![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 6 of 6 for E2F2 and EVI1. (0.09 seconds) |
EVI 1 Promotes Cell Proliferation by Interacting with BRG 1 and Blocking the Repression of BRG 1 on … - Full text - MIT Libraries
Y Chi, V Senyuk, S Chakraborty, G Nucifora - J Biol Chem, 2003 - jbc.org
... 5. EVI1 up-regulates the cell cycle of 32Dcl3 cells (A) but not SW13 cells (B ... such
as cyclin E, cyclin A, cdc2, cdk2, and even E2F1 and E2F2 themselves (51). ...
Cited by 2 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Distinct roles for E2F proteins in cell growth control and apoptosis - Full text - MIT Libraries
J DeGregori, G Leone, A Miron, L Jakoi, JR Nevins - Proc. Natl. Acad. Sci. USA, 1997 - dx.doi.org
... and R. Bernards High Incidence of Thymic Epithelial Tumors in E2F2 Transgenic Mice
J ... page Y. Chi, V. Senyuk, S. Chakraborty, and G. Nucifora EVI1 Promotes Cell ...
Cited by 293 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 7 versions »
A Novel Gene, MDS2, Is Fused to ETV6/TEL in a t (1; 12)(p36. 1; p13) in a Patient With …
MD Odero, JL Vizmanos, JP Roman, I Lahortiga, C … - Genes Chromosomes Cancer, 2002 - doi.wiley.com
... genes have been cloned: ARNT (1q21), ARG (1q25), MDS1/EVI1 (3q26), CHIC2 ... X69111-F
ID3 CCCCGGTATCAGCGCTTCCTCATT X69111-R ID3 CGCCTTCATGCTGGGGAGTGAGT E2F2-F E2F2 ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Lysine acetylation and the bromodomain: a new partnership for signaling - Full text - MIT Libraries
XJ Yang - BioEssays, 2004 - doi.wiley.com
... CBP HDAC1 Increase DNA binding (72,73) E2F2, 3 p300, CBP (73) bHLH-Zip SREBP ... PCAF
Potentiate transcription (83) EVI1 PCAF, CBP Stimulate transport to nuclear ...
Cited by 15 - Web Search - ncbi.nlm.nih.gov
Recent acquisitions on functional properties of the p14/p19ARF tumor suppressor protein and its …
R Summary - john-libbey-eurotext.fr
... E2F1 (et aussi E2F2 et 3) activent le promoteur d'ARF [21, 43]. ... générant les protéines
chimériques CBFbeta-SMMHC, AML1-ETO, AML1-EVI1 peuvent perturber ces ...
Cached - Web Search - john-libbey-eurotext.fr
Donnees recentes sur les fonctions du gene suppresseur de tumeur p14/p19ARF et son importance en …
R Summary, R Girot, P Begue, F Galacteros, M Aiach - john-libbey-eurotext.fr
... E2F1 (et aussi E2F2 et 3) activent le promoteur d'ARF [21, 43]. ... générant les protéines
chimériques CBFbeta-SMMHC, AML1-ETO, AML1-EVI1 peuvent perturber ces ...
Cached - Web Search - john-libbey-eurotext.fr
|
©2005 Google