![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 18 of 18 for EGR1 and RUNX1. (0.06 seconds) |
Centromeric breakage and highly rearranged chromosome derivatives associated with mutations of TP53 …
MK Andersen, DH Christiansen, J Pedersen-Bjergaard - GENES, CHROMOSOMES & CANCER, 2005 - doi.wiley.com
... The locus-specific probes (LSI)—MLL dual-color, p53, BCR/ABL, C-MYC, cyclin D1,
ETO/RUNX1, ETV6/RUNX1 extra signal, 5q EGR1/D5S23, 7q 7S486/CEP7—came from ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Gene Expression Profiling of Leiomyoma and Myometrial Smooth Muscle Cells in Response to … - Full text - MIT Libraries
X Luo, L Ding, J Xu, N Chegini - Endocrinology, 2005 - endo.endojournals.org
... vector into a myometrial cell line expressing low levels of EGR1 resulted in a ... in
this functional category include TGIF, TIEG, CITED2, Nur77, Runx1, and Runx2. ...
Cited by 2 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Oligo GEArray® Human Hematopoietic Stem Cells and Hematopoiesis Microarray
S Conditions - search.cosmobio.co.jp
... and Regulators: ASH2L, BCL11A, CBFB, CD80, CD86, CEBPE, CEBPG, EGR1, ETS1, ETV6 ... NCOA6,
NFYA, NOTCH1, NOTCH2, NOTCH4, PAX5, RBPSUH, RHOH, RUNX1, SCAND1, STAT1 ...
View as HTML - Web Search
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Transcription Factors: Atf2, Cebpb, Creb1, Crebbp, Egr1, Egr2, Egr3, Elk1, Elk3,
Fkbp1b, Fos ... Nfkbie, Nfkbil1, P300-ESTs, Raf1, Rel, Rela, Relb, Runx1, Runx2, Sp1 ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... Transcription Factors: ATF2, CEBPB, CREB1, CREBBP, EGR1, EGR2, EGR3, ELK1, ELK3,
EP300 ... NFKBIE, NFKBIL1, NFKBIL2, NFRKB, RAF1, REL, RELA, RELB, RUNX1, RUNX2, SP1 ...
View as HTML - Web Search - eurogentec.com
Innovation: Novel ChIP-based strategies to uncover transcription factor target genes in the immune … - Full text - MIT Libraries
AS Weinmann - Nature Reviews Immunology, 2004 - nature.com
... chromatin immunoprecipitation screen reveals protein kinase C as a direct RUNX1
target gene ... new growth suppressor protein TOE1 as a direct target gene of Egr1. ...
Cited by 4 - Web Search - depts.washington.edu - zlab.bu.edu - ncbi.nlm.nih.gov - all 5 versions »
Gene Expression Profiling of Leiomyoma and Myometrial Smooth Muscle Cells In Response to TGF-β
X Luo, L Ding, J Xu, N Chegini - Endocrinology (submitted), 2004 - endo.endojournals.org
... vector into a myometrial cell line expressing low levels of EGR1 resulted in ... and
MSMC in this functional category include TGIF, TIEG, CITED2, Nur77, Runx1 and ...
Cited by 1 - Web Search - endo.endojournals.org
Leiomyoma and Myometrial Gene Expression Profiles and Their Response to Gonadotropin Releasing …
X Luo, L Ding, J Xu, RS Williams, N Chegini - Endocrinology (submitted), 2004 - endo.endojournals.org
... PCR including CTGF, Able-interactive (Abi2), fibromodulin, Runx1 and Runx2 (35,42). ...
In our previous microarray study we reported that EGR1, a prototype of a ...
Cited by 1 - Web Search - endo.endojournals.org
Cellular Genomic Products for Hematopoietic Disorders
DNAP Description - vysis.com
... The breakpoints in 21q22 are clustered within the AML1 (RUNX1) gene. ... LSI EGR1/D5S721,
D5S23 Dual Color Probe hybridized to normal cells showing the two orange ...
View as HTML - Web Search
Relation between resistance of Philadelphia-chromosome-positive acute lymphoblastic leukaemia to the … - Full text - MIT Libraries
WK Hofmann, S de Vos, D Elashoff, H Gschaidmeier, … - Lancet, 2002 - knm1.ibe.med.uni-muenchen.de
... BCD1 U44975 10p15 B-cell development 1 >10 RUNX1 D43968 21q22.3 Runt related
transcription factor 1 (AML1) >10 ... EGR1 X52541 5q31.1 Early growth response 1 >10 ...
Cited by 65 - View as HTML - Web Search - dc.uba.ar - ncbi.nlm.nih.gov
Array-based comparative genomic hybridization for the detection of DNA sequence copy number changes … - Full text - MIT Libraries
B Albrecht, M Hausmann, H Zitzelsberger, H Stein, … - The Journal of Pathology, 2004 - doi.wiley.com
... 40TEL11 D4S2930 C84C11/T3 D5S23 D5S2064 DAB2 DHFR,MSH3 APC EGR1 CSF1R NIB1408 ... ZABC1)
CYP24 TNFRSF 6B (DCR3) TPD52L2,TOM 200TEL14 D21S378 RUNX1(AML1) DYRK1A ...
Cited by 2 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Leiomyoma and Myometrial Gene Expression Profiles and Their Responses to Gonadotropin-Releasing … - Full text - MIT Libraries
X Luo, L Ding, J Xu, RS Williams, N Chegini - Endocrinology, 2005 - endo.endojournals.org
... to these genes, we validated the expression of 15 more genes with real-time PCR
including CTGF, Able-interactive (Abi2), fibromodulin, Runx1, and Runx2 (35, 42 ...
Cited by 1 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
A General Survey of Thymocyte Differentiation by Transcriptional Analysis of Knockout Mouse Models - Full text - MIT Libraries
D Puthier, F Joly, M Irla, M Saade, G Victorero, B … - The Journal of Immunology, 2004 - jimmunol.org
... Runx1/AML1 has been shown to modulate the local accessibility of DNA to the ... Egr1
is another transcriptional regulator of interest, because it promotes positive ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Defining the CREB Regulon: A Genome-Wide Analysis of Transcription Factor Regulatory Regions - Full text - MIT Libraries
S Impey, SR McCorkle, H Cha-Molstad, JM Dwyer, GS … - Cell, 2004 - ohsu.edu
... Moreover, Stony Brook, New York 11794 many CREB targets (eg, C/EBP , Egr1, and Nurr1)
are themselves transcription factors that regulate other genes. ...
Cited by 6 - View as HTML - Web Search - cmu.edu - neuro.med.harvard.edu - ncbi.nlm.nih.gov
Analysis of Transcription Factor Expression during Discrete Stages of Postnatal Thymocyte … - Full text - MIT Libraries
S Tabrizifard, A Olaru, J Plotkin, M Fallahi- … - The Journal of Immunology, 2004 - jimmunol.org
... Egr1: forward, CAGGAGTGATGAACGCAAGA; reverse, TGGGGATGGGTAAGAAGAGA. ... findings for
Egrs (37) c-Myb (38), GATA-3 (39), Lmo1 (40), Heb (41), Runx1 (42), and many ...
Cited by 1 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Transforming growth factor {beta}-induced cell cycle arrest of human hematopoietic cells requires p … - Full text - MIT Libraries
JM Scandura, P Boccuni, J Massague, SD Nimer - Proc. Natl. Acad. Sci. US A, 2004 - pnas.org
... binding sites for several transcription factors (eg, Sp1, YY1, and RUNX1) that are ...
known to play important roles in hematopoiesis (including C/EBP , EGR1, WT-1 ...
Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
JBC Papers in Press. Published on October 24, 2001 as Manuscript M107795200
C Kumar-Sinha, S Varambally, A Sreekumar, AM … - jbc.org
Page 1. Molecular Cross-Talk Between the TRAIL and Interferon Signaling Pathways
Chandan Kumar-Sinha, Sooryanarayana Varambally, Arun ...
Web Search
Expression of the Peripheral Benzodiazepine Receptor Triggers Thymocyte Differentiation
P ROCHARD, S GALIEGUE, N TINEL, A PELERAUX, A BORD … - inflammation - ingentaconnect.com
... cell differentiation M29474 RAG-1 M94633 RAG-2 M28825 CD1a M28826 CD1b M28827 CD1c
L38820 CD1d X14975 CD1e M16279 CD99 (MIC2) D43968 RUNX1 X85750 transcript ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
|
©2005 Google