![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 6 of 6 for HAND1 and GATA1. (0.05 seconds) |
GATA6 Is Essential for Embryonic Development of the Liver but Dispensable for Early Heart Formation - Full text - MIT Libraries
R Zhao, AJ Watt, J Li, J Luebke-Wheeler, EE … - Mol Cell Biol, 2005 - mcb.asm.org
... GATA1, -2, and -3 appear to act primarily in ... and TGAGGTGGTCGCTTGTGTAG; Gata4,
TGGCCGACGTGGGAGCAT and CGGCGGGAAGCGGACAG; Hand1, AACCTCAACCCCAAAAGCC and ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Morphogenesis of the right ventricle requires myocardial expression of Gata4 - Full text - MIT Libraries
EM Zeisberg, Q Ma, AL Juraszek, K Moses, RJ … - J. Clin. Invest, 2005 - jci.org
... RV development, while Nkx2-5 acts in conjunction with Hand1 to regulate LV ... For instance,
Gata1 inhibits proliferation and promotes terminal differentiation of ...
Web Search - jci.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Cooperative interaction between GATA5 and NF-ATc regulates endothelial-endocardial differentiation … - Full text - MIT Libraries
G Nemer, M Nemer - Development, 2002 - dev.biologists.org
... et al., 1997 ), and the basic helix-loop-helix proteins Hand1 and Hand2 ... splicing
and alternate translation initiation have also been reported for GATA1 (Ito et ...
Cited by 16 - Web Search - ircm.qc.ca - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
Genetic and genomic approaches to study placental development - Full text - MIT Libraries
M Hemberger, U Zechner, F Alert - Cytogenetic and Genome Research, 2004 - content.karger.com
Page 1. Genome in Development and Cloning Cytogenet Genome Res 105:257–269 (2004)
DOI: 10.1159/000078197 Genetic and genomic approaches to study ...
Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Polymorphism, shared functions and convergent evolution of genes with sequences coding for … - Full text - MIT Libraries
H Lavoie, F Debeane, QD Trinh, JF Turcotte, LP … - Human Molecular Genetics, 2003 - hmg.oupjournals.org
... appeared only in mammals in HOXD8, HOXA11, HOXD11, HOXA13, HOXD13, GATA1, GATA4
and ... It was further found that HEY2 homo and heterodimerize with HAND1 and HAND2 ...
Cited by 8 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Differenciation des precurseurs myocardiques (du Magicien d’Oz au Dr Faust)
S YNTHESE - MEDECINE/SCIENCES, 2002 - ist.inserm.fr
... scl règlent ensuite l’expression de gènes tels que vegfR2 et gata1 dans les ... fait
de l’existence, chez cette espèce, d’un second gène, Hand1, qui doit ...
View as HTML - Web Search - disc.vjf.inserm.fr
| |
©2005 Google