![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 33 of 33 for FOXD3 and MSX1. (0.06 seconds) |
Regulation of Msx genes by a Bmp gradient is essential for neural crest specification - Full text - MIT Libraries
C Tribulo, MJ Aybar, VH Nguyen, MC Mullins, R … - Development, 2003 - dev.biologists.org
... We show that msx1 expression is able to induce all other early neural crest markers
tested (snail, slug, foxd3) at the time of neural crest specification. ...
Cited by 9 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The winged-helix transcription factor Foxd3 suppresses interneuron differentiation and promotes … - Full text - MIT Libraries
M Dottori, MK Gross, P Labosky, M Goulding - Development, 2001 - dev.biologists.org
... Key words: Winged-helix genes, Foxd3, Neural crest specification, Neural tube
development, Chick ... These include Pax3, Pax7, Msx1/2 and Zic1-Zic3, all of which ...
Cited by 33 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Quantitative Evaluation of Morpholino-Mediated Protein Knockdown of GFP, MSX1, and PAX7 During Tail …
E Schnapp, EM Tamaka - Key words, 2005 - doi.wiley.com
... Mediated Protein Knockdown of GFP, MSX1, ... We focused on the down-regulation of green
fluorescent protein and two axolotl proteins, MSX1 and PAX7. ...
Cited by 1 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
The transcription factor Sox9 is required for cranial neural crest development in Xenopus - Full text - MIT Libraries
RF Spokony, Y Aoki, N Saint-Germain, E Magner-Fink … - Development, 2002 - dev.biologists.org
... represent downstream targets of Sox9. These genes include Slug, Snail,
Twist, Pax3, Msx1 and Foxd3. However, it is not clear at ...
Cited by 38 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Canonical Wnt activity regulates trunk neural crest delamination linking BMP/noggin signaling with G … - Full text - MIT Libraries
T Burstyn-Cohen, J Stanleigh, D Sela-Donenfeld, C … - Development, 2004 - dev.biologists.org
... neural crest delamination and transcription of various BMP-dependent genes, which
include Cad6B, Pax3 and Msx1, but not that of Slug, Sox9 or FoxD3. ...
Cited by 2 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Cardiac outflow tract defects in mice lacking ALK 2 in neural crest cells - Full text - MIT Libraries
V Kaartinen, M Dudas, A Nagy, S Sridurongrit, MM … - Development, 2004 - uphs.upenn.edu
... Expression of NCC markers Msx1 (A,B), Foxd3 (C,D) and Sox10 (E,F) in controls
(A,C,E) and Alk2 mutants (B,D,F) at E9.0. The expression pattern of Msx1 (A,B ...
Cited by 4 - View as HTML - Web Search - dev.biologists.org - dev.biologists.org - ncbi.nlm.nih.gov
Neural crest as a way of knowing: New perspectives on lineage and morphogenesis - Full text - MIT Libraries
S Chapman, D Raible, D Henken, K Tosney - Developmental Dynamics, 2004 - doi.wiley.com
... The concentrations of BMP required to induce msx1 expres- sion were determined in ...
Wnt signals are required for both Sox10 and FoxD3, which specifically alter ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Report A Dynamic Switch in the Replication Timing of Key Regulator Genes in Embryonic Stem Cells …
P Perry, S Sauer, N Billon, WD Richardson, M … - landesbioscience.com
... This included genes such as Oct4, Nanog, Utf1, Rex1, Foxd3, Cripto, Fgf4 and ... Several
other neural-asso- ciated genes including Irx3, Nkx2.9, Msx1, Olig2 and ...
Web Search - landesbioscience.com
Issues in Development
SN BRIMBLE, X ZENG, DA WEILER, Y LUO, Y LIU, I … - dx.doi.org
... 5 -GACTGAGCTGGTTGC- CTCAT-3 and 5 -TTTCTTCAGGCCCACAAATC-3 ; FOXD3, 5 -
CGTCGCTCATCAAGTCCGA ... 5 -CCGAACTTTCCAAGCCATAA-3 and 5 -TGGCATTCAAGAGGGTTTTC-3 ; MSX1 ...
Web Search - liebertonline.com - liebertonline.com - liebertpub.com
Opinion: Mechanisms of roof plate formation in the vertebrate CNS - Full text - MIT Libraries
VV Chizhikov, KJ Millen - Nature Reviews Neuroscience, 2004 - nature.com
... Liu, Y., Helms, AW & Johnson, JE Distinct activities of Msx1 and Msx3 in ... Johnson,
RL & Erickson, CA The winged-helix transcription factor FoxD3 is important ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Neural crest specification: migrating into genomics - Full text - MIT Libraries
LS Gammill, M Bronner-Fraser - Nature Reviews Neuroscience, 2003 - nature.com
... 53. Sasai, N., Mizuseki, K. & Sasai, Y. Requirement of FoxD3-class signaling for
neural crest determination in Xenopus. Development 128, 2525-2536 (2001). ...
Cited by 18 - Web Search - nature.com - genetics.wisc.edu - ncbi.nlm.nih.gov - all 5 versions »
The bHLH factor Olig 3 coordinates the specification of dorsal neurons in the spinal cord - Full text - MIT Libraries
T Muller, K Anlag, H Wildner, S Britsch, M Treier, … - Genes & Development, 2005 - genesdev.org
... Lmx1a and Msx1 expression were similar in control and Olig3 GILacZ /Olig3 ... Similarly,
the expression of Foxd3 and Sox10, which mark premigratory and migratory ...
Web Search - dx.doi.org - genesdev.org - ncbi.nlm.nih.gov
Extracellular signals, cell interactions and transcription factors involved in the induction of the … - Full text - MIT Libraries
MJ AYBAR, A GLAVIC, R MAYOR - Biol Res, 2002 - scielo.cl
... The dynamic expression patterns of Msx1 and AP-2 genes suggest they could have ...
transcription factors expressed in the neural crest such as Xtwist, FoxD3, Zic-5 ...
Cited by 12 - Cached - Web Search - scielo.cl - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Specification of dorsal spinal cord interneurons - Full text - MIT Libraries
AW Helms, JE Johnson - Curr. Opin. Neurobiol, 2003 - staging.healthsystem.virginia.edu
... Pax7 Dbx2 Ngn1/2 Lhx2/9 BarH1 Brn3a Lhx1/5 Brn3a Foxd3 Isl1/2 Brn3a Rnx Lbx1
Lhx1/5 Pax2 ... bHLH genes ventral cell fates Msx1 Math1 Ngn1/2 Wnt1/Wnt3a Zic1 BMPs ? ...
Cited by 28 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions »
Generation of Peripheral Sensory and Sympathetic Neurons and Neural Crest Cells from Human Embryonic … - Full text - MIT Libraries
O Pomp, I Brokhman, I Ben-Dor, BE Reubinoff, RS … - Stem Cells, 2005 - stemcells.alphamedpress.org
... Foxd3 (CAAGCCCAAGAACAGCCTAGTGAA, TGACGAAGCAGTCGTTGAGTGAGA, 202 bp). ... in the mouse
also induced by 1 week of SDIA treatment included Sox9, dHAND, and MSX1. ...
Web Search - dx.doi.org - stemcells.alphamedpress.org - ncbi.nlm.nih.gov
Six 1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a … - Full text - MIT Libraries
SA Brugmann, PD Pandur, KL Kenyon, F Pignoni, SA … - Development, 2004 - gwumc.edu
... Key words: Pre-placodal ectoderm, Neural crest, foxD3, zic2, sox2, sox3, keratin,
dlx5, dlx6, Cell fate determination, Patterning, Xenopus Summary ...
Cited by 1 - View as HTML - Web Search - dev.biologists.org - dev.biologists.org - ncbi.nlm.nih.gov
Original Research Report
ESC Differentiation - dx.doi.org
... DNMT2; DNMT3A; DNMT3B; DNMT3L; DSG2; EIF4A1; ELOVL6; EPRS; FABP5; FOXD3; GAL; GDF3 ...
HN1; HOXB2; ID3; IRX2; IRX3; IRX4; LASP1; LLGL2; MILD1; MSX1; MSX2; NEUROG1 ...
Web Search - liebertonline.com - liebertonline.com
Snail precedes Slug in the genetic cascade required for the specification and migration of the … - Full text - MIT Libraries
MJ Aybar, MA Nieto, R Mayor - Development, 2003 - dev.biologists.org
... The expression of genes such as Meis, Pbx, FoxD3 and Zic family members not only ...
molecules include BMP4 and the genes downstream of it, such as Msx1 and the ...
Cited by 21 - Web Search - dx.doi.org - dev.biologists.org - ncbi.nlm.nih.gov
A slug, a fox, a pair of sox: Transcriptional responses to neural crest inducing signals
E Heeg-Truesdell, C LaBonne - Birth Defects Research Part C Embryo Today Reviews, 2004 - doi.wiley.com
... 2004. © 2004 Wiley-Liss, Inc. Key words: neural crest; c-myc; Wnt; BMP;
FGF; Notch; Slug; Snail; Sox; Msx-1; Pax-3; FoxD3 Elizabeth ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
To proliferate or to die: role of Id 3 in cell cycle progression and survival of neural crest … - Full text - MIT Libraries
Y Kee, M Bronner-Fraser - Genes & Development, 2005 - genesdev.org
... 2003 ), AP2 (Luo et al. 2003 ), c-Myc (Bellmeyer et al. 2003 ), and Msx1 (Tribulo
et al. ... (F) Double in situ hybridization with Id3 and FoxD3 RNA. ...
Cited by 1 - Web Search - dx.doi.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Snail precedes Slug in the genetic cascade required for the specification and migration of the … - Full text - MIT Libraries
S Xenopus - Development - codon.ciencias.uchile.cl
... We show that Snail is able to induce the expression of Slug and all other neural
crest markers tested (Zic5, FoxD3, Twist and Ets1) at the time of specification ...
View as HTML - Web Search
Induction and specification of the vertebrate ectodermal placodes: precursors of the cranial sensory …
SA Brugmann, SA Moody - Biol. Cell, 2005 - gwumc.edu
... most highly expressed at Noggin concentrations lower than those for foxD3, there
is ... six1 (Brugmann et al., 2004) and enhances the expression of msx1 (Woda et al ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Control of roof plate formation by Lmx 1 a in the developing spinal cord - Full text - MIT Libraries
VV Chizhikov, KJ Millen - Development, 2004 - dev.biologists.org
... Expression of MafB (AE), Msx1/2 (GK) (both red), Gdf7 (L,M), Bmp4 (N ... The winged-helix
transcription factor FoxD3 is important for establishing the neural crest ...
Cited by 4 - Web Search - dx.doi.org - dev.biologists.org - ncbi.nlm.nih.gov
Dorsalization of the neural tube by Xenopus tiarin, a novel patterning factor secreted by the … - Full text - MIT Libraries
H Tsuda, N Sasai, M Matsuo-Takasaki, M Sakuragi, Y … - Neuron, 2002 - note.cellbio.duke.edu
... 2G and 2H), Sox2 (CNS; Figures 2I and 2J), and FoxD3 (neural crest; Figure 2K) showed
that Tiarin-positive ... (K) FoxD3 (light blue) and Tiarin (indigo) probes. ...
Cited by 12 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Monitoring Early Differentiation Events in Human Embryonic Stem Cells by Massively Parallel …
T Miura, Y Luo, I Khrebtukova, R Brandenberger, D … - Stem Cells and Development, 2004 - dx.doi.org
... EBAF (LEFTA) 4/16 Hs.278239 LEFTB 0/72 Hs.385870 TDGF1 0/38 Hs.120204 FOXD3 0/37
Hs ... KRT19 28/1 Hs.155421 AFP 1829/30 Hs.152531 HAND1 500/0 Hs.424414 MSX1 218/15 ...
Cited by 1 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Neural crest and the origin of ectomesenchyme: Neural fold heterogeneity suggests an alternative … - Full text - MIT Libraries
JA Weston, H Yoshida, V Robinson, S Nishikawa, S T … - Developmental Dynamics, 2004 - doi.wiley.com
... These include FoxD3 (Kos et al., 2001; Sasai et al., 2001), Zic5 (Na- kata et al.,
2000), Twist (Hopwood et al., 1989; Soo et al., 2002), and AP2 (Luo et al ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells - Full text - MIT Libraries
I Chambers, D Colby, M Robertson, J Nichols, S Lee … - Cell, 2003 - note.cellbio.duke.edu
... acid identity over the homeodomain is found with Barx1, Msx1, and members ... ES cells,
including Oct4 and two transcription factors, Sox2 and FoxD3, identified as ...
Cited by 133 - View as HTML - Web Search - biology.ccsu.edu - fhcrc.org - all 7 versions »
Myogenic satellite cells: physiology to molecular biology - Full text - MIT Libraries
TJ Hawke, DJ Garry - J Appl Physiol, 2001 - jap.org
... kinase receptor c-Met (205), the homeodomain transcriptional repressor msx1 (11,
189 ... identified in stem cells or regenerating cells including Genesis (Foxd3; Ref ...
Cited by 160 - Cached - Web Search - intl-jap.physiology.org - jap.physiology.org - ncbi.nlm.nih.gov - all 5 versions »
Amphioxus and lamprey AP-2 genes: implications for neural crest evolution and migration patterns - Full text - MIT Libraries
D Meulemans, M Bronner-Fraser - Development, 2002 - dev.biologists.org
... the neural plate border, including Snail, Twist, Zic, Id, AP-2, FoxD3, Distal-less ...
of the anterior neural plate in Xenopus by homeodomain factors Dlx3 and Msx1. ...
Cited by 28 - Web Search - staff.washington.edu - biology.ualberta.ca - ncbi.nlm.nih.gov - all 6 versions »
A primer on using in ovo electroporation to analyze gene function - Full text - MIT Libraries
CE Krull - Developmental Dynamics, 2004 - doi.wiley.com
... Bach A, Lallemand Y, Nicola MA, Ramos C, Mathis L, Maufras M, Robert B. 2003.
Msx1 is required for dorsal diencepha- lon patterning. ...
Cited by 6 - Web Search - protechinternational.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Smooth muscle stem cells
KK Hirschi, MW Majesky - The Anatomical Record, 2004 - doi.wiley.com
... The winged helix transcription factor Foxd3 is genetically downstream of Pax3 and
is expressed in both premigra- tory and migratory neural crest cells. ...
Cited by 6 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Stem Cells: Hype and Reality - Full text - MIT Libraries
CM Verfaillie, MF Pera, PM Lansdorp - Hematology, 2002 - asheducationbook.org
... These include the transcription factor Oct-4, 4 the transcription factor FoxD3
(P. Labosky, personal communication), and the novel gene taube nuss. ...
Cited by 30 - Web Search - asheducationbook.org - ncbi.nlm.nih.gov
Long-Distance Cue From Emerging Dermis Stimulates Neural Crest Melanoblast Migration
KW Tosney - Key words, 2004 - doi.wiley.com
Page 1. ARTICLE Long-Distance Cue From Emerging Dermis Stimulates Neural
Crest Melanoblast Migration Kathryn W. Tosney* Neural crest ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
| |
©2005 Google