intracrine 24 kDa FGF-2 isoform-induced cell … - Full text - MIT Libraries
M Hortala, A Estival, L Pradayrol, C Susini, F … - International Journal of Cancer, 2005 - doi.wiley.com
... 3.08* c-ets-1 1.59* Replication protein A (RPA2) 4.12*** CREB1 1.59* Heat ... binding
sites for different transcription factors including AP-1 and Sp1, which have ...
Web Search - ncbi.nlm.nih.gov
Regulation of Airway Smooth Muscle Cyclin D Transcription by Protein Kinase C-{delta} - Full text - MIT Libraries
K Page, J Li, KC Corbit, KM Rumilla, JW Soh, IB … - American Journal of Respiratory Cell and Molecular Biology, 2002 - ajrcmb.org
... 22), nuclear factor (NF)- B (23–26), activator protein (AP)-1 (19), Sp1 (27), and ...
Antibodies against PKC , cyclin D 1 , CREB1, CREM1, ATF-2, p65 (Rel A), p50 ...
Cited by 12 - Web Search - ajrcmb.org - ncbi.nlm.nih.gov
Regulation of Airway Smooth Muscle Cyclin D Transcription by Protein Kinase C- - Full text - MIT Libraries
K Page, J Li, KC Corbit, KM Rumilla, JW Soh, IB … - Am. J. Respir. Cell Mol. Biol, 2002 - pkclab.org
... 22), nuclear factor (NF)- B (23–26), activator protein (AP)-1 (19), Sp1 (27), and ...
Antibodies against PKC , cyclin D 1 , CREB1, CREM1, ATF-2, p65 (Rel A), p50 ...
Cited by 2 - View as HTML - Web Search
Genomic and proteomic analysis of the myeloid differentiation program. II. Global analysis of gene … - Full text - MIT Libraries
Z Lian, Y Kluger, DS Greenbaum, D Tuck, M Gerstein … - Blood, 2004 - bloodjournal.org
... 0h 24h 48h 72h MPRO72H* Human 60K* AA407540 2 3 1 1 169.81/P N/A Bach1 1 3 4 4
20/A 679.32/P Baz1b 4 7 3 3 20/A 679.32/P Crem 2 1 0 0 20/A 821.08/P Creb1 2 3 2 ...
Web Search - bloodjournal.org
Synergistic Transcriptional Activation by hGABP and Select Members of the Activation Transcription … - Full text - MIT Libraries
J Sawada, N Simizu, F Suzuki, C Sawa, M Goto, M … - J Biol Chem, 1999 - jbc.org
... 5A). We also did not detect DNA-binding transcription factor Sp1 in the ... Dr. H. C.
Hurst (Imperial Cancer Research Fund) for plasmids pGEM-ATF1 and pT7 -CREB1. ...
Cited by 10 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
|
©2005 Google