![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 27 of 27 for EGR1 and SOX9. (0.07 seconds) |
Sp1 and Egr1 regulate transcription of the Dmrt1 gene in Sertoli cells - Full text - MIT Libraries
N Lei, LL Heckert - Biol Reprod, 2002 - biolreprod.org
... The positive elements bind the transcription factors Sp1, Sp3, and Egr1, suggesting
that these ... genes for Sry, SF-1, Dax1, WT1, Lim1, Emx2, Lhx9, and SOX9 [1–8 ...
Cited by 11 - Web Search - bioone.org - biolreprod.org - ncbi.nlm.nih.gov - all 5 versions »
Small Ubiquitin-Like Modifier 1 (SUMO-1) Modification of the Synergy Control Motif of Ad4 Binding … - Full text - MIT Libraries
T Komatsu, H Mizusaki, T Mukai, H Ogawa, D Baba, M … - Molecular Endocrinology - mend.endojournals.org
... multiple types of transcription factors such as Sox9 (13), Gata4 (14), Wt1 (15,
16), PITX1 (17), multiprotein bridging factor 1 (MBF1) (18), EGR1 (19, 20), and ...
Cited by 5 - Web Search - dx.doi.org - mend.endojournals.org - ncbi.nlm.nih.gov
The one-to-four rule and paralogues of sex-determining genes - Full text - MIT Libraries
S Ohno - Cell. Mol. Life Sci, 1999 - springerlink.com
... ther of SOX3 (SRX) nor of SOX9. ... consisted of EGR1, EGR2, EGR3 and EGR4, whereas the
only known paralogue of the other is WT1, which receptor genes in the ...
Cited by 16 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Sp 1 and Sp 3 Transcription Factors Mediate Interleukin-1 {beta} Down-regulation of Human Type II … - Full text - MIT Libraries
C Chadjichristos, C Ghayor, M Kypriotou, G Martin, … - J Biol Chem, 2003 - jbc.org
... transcription would probably involve an inhibitory effect on expression and binding
of SOX9 to the enhancer and increased expression and binding of Egr1 to the ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Comparison of Gene Expression Patterns between 2, 3, 7, 8-Tetrachlorodibenzo-p-dioxin and a Natural … - Full text - MIT Libraries
J Adachi, Y Mori, S Matsui, T Matsuda - Toxicological Sciences, 2004 - toxsci.oupjournals.org
... treated cells. Other up-regulated genes were IGFBP10, GSTP1, CYP19A1, IGFBP1,
NPC1, CYP1A2, SOX9, EGR1, IGF2, and CDKN1A. The number ...
Cited by 1 - Web Search - toxsci.oupjournals.org - ncbi.nlm.nih.gov
Minireview: genetic models for the study of gonadotropin actions - Full text - MIT Libraries
KH Burns, MM Matzuk - Endocrinology, 2002 - endo.endojournals.org
... cell markers, Müllerian-inhibiting substance, sulfated glycoprotein-2, and Sox9
(46 ... critical in the establishment of the HPG endocrine axis, EGR1 (also known ...
Cited by 11 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Egr-1 mediates transcriptional repression of COL2A1 promoter activity by interleukin-1beta - Full text - MIT Libraries
L Tan, H Peng, M Osaki, BK Choy, PE Auron, LJ … - J. Biol. Chem, 2003 - jbc.org
... with a Gal4 binding domain and a pCMV-Gal4-Egr1 chimera permits an ... Sox9, the first
transcription factor to specify the chondrogenic lineage, activates type II ...
Cited by 16 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genetic causes of human reproductive disease - Full text - MIT Libraries
JC Achermann, G Ozisik, JJ Meeks, JL Jameson - J Clin Endocrinol Metab, 2002 - dx.doi.org
... no mutations in gonadotrope-specific genes have been described yet (eg Egr1) (Fig ...
or inappropriate expression of the testis genes, SRY and SOX9, affect ovarian ...
Cited by 17 - Web Search - jcem.endojournals.org - ncbi.nlm.nih.gov
Expression of Dmrt 1 in a turtle with temperature-dependent sex determination - Full text - MIT Libraries
C Murdock, T Wibbels, F Alert - Cytogenetic and Genome Research, 2003 - content.karger.com
... sex-determining genes reported to-date, including: aromatase, SOX9, NR0B1, WT1 ... Three
zinc finger transcription factors, Sp1, Egr1, and Sp3 were identified and ...
Cited by 2 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions »
Gata4 regulates testis expression of Dmrt1 - Full text - MIT Libraries
N Lei, LL Heckert - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... and the positive elements bind the transcription factors Sp1, Sp3, and Egr1 (Fig. ...
containing a consensus Gata binding site, but not with consensus Sox9 or Sp1 ...
Cited by 3 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Alterations of Sex Differentiation in Males: From Candidate Genes to Diagnosis and Treatments
H Ostrer - Current Pharmaceutical Design, 2004 - ingentaconnect.com
... The WT1 –KTS isoform plays a role in SRY induction through a proximal EGR1-like
DNA ... SOX9 is autosomal, sex-determining gene was an SRY- like HMG-box encodes a ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Expression of Steroidogenic Factor 1 in the Testis Requires an Interactive Array of Elements Within … - Full text - MIT Libraries
SP Scherrer, DA Rice, LL Heckert - Biology of Reproduction, 2002 - bioone.org
... bound complexes have not been identified, but antibodies against Sp3, Wt1, and Egr1
failed to ... to SF-1 promoter activity, identifying a role for a Sox9 site, E ...
Cited by 4 - Web Search - biolreprod.org - biolreprod.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular Endocrinology. First published June 10, 2004 as doi: 10.1210/me. 2004-0173
K Morohashi - mend.endojournals.org
... factors such as Sox9 (13), Gata4 (14), Wt1 (15, 16), PITX1 (17), MBF1
(18), EGR1 (19, 20), and TReP-132 (21) have been reported ...
Web Search
GENE INTERACTIONS IN GONADAL DEVELOPMENT - Full text - MIT Libraries
KL Parker, A Schedl, BP Schimmer - Annual Review of Physiology, 1999 - physiol.annualreviews.org
... SOX9, one of these genes, also is involved in sex determination. ... the last three of
which show high homology with the transcription factors Sp1 and Egr1. ...
Cited by 51 - Web Search - physiol.annualreviews.org - d.umn.edu - ncbi.nlm.nih.gov
Full Text View - Full text - MIT Libraries
SP Scherrer, DA Rice, LL Heckert - Biology of Reproduction - bioone.org
... bound complexes have not been identified, but antibodies against Sp3, Wt1, and Egr1
failed to ... to SF-1 promoter activity, identifying a role for a Sox9 site, E ...
Web Search
Wnt-4 regulation by the Wilms' tumour suppressor gene, WT 1 - Full text - MIT Libraries
EUH Sim, A Smith, E Szilagi, F Rae, P Ioannou, MH … - Oncogene, 2002 - nature.com
... The putative target genes described in the literature include other transcription
factors (Pax2, EGR1, c-myc, c-myb, MyoD, WT1 ... GATA 1 GATA 2 Sox9 Sox11 EGR-1 ...
Cited by 11 - Web Search - nature.com - ncbi.nlm.nih.gov
Conservation of the function of DMRT1 regulatory sequences in mammalian sex differentiation. - Full text - MIT Libraries
A Boyer, S Dornan, I Daneau, J Lussier, DW … - Genesis, 2002 - doi.wiley.com
... field et al., 1993), in contrast to other genes such as SOX9, SF1, and ... by DNAse I
foot- printing, and furthermore that Sp1, Sp3, and Egr1 bound respectively to ...
Web Search - ncbi.nlm.nih.gov
ZINC FINGER TRANSCRIPTION FACTORS IN SKELETAL DEVELOPMENT - Full text - MIT Libraries
B Ganss, A Jheon - Crit Rev Oral Biol Med, 2004 - crobm.iadrjournals.org
... In one class are the C2H2 genes that encode proteins such as Egr1 and the Sp ... activation
by the high-mobility group (HMG) transcription factor Sox9 (Lefebvre et ...
Web Search - crobm.iadrjournals.org - ncbi.nlm.nih.gov
Sustained ERK 1/2 but not STAT 1 or 3 activation is required for thanatophoric dysplasia phenotypes … - Full text - MIT Libraries
N Nowroozi, S Raffioni, T Wang, BL Apostol, RA … - Human Molecular Genetics, 2005 - hmg.oxfordjournals.org
... L09752); Early growth response1 (egr1) [ACTAGAACATCAAGTTGGCTGAAAA] (forward) and
[TTGTTTAAGCAAACACAAGTACGAA ... 2000) Up-regulation of the chondrogenic Sox9 gene by ...
Web Search - hmg.oxfordjournals.org - hmg.oupjournals.org - ncbi.nlm.nih.gov
Genetic dissection of mammalian fertility pathways - Full text - MIT Libraries
MM Matzuk, DJ Lamb - Nature Cell Biology, 2002 - mrg.genetics.washington.edu
... human X-linked gene DAX1 (ref. 33) or haploinsufficiency of the autosomal
SOX9 gene 32,34–36 . Interestingly, whereas an extra Y ...
Cited by 60 - View as HTML - Web Search - nature.com - tu-cottbus.de - ncbi.nlm.nih.gov - all 5 versions »
Meningioma Expression Analysis
G Wrobel - dkfz-heidelberg.de
Page 1. Meningioma Expression Analysis Gunnar Wrobel February 26, 2004 Page
2. Contents 1 Preprocessing 3 1.1 Introduction . . . . . ...
View as HTML - Web Search - dkfz.de
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... 4 binding sites PAX4 04 Pax-4 binding sites PAX6 01 Pax-6 PU1 B Pu.1 (Pu120)
Ets-like transcription factor identified in lymphoid B-cells S8 01 S8 SOX9 B1 SOX ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Poster Session II Signaling
AOFRAT INCISOR, M TEETH - Connective Tissue Research, 2003 - taylorandfrancis.metapress.com
Page 1. Connective Tissue Research, 44(Suppl. 1): 342–350, 2003 Copyright c 2003
Taylor & Francis 0300-8207/03 $12.00 + .00 DOI: 10.1080/03008200390181870 ...
Web Search
The DEAD-Box Protein DP103 (Ddx20 or Gemin-3) Represses Orphan Nuclear Receptor Activity via SUMO … - Full text - MIT Libraries
MB Lee, LA Lebedeva, M Suzawa, SA Wadekar, M … - Molecular AND Cellular Biology, 2005 - mcb.asm.org
... other factors that function in sexual differentiation, namely Sox9 and WT ... they function
to silence transcription factors, including nuclear receptors, Egr1 to 4 ...
Web Search - subhagya.wadekar.tripod.com - ucsf.edu - ncbi.nlm.nih.gov - all 6 versions »
Cloning and Characterization of a Novel Zinc Finger Protein that Modulates the Transcriptional … - Full text - MIT Libraries
B Borud, G Mellgren, J Lund, M Bakke - Mol Endocrinol, 2003 - mend.endojournals.org
... SF-1 is also expressed in Sertoli cells, where it synergizes with Sox9 and WT ... the
promoters described to be regulated by SF-1 and Sp1 or Egr1 contain adjacent ...
Cited by 2 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Silencing of Fshr Occurs through a Conserved, Hypersensitive Site in the First Intron - Full text - MIT Libraries
BP Hermann, LL Heckert - Molecular Endocrinology - mend.endojournals.org
... Furthermore, other studies examining distal cis-regulatory sequences, such as those
on the Sox9 and Shh genes, demonstrate that distal elements can function at ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Impact of genetic engineering on the understanding of spermatogenesis - Full text - MIT Libraries
D Escalier - Human Reproduction Update, 2001 - humupd.oupjournals.org
... Egr4-Egr1 double mutants have permitted the elucidation of the level of redundancy
between these Egr family members in regulating luteinizing hormone ...
Cited by 35 - Web Search - ingentaconnect.com - oup.co.uk - ncbi.nlm.nih.gov - all 6 versions »
| |
©2005 Google