![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 42 of 42 for EGR1 and NF1. (0.08 seconds) |
Context-dependent Transcriptional Regulation
TACB Achieved - cbr.med.harvard.edu
... TCF, T cell factor; HMG, high mobility group; Rb, retinoblastoma; NF1, nuclear factor
1 ... DNA-binding transcription fac- tors; binding of Sp1 and Egr1 is often ...
View as HTML - Web Search - genomecenter.ucdavis.edu - mcardle.oncology.wisc.edu - genomics.ucdavis.edu - all 6 versions »
Context-dependent Transcriptional Regulation - Full text - MIT Libraries
CJ Fry, PJ Farnham - J Biol Chem, 1999 - dx.doi.org
... basal transcription complex (eg TBP); placement of YY1 upstream of NF1 abolishes
YY1 ... GC-rich DNA-binding transcription factors; binding of Sp1 and Egr1 is often ...
Cited by 76 - Web Search - jbc.org - ncbi.nlm.nih.gov
Association of p107 with Sp1: genetically separable regions of p107 are involved in regulation of E2 … - Full text - MIT Libraries
PK Datta, P Raychaudhuri, S Bagchi - Mol. Cell. Biol, 1995 - mcb.asm.org
... AP2 oligonucleotide is 5 GATCGAACTGACCGCCCGCGGCCCGT3 , and that of the NF1
oligonucleotide is 5 ... residues 520 to 538 of Sp1 protein), the Egr1 antibody (against ...
Cited by 67 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Blood expression profiles for tuberous sclerosis complex 2, neurofibromatosis type 1, and down's … - Full text - MIT Libraries
Y Tang, MB Schapiro, DN Franz, BJ Patterson, FJ … - Annals of Neurology, 2004 - doi.wiley.com
... For example, a subset of genes including IL8, G0S2, FOS, and EGR1 are upregulated
in TSC2, whereas K-RAS2 and GAS7 are overexpressed in NF1. ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Physical mapping of the minimal region of loss in 5q-chromosome - Full text - MIT Libraries
J Fairman, I Chumakov, AC Chinault, PC Nowell, L … - Proc Natl Acad Sci USA, 1995 - pnas.org
... The combined order of the polymorphic loci is centromere-IL9-(DSS525-
DSS558-D5S89-D5S526-DSS393)-DSS399-D5S396- DSS414-EGR1 and telomere. ...
Cited by 33 - Web Search - pubmedcentral.nih.gov - pnas.org - ncbi.nlm.nih.gov
GEArray Q series Mouse cAMP/Ca2+ PathwayFinder Gene Array: AR-SAMM-028
FG Grouping - eurogentec.com
... Ccna1 (CyclinA), Ccnd1 (CyclinD1), Cdk5, Cdkn2b (p15IND4b), Gem, Nf1, Pcna, Pmaip1 ...
Transcription: Atf3, Creb1, Crem, Egr1, Egr2, Fos, Jund1, Maf2-Ests, Nr4a2 ...
View as HTML - Web Search - eurogentec.be
GEArray Q series Human cAMP/Ca2+ PathwayFinder Gene Array: AR-SAHS-028
FG Grouping - eurogentec.com
... CCNA1 (CyclinA), CCND1 (CyclinD1), CDK5, CDKN2B (p15IND4b), GEM, NF1, PCNA, PMAIP1 ...
Transcription: ATF3, CREB1, CREM, EGR1, EGR2, FOS, JUND, MAF, NR4A2 (Nur77 ...
View as HTML - Web Search - eurogentec.be
Regulation of the MDR1 Gene by Transcriptional Repressors Selected Using Peptide Combinatorial … - Full text - MIT Libraries
VV Bartsevich, RL Juliano - Regulation, 2000 - molpharm.org
... 3F2 (ZF2-NF1-NF2); 4F (ZF3-ZF2-NF1-NF2); 5F (SF3-SF2-ZF2-NF1-NF2 with ... of P-glycoprotein
from the MDR1 locus can be induced by the EGR1 transcription factor in ...
Cited by 36 - Cached - Web Search - intl-molpharm.aspetjournals.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular Profiles of Neurofibromatosis Type 1-Associated Plexiform Neurofibromas - Full text - MIT Libraries
P Levy, I Bieche, K Leroy, B Parfait, J Wechsler, … - Clinical Cancer Research, 2004 - clincancerres.aacrjournals.org
... in the different cell components of the neurofibroma and the NF1–/– Schwann cells ...
Other early growth-response genes (MYC and EGR1), which code for ...
Cited by 1 - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
of the Human IGF-I1 Gene
P HOLTHUIZEN, MA VAN DIJK, RJT RODENBURG, A KOONEN … - MOLECULAR REPRODUCTION AND DEVELOPMENT, 1993 - doi.wiley.com
... EGR EGR NF1 ... Promoter P3 contains at least three putative binding sites for the early
growth response factors EGR1/ krox24 and EGR2/krox20, which are ...
Web Search
The Dominant Role of Sp1 in Regulating the Cystathionine-Synthase 1a and 1b Promoters Facilitates …
KN Maclean, E Kraus, JP Kraus - jbc.org
... not previously re- ported to be protected (13) and contains the Sp1/Egr1 overlap-
ping ... with the TRANS- FAC 5.0 matrices (25) revealed binding sites for NF1 and ...
Web Search
A Novel Retinoic Acid-Responsive Element Regulates Retinoic Acid-Induced BLR1 Expression - Full text - MIT Libraries
J Wang, A Yen - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... Biotin-labeled probes and unlabeled competitors for DR5, DR2, DR1, EGR1, Sp1,
NFATc, NF1, CREB, and Pbx1 were also purchased from Panomics. ...
Cited by 1 - Web Search - panomics.com - dx.doi.org - mcb.asm.org - all 6 versions »
WL Blalock, C Weinstein-Oppenheimer, F Chang, PE Hoyle, XY Wang 3, PA Algate 4, RA Franklin, SM …
LS Steelman, JA McCubrey - Leukemia, 1999 - nature.com
... Interestingly, the neurofibromatosis-1 (NF1) gene, a tumor suppressor frequently
lost in juvenile chronic myelogenous leukemia (CML), is functionally related ...
Web Search
Induction of p 57 KIP 2 expression by p 73 beta - Full text - MIT Libraries
E Balint, AC Phillips, S Kozlov, CL Stewart, KH … - Proceedings of the National Academy of Sciences, 2002 - pnas.org
... upstream of the human p57 KIP2 transcription initiation site contains binding sites
for numerous transcription factors including SP1, NF1, OCT1, EGR1, TBP, and ...
Cited by 7 - Web Search - pubmedcentral.nih.gov - pnas.org - dx.doi.org - all 5 versions »
Induction of p57 KIP2 expression by p73
E Balint, AC Phillips, S Kozlov, CL Stewart, KH … - pnas.org
... of the human p57 KIP2 transcription initiation site contains binding sites for numerous
transcription factors includ- ing SP1, NF1, OCT1, EGR1, TBP, and ETS (40 ...
Web Search
Hepatitis B Virus X Protein: Structure, Function and Biology
S Murakami, S Murakami, FTC Alert - Intervirology, 1999 - content.karger.com
... TPA)- responsive element (TRE)-like sequence, aC stretch and an NF1-binding site ...
TGFß Egr1 (Ets family) HBx interaction with Egr1 70 transgenic, mRNA, TGFß ...
Cited by 42 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Array-based comparative genomic hybridization for the detection of DNA sequence copy number changes … - Full text - MIT Libraries
B Albrecht, M Hausmann, H Zitzelsberger, H Stein, … - The Journal of Pathology, 2004 - doi.wiley.com
... GEF1 40TEL11 D4S2930 C84C11/T3 D5S23 D5S2064 DAB2 DHFR,MSH3 APC EGR1 CSF1R NIB1408 ...
D17S125,D17S61 D17S1296,D17S1523 LLGL1 FLI,TOP3A NF1 5' NF1 3' BRCA1 PPARBP ...
Cited by 2 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
The role of nuclear Y-box binding protein 1 as a global marker in drug resistance - Full text - MIT Libraries
M Kuwano, Y Oda, H Izumi, SJ Yang, T Uchiumi, Y … - Mol Cancer Ther, 2004 - mct.aacrjournals.org
... Involvement of a DNA binding protein, MDR-NF1/YB-1, in human MDR1 gene ... O-
tetradecanoylphorbol-13-acetate activation of the MDR1 promoter is mediated by EGR1. ...
Cited by 1 - Web Search - mct.aacrjournals.org - ncbi.nlm.nih.gov
SRF mediates activity-induced gene expression and synaptic plasticity but not neuronal viability - Full text - MIT Libraries
N Ramanan, Y Shen, S Sarsfield, T Lemberger, G … - Nature Neuroscience, 2005 - neuroscience.jhu.edu
... Expression of IEGs, including c-Fos, FosB, Egr1, Egr2, cJun (also known as Jun),
JunB, Arc, Actb and Actg1, was greatly enhanced in the dentate gyrus of ... Egr1 ...
Web Search - nature.com - nature.com - ncbi.nlm.nih.gov
DNA elements recognizing NF-Y and Sp1 regulate the human multidrug-resistance gene promoter - Full text - MIT Libraries
R Sundseth, G MacDonald, J Ting, AC King - Mol Pharmacol, 1997 - molpharm.org
... Sp1 and WT-1 (34) share overlapping DNA-binding consensus with the
transcription factor EGR1. Recombinant EGR1 binds to an hMDR1 ...
Cited by 31 - Web Search - molpharm.aspetjournals.org - intl-molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
An SP 1-like 5'-GACCACGCC-3' sequence is critical for activity of the inflammatory phospholipase A 2 …
M Paradon, C Salvat, Q Fan, G Bereziat, JL Olivier - European Journal of Biochemistry, 1998 - blackwell-synergy.com
... of the probe (lane 2). Oligonucleotides binding AP1 (lane 3), NF1 (lane 4 ... by a series
of oligonucleotide competitors containing binding sites for Egr1, YY1, Ets ...
Cited by 2 - Web Search - content.febsjournal.org - ejbiochem.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Strong nuclear factor-kB–DNA binding parallels cyclooxygenase-2 gene transcription in aging and in … - Full text - MIT Libraries
WJ Lukiw, NG Bazan - J Neurosci Res, 1998 - doi.wiley.com
... rat, and human COX-2 genes for transcription factor binding sites that show homology
to the core consensus se- quences for AP1, AP2, Egr1, hypoxia inducible ...
Cited by 58 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Transcriptional Control of Hepatocanalicular Transporter Gene Expression - Full text - MIT Libraries
M MUeLLER - Seminars in Liver Disease, 2000 - humanabc.4t.com
Page 1. SEMINARS IN LIVER DISEASE—VOL. 20, NO. 3, 2000 323 From the Division
of Gastroenterology and Hepatology, University Hospital ...
Cited by 31 - View as HTML - Web Search - ncbi.nlm.nih.gov
Do essential genes evolve slowly - Full text - MIT Libraries
LD Hurst, NG Smith - Curr. Biol, 1999 - csb.yale.edu
Page 1. Brief Communication 747 Do essential genes evolve slowly? Laurence
D. Hurst and Nick GC Smith Approximately two thirds of ...
Cited by 45 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions »
C5a-Induced Gene Expression in Human Umbilical Vein Endothelial Cells - Full text - MIT Libraries
EA Albrecht, AM Chinnaiyan, S Varambally, C Kumar- … - American Journal of Pathology, 2004 - ajp.amjpathol.org
... genes that became activated after 2 hours of stimulation with C5a (EGR1 and ATF3 ...
523-538[Medline]; Jahroudi N, Ardekani AM, Greenberger JS: An NF1-like protein ...
Cited by 3 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Transcription of the bone sialoprotein gene is stimulated by v-Src acting through an inverted CCAAT … - Full text - MIT Libraries
RH Kim, J Sodek - Cancer Res, 1999 - intl-cancerres.aacrjournals.org
... from Life Technologies, Inc., and the consensus oligonucleotides for CTF/NF1 and
CREB ... gene expression through serum-responsive elements of the Egr1/TIS8 gene ...
Cited by 21 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cross signaling, cell specificity, and physiology - Full text - MIT Libraries
JE Dumont, S Dremier, I Pirson, C Maenhaut - Am J Physiol Cell Physiol, 2002 - intl-ajpcell.physiology.org
... immediate genes. C-Fos and Egr1, which are induced in many cells in response
to all sorts of signals, are an obvious example (372). Cell ...
Cited by 8 - Web Search - ajpcell.physiology.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Transcriptional Control of Hepatocanalicular Transporter Gene Expression - Full text - MIT Libraries
G TRANSCRIPTION, T FACTORS - Semin Liver Dis, 2000 - thieme-connect.com
... promoter is positively regulated by SP1, whereas overexpression of EGR1 decreased
Mdr1b ... sites for C/EBPβ, RAR, HNF3β, AP1, AP2, SP1, NF1 (nuclear factor 1 ...
Web Search
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... MEF-2 MEF2 03 Myogenic MADS factor MEF-2 MEF2 04 Myogenic MADS factor MEF-2 MINI20
B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcriptional regulation of MDR genes
KW Scotto, DA Egan - Cytotechnology, 1998 - springerlink.com
... NF-R1, a 110 kD protein, interacts with sequences between –123 and –115 and between
–56 and –45 (the Sp1/EGR1 site) (Ogura, 1992) A series of 2 bp ...
Cited by 10 - Web Search - kluweronline.com - ingentaconnect.com
Large-scale collection and characterization of promoters of human and mouse genes - Full text - MIT Libraries
Y Suzuki, R Yamashita, M Shirota, Y Sakakibara, J … - Silico Biol, 2004 - iospress.metapress.com
... V$E4F1 Q6 E4F1 1 0.985 64 48 4 V$EGR1 01 Egr-1 0.885 0.854 111 74 2 ... V$MYOD
01 MyoD 1 0.979 163 107 12 V$NF1 Q6 NF-1 1 0.986 483 468 32 ...
Cited by 2 - Web Search - bioinfo.de - bioinfo.de - ncbi.nlm.nih.gov
5 TUMOR SUPPRESSOR GENE DEFECTS IN HUMAN CANCER
SCGSOF TUMORIGENESIS - cancer.org
Page 1. A genetic basis for the development of cancer has been hypothe-
sized for roughly a century, and support for the proposal ...
View as HTML - Web Search
Diagnosis, classification, and cytogenetics of myelodysplastic syndromes - Full text - MIT Libraries
T Vallespi, M Imbert, C Mecucci, C Preudhomme, P … - Haematologica, 1998 - haematologica.it
Page 1. Haematologica 1998; 83:258-275 review A BSTRACT Recent Advances
in Myelodysplastic Syndromes Guest Editors: Miguel Angel ...
Cited by 26 - View as HTML - Web Search - haematologica.it - haematologica.org - ncbi.nlm.nih.gov - all 10 versions »
Journal of Neuro-Oncology 46: 263–291, 2000
F DeMonte, CG Kalhorn, TX Houston, LE Ginsberg, TX … - Journal of Neuro-Oncology, 2000 - kluweronline.com
Page 1. 1 2 3 4 April 13, 2000 4:30–4:45pm MANAGEMENT AND OUTCOME OF SARCOMAS
OF THE SKULL BASE Franco DeMonte, Chrisstopher G. Kalhorn ...
Web Search - springerlink.com - ingentaconnect.com
DNA microarray analysis reveals that glutathione S-transferase is a novel target for the mood …
C de Caen, F Caen, I Rehovot, AB AG, H Im … - blackwell-synergy.com
... NMDA up-regulated immediate early genes (IEGs) and transcriptions factors (Egr1,
c-fos, NGFI-B). Egr-1 was up-regulated by 60 min and then slowly decreased. ...
Web Search - ingentaconnect.com
Immunohistochemistry study of human vestibular nerve schwannoma differentiation - Full text - MIT Libraries
G Hung, J Colton, L Fisher, M Oppenheimer, R … - Glia, 2002 - doi.wiley.com
... Furthermore, another Schwann cell tumor sup- pressor gene, NF1, which acts as ...
Wild-type egr1/ Krox24 promotes and dominant-negative mutants inhibit, pluripo ...
Cited by 2 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Plenary Talk P01: Experience-dependent modification of neural circuits–cellular and molecular … - Full text - MIT Libraries
MM Poo - Journal of Neurochemistry - blackwell-synergy.com
... USA Benign peripheral nerve tumors called neurofibromas are a major source of morbidity
for patients with the inherited disease neurofibro- matosis type 1 (NF1 ...
Web Search - blackwell-synergy.com
Quantitative Proteomic and Transcriptional Analysis of the Response to the p38 MAPK Inhibitor
Z Lin… - mcponline.org
... mitotic inhibitors (wee1 tyrosine kinase and homolog of checkpoint 1),
growth repressors (Spry-4, NF1, and WD repeat containing ...
Web Search
Transcription factors, normal myeloid development, and leukemia - Full text - MIT Libraries
DG Tenen, R Hromas, JD Licht, DE Zhang - Blood, 1997 - bloodjournal.org
PDF Version of this Article. Citation Map. Email this article to a friend. Similar
articles found in: Blood Online PubMed. PubMed Citation. ...
Cited by 353 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
cDNA Array Identification of Genes Regulated in Rat Renal Medulla in Response to Vasopressin …
R Title - ajprenal.physiology.org
Page 1. 1 F-00054-2002 July 9, 2002 Revised: September 1, 2002 cDNA Array
Identification of Genes Regulated in Rat Renal Medulla in ...
Web Search
Evaluation of the host transcriptional response to human cytomegalovirus infection - Full text - MIT Libraries
JF Challacombe, A Rechtsteiner, R Gottardo, LM … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
Page 1. Evaluation of the host transcriptional response to human cytomegalovirus
infection Jean F. Challacombe 1 , Andreas Rechtsteiner ...
Web Search - stat.washington.edu - intl-physiolgenomics.physiology.org - ncbi.nlm.nih.gov - all 6 versions »
Medizinische Klinik und Poliklinik III Grosshadern Ludwig-Maximilians-Universitaet Muenchen Leitung: …
CG Hybridisierung, J Christodoulou - edoc.ub.uni-muenchen.de
Page 1. I Medizinische Klinik und Poliklinik III Großhadern Ludwig-Maximilians-
Universität München Leitung: Prof. Dr. med. W. Hiddemann ...
View as HTML - Web Search
|
©2005 Google