![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 13 of 13 for GATA2 and NF1. (0.06 seconds) |
The NFY Transcription Factor Inhibits von Willebrand Factor Promoter Activation in Non-endothelial … - Full text - MIT Libraries
Y Peng, N Jahroudi - J Biol Chem, 2003 - jbc.org
... 2). Several trans-acting factors including GATA2 (3, 4), GATA3, GATA6 (5), Ets
(6, 7), SCL/Tal-1 (8), SP1 (9), vezf (10), Oct1 (11, 12), and NF1 (13) in ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov
Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing … - Full text - MIT Libraries
ML Givens, R Kurotani, N Rave-Harel, NLG Miller, … - Molecular Endocrinology, 2004 - mend.endojournals.org
... matrices for the following factors from the MatInspector (38) library: V$CEBPB.01,
V$DLX1.01, V$GATA2.01, V$GATA2.02, V$HOXA9.01, V$MEIS1_HOXA9.01, V$NF1.01, V ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... 22.4 ATF XBP1 306.2 CREB HNF1 87.4 ETS2 IRF1 36.9 GATA2 MZF1 22.3 ... 21.6 BRN2
TATA 257.1 HNF4 RORA1 80.4 CREB SRF 34.4 CHOP NF1 21.4 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... GATA1 03 GATA-binding factor 1 GATA1 04 GATA-binding factor 1 GATA2 01 GATA ... 2 MINI20
B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Localization of 54 rat genes, and definition of new synteny groups conserved in the human and the … - Full text - MIT Libraries
IM Genome - Mammalian Genome, 2000 - springerlink.com
... ATCTTGACCTGCGTGGGCGTGA Chr 4 Gata2 3.1 kb mouse cDNA (L4) b — Minegishi et al.
(1998) A ... Rat Chr 4 GATA-binding protein 2 Gata2 4q34-q41 3q21 6, 38.5 ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genomic organization and transcriptional analysis of the human L-glutaminase gene
FJA CASTILLO-OLIVARES, J MARQUEZ, F de Ciencias, S … - biochemj.org
... For NF1 and TATA Biochemical Journal Immediate Publication. ... pGL3-1, hinting at CREBP1
and/or HNF-1 and at HNF-4 and/or NF1 as very important silencer elements. ...
View as HTML - Web Search
Clinical pharmacology of human growth hormone and its secretagogues
AW Root, MJ Root - Curr Drug Targets Immune Endocr Metabol Disord, 2002 - ingentaconnect.com
... Nkx3.1, Six3, P-Frk, GATA2, Islet1, Pax6, and Brn4 further the formation of the
definitive pouch which closes off from the oral cavity by e12 in the mouse. ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Genetic control of growth - Full text - MIT Libraries
PE Mullis - European Journal of Endocrinology - eje-online.org
... element; TRE: thyroid hormone responsive element; POU1F1: Pit1 (pituitary-specific
transcription factor); USF, upstream stimulatory factor; NF1, nuclear factor ...
Web Search - eje-online.org - ncbi.nlm.nih.gov
Functional analysis of the von Hippel-Lindau tumour suppressor and its role in tumourigenesis
RE Barry - unibas.ch
Page 1. Functional analysis of the von Hippel-Lindau tumour suppressor and its
role in tumourigenesis Inauguraldissertation zur Erlangung ...
View as HTML - Web Search - pages.unibas.ch - pages.unibas.ch - unibas.ch
Expression of genes involved in vascular development and angiogenesis in endothelial cells freshly … - Full text - MIT Libraries
CJ Favre, M Mancuso, K Maas, JW McLean, P Baluk, … - Am. J. Physiol. Heart. Circ. Physiol, 2003 - ajpheart.physiology.org
Page 1. Am. J. Physiol.- Heart & Circ. Physiol. #H-00983-2002.R1 FINAL ACCEPTED
VERSION June 27, 2003 Expression of genes involved in vascular development ...
Cited by 12 - Web Search - intl-ajpheart.physiology.org - ajpheart.physiology.org - ncbi.nlm.nih.gov
Molekulare Analyse der mRNA-Expression von Plasma-Prokallikrein: Expressionsprofil in humanen …
P Neth - deposit.ddb.de
Page 1. Molekulare Analyse der mRNA-Expression von Plasma-Prokallikrein:
Expressionsprofil in humanen Geweben und Mechanismen der Transkriptionsregulation ...
Web Search - edoc.ub.uni-muenchen.de
Evaluation of the host transcriptional response to human cytomegalovirus infection - Full text - MIT Libraries
JF Challacombe, A Rechtsteiner, R Gottardo, LM … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
Page 1. Evaluation of the host transcriptional response to human cytomegalovirus
infection Jean F. Challacombe 1 , Andreas Rechtsteiner ...
Web Search - stat.washington.edu - intl-physiolgenomics.physiology.org - ncbi.nlm.nih.gov - all 6 versions »
POU domain factors in the neuroendocrine system: lessons from developmental biology provide insights … - Full text - MIT Libraries
B Andersen, MG Rosenfeld - Endocr. Rev, 2001 - edrv.endojournals.org
... Q29) (151). In GATA2, the C-terminal DNA-binding zinc finger and an adjacent
cluster of basic residues seem to be important. Pit ...
Cited by 25 - Web Search - pharmacology.cwru.edu - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
|
©2005 Google