![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 48 of 48 for HOXA9 and HOXA3. (0.18 seconds) |
Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34 Human Cord …
CM Ferrell, ST Dorsam, H Ohta, RK Humphries, MK … - stemcells.alphamedpress.org
... The transcriptome of the leukemogenic homeoprotein HOXA9 in human hematopoietic
cells. ... the influence of somite-derived signals, retinoic acid and Hoxa3. ...
Web Search - dx.doi.org - stemcells.alphamedpress.org
Rapid Generation of de novo Biological Pathways from Large-Scale Gene Expression Data Using the …
DC Siu - ingenuity.com
... MLL bone marrow sample was analyzed by Ingenuity Pathways Analysis, HOXA9,PBX1,MEIS1 ...
in the networks built using the 100 – gene set,such as HOXA3,PBX3, CD2 ...
View as HTML - Web Search
High-resolution genetic mapping of the hypodactyly (Hd) locus on mouse chromosome 6
JW Innis, K Kazen-Gillespie, J McGorman - Mamm. Genome, 1996 - springerlink.com
... If the Hd locus is proximal to Hoxa3, then knowledge of the orientation of ... The
expression pattern of Hoxa9 (formerly 1.7) has not been reported for the limbs. ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular approach to echinoderm regeneration - Full text - MIT Libraries
MC Thorndyke, WC Chen, PW Beesley, M Patruno - Microscopy Research and Technique, 2001 - doi.wiley.com
... Furthermore, of these, HoxA genes, HoxA9, and HoxA3 are early molecular makers
for the dedifferentiation process (Gardiner et al., 1995). ...
Cited by 2 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa 7 and Hoxa 9 - Full text - MIT Libraries
PM Ayton, ML Cleary - Genes & Development, 2003 - genesdev.org
... Multiple Hoxa cluster genes (Hoxa1, Hoxa3, Hoxa5, Hoxa7, Hoxa9, Hoxa10, and Hoxa11)
were consistently expressed in MLL-immortalized MPMP cell lines. ...
Cited by 27 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Homeobox genes and gut development - Full text - MIT Libraries
F Beck, F Tata, K Chawengsaksophak - BioEssays, 2000 - doi.wiley.com
... stomach Hoxc5 (22) g Hoxa3 (17 ... Hoxa4 (74) Hoxa5 (23) Hoxc5 (23) hi Hoxb6 (25) Hoxc6
(25) Hoxa7 (25) j [Hoxa9 (29,30) Hoxc9 (30)] n Hoxb8 (25) j Hoxc8 (25) Hoxd8 ...
Cited by 33 - Web Search - dx.doi.org - gutjnl.com - gut.bmjjournals.com - all 8 versions »
Genomic organization of the Hoxa4-Hoxa10 region from Morone saxatilis: implications for Hox gene …
EA Snell, JL Scemama, EJ Stellwag - J. Exp. Zool.(Mol. Dev. Evol.), 1999 - doi.wiley.com
... M24085, Hoxb5 X12802, Hoxc5 X68324, Hoxb6 X17267, Hoxc6 X17266, Hoxa9 Y07696, Hoxa10 ...
15 kb in length) which extends toward the presumptive Hoxa3 region of the ...
Cited by 14 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular Cytogenetics A new recurrent inversion, inv (7)(p15q34), leads to transcriptional …
F Speleman, B Cauwelier, N Dastugue, J Cools, B … - Leukemia, 2005 - nature.com
... 16 Primers for the other HOXA genes (HOXA2, HOXA3, HOXA6, HOXA9, HOXA10, HOXA13)
and for HOXB3 and HOXC4 expression analysis were designed and developed ...
Web Search - nature.com
Differentiation phenotypes of pancreatic islet beta-and alpha-cells are closely related with … - Full text - MIT Libraries
N Mizusawa, T Hasegawa, I Ohigashi, C Tanaka- … - Gene, 2004 - ncbi.nlm.nih.gov
... Cdx2, Gbx2, Pax4, and Hlxb9 genes in MIN6 was higher than those in alpha TC1.6,
while expression of Hoxa2, Hoxa3, Hoxa5, Hoxa6, Hoxa7, Hoxa9, Hoxa10, Hoxa13 ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
A new recurrent inversion, inv (7)(p15q34), leads to transcriptional activation of
F Speleman, B Cauwelier, N Dastugue, J Cools, B … - Leukemia, 2005 - nature.com
... 16 Primers for the other HOXA genes (HOXA2, HOXA3, HOXA6, HOXA9, HOXA10, HOXA13)
and for HOXB3 and HOXC4 expression analysis were designed and developed ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Role of HOX Genes in the Development and Function of the Female Reproductive Tract - Full text - MIT Libraries
HS Taylor - Seminars in Reproductive Medicine - thieme-connect.com
... Mice with targeted disruptions in the paralogous genes Hoxa3 and Hoxd3 reveal ... G.
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
Meis1 and pKnox1 bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in … - Full text - MIT Libraries
PS Knoepfler, KR Calvo, H Chen, SE Antonarakis, MP … - Proc. Natl. Acad. Sci. USA, 1997 - dx.doi.org
... proliferation by SCF: Potential mechanisms of cooperativity with Hoxa9 in myeloid ...
regulation of initiation and maintenance phases of Hoxa3 expression in the ...
Cited by 64 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 7 versions »
Homeodomain Sequences
SD Subsets, V Plots - pnas.org
... goosecoid, Gsh-1, Gsh-2, GSCL, Gtx, H6, HB9, HB24, HD1, Hesx1, HEX, HOX11L1, HOX11L2,
HOXA1, HOXA2, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11 ...
Web Search
Expression of HOXA Genes in Patients with Multiple Myeloma
HR Hudlebusch, M Lodahl, H Johnsen, T Rasmussen - Leukemia & Lymphoma, 2004 - dx.doi.org
... HOXA3 R CAGTCCTCCGTTTGCTGG HOXA4 F GAAAGCAGAAGAAGACAGACCCTT HOXA4 R
GCTTGGATGAGCTGCCTTAATG HOXA7 F AATCGCCCACGCGCT HOXA7 R TTCTTCCACTTCATGCGGC HOXA9 ...
Web Search - taylorandfrancis.metapress.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Implication des genes Hox dans les processus d’organogenese chez les mammiferes
J Aubin, L Jeannotte - Medecine/Sciences, 2001 - ist.inserm.fr
... Dans le cas des doubles mutants Hoxa3/Hoxd3, la délétion de la vertèbre C1 est indiquée
par la boîte. ... Dans le système respiratoire, les souris Hoxa3 ...
Cited by 4 - View as HTML - Web Search
Evolutionary Conservation of Regulatory Elements in Vertebrate Hox Gene Clusters - Full text - MIT Libraries
S Santini, JL Boore, A Meyer - Genome Research, 2003 - genome.org
... HoxA10 ) into the analysis, only the length of the HoxA4 to HoxA9 portion of ... The
zebrafish A cluster lacks the HoxA1 and HoxA3 , HoxA4 , HoxA5 , and HoxA7 genes ...
Cited by 37 - Web Search - evolutionsbiologie.uni-konstanz.de - repositories.cdlib.org - dx.doi.org - all 13 versions »
Full Article - Full text - MIT Libraries
FR Goodman, PJ Scambler - Clinical Genetics, 2001 - blackwell-synergy.com
... has a phenotype attributable to haploinsufficiency for just HOXA3 and HOXA13 ... Recurrent
chromosomal translocations producing NUP98/HOXA9 and NUP98/HOXD13 fusion ...
Web Search - blackwell-synergy.com
Molecular Regulation of Muellerian Development by Hox Genes - Full text - MIT Libraries
H DU, HS TAYLOR - Ann. NY Acad. Sci, 2004 - annalsnyas.org
... Although Hoxa3 –/– and Hoxd3 –/– mutants had no defects in common, the generation
of ... 74,75 The Hoxa9 and Hoxd9 targeted mutations resulted in anterior ...
Cited by 1 - Web Search - dx.doi.org - annalsnyas.org - ncbi.nlm.nih.gov
High incidence of proviral integrations in the Hoxa locus in a new model of E 2 a-PBX 1-induced B- … - Full text - MIT Libraries
J Bijl, M Sauvageau, A Thompson, G Sauvageau - Genes & Development, 2005 - genesdev.org
... in the intergenic region between Hoxa9 and Hoxa10, two in the 3'-UTR of Hoxa10,
one between Hoxa7 and Hoxa9, and one telomeric to the 5'-UTR of Hoxa3 (which is ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
The molecular evolution of development - Full text - MIT Libraries
MD Purugganan - BioEssays, 1998 - doi.wiley.com
... HoxD1 Drosophila lab nematode ceh-13 HoxA2 HoxB2 Drosophila pb HoxA3, HoxB3,HoxD3 ...
abd-A Drosophila Antp Drosophila Ubx HoxB8, HoxC8, HoxD8 HoxA9, HoxB9, HoxC9 ...
Cited by 42 - Web Search - purugganan.gnets.ncsu.edu - ncsu.edu - ncbi.nlm.nih.gov - all 5 versions »
Differential selection after duplication in mammalian developmental genes - Full text - MIT Libraries
ET Dermitzakis, AG Clark - Mol. Biol. Evol, 2001 - mbe.oupjournals.org
... U10421, NM_010449), Hoxb1 (NM_002144, NM_008266); Hox3— Hoxa3 (NM_043365, P02831 ...
NP_008827, P02830), Hoxb7 (P09629, P09024); Hox9—Hoxa9 (P31269, P09631 ...
Cited by 30 - Web Search - genetics.wustl.edu - apt.allenpress.com - ncbi.nlm.nih.gov - all 5 versions »
Comparative genomics provides evidence for an ancient genome duplication event in sh
JS Taylor, Y Van de Peer, I Braasch, A Meyer - Phil. Trans. R. Soc. Lond. B, 2001 - journals.royalsoc.ac.uk
... In mice, paralogues Hox-1.5 and Hox- 1.6 (renamed HoxA3 and HoxA1 respectivelyöDe
Robertis 1994) have overlapping expression domains and are at least ...
Cited by 102 - Web Search - evolutionsbiologie.uni-konstanz.de - mit.edu - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Atlas of Hox gene expression in the developing kidney - Full text - MIT Libraries
LT Patterson, SS Potter - Developmental Dynamics, 2004 - doi.wiley.com
... Hoxa2 AI324701 Hoxc5 AI425648 Hoxa3 5 -CCAATGGGTTCGCTTACAATGC Hoxc6 AA035988 ... 5
-TCAGAATTAACCCTCACTAAAGGGA Hoxa9 GACCCCTCAGCAAGACAAACAC Hoxd1 BE865232 ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Perturbed thyroid morphology and transient hypothyroidism symptoms in Hoxa5 mutant mice - Full text - MIT Libraries
D Meunier, J Aubin, L Jeannotte - Dev Dyn, 2003 - doi.wiley.com
... For in- stance, Hoxa3 mutant mice are athymic and devoid of parathyroids, and they
exhibit thyroid hypoplasia (Manley and Capecchi, 1995, 1998; Su et al., 2001 ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov
Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation … - Full text - MIT Libraries
AC Brun, JM Bjornsson, M Magnusson, N Larsson, P … - Blood, 2004 - bloodjournal.org
... more pronounced given the report of a severe stem cell defect in HoxA9-deficient
mice ... et al 46 demonstrates a redundancy for the paralogous genes Hoxa3 and Hoxd3 ...
Cited by 8 - Web Search - dx.doi.org - ncbi.nlm.nih.gov - lu-research.lub.lu.se - all 6 versions »
A conceptual scale for correlating cytogenetic and physical maps - Full text - MIT Libraries
M Bina, J Young, EI Pares-Matos, F Alert - Cytogenetic and Genome Research, 2002 - content.karger.com
... 191.2 TF HOXA3/HOX1E 7p15–p14.2 Homeo ... 197.8 TF HOXA9/HOX1G, Hox 1.7 mouse
homolog, Abd-B Drosophila homolog 7p15–p14.2 Homeo ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
The pathophysiology of HOX genes and their role in cancer - Full text - MIT Libraries
DG Grier, A Thompson, A Kwasniewska, GJ McGonigle, … - J Pathol, 2005 - doi.wiley.com
... A nested pattern of Hoxa cluster genes was found, with Hoxa9 expressed in the
proximal part of the limbs, where the humerus or femur develops. ...
Cited by 1 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Mice mutant for both Hoxa1 and Hoxb1 show extensive remodeling of the hindbrain and defects in … - Full text - MIT Libraries
M Rossel, MR Capecchi - Development, 1999 - dev.biologists.org
... The Hoxa3 probe was a 650 bp EcoRI cDNA fragment containing the first coding exon
and the homeobox; the Pax1 probe was a 1 kb cDNA fragment previously ...
Cited by 62 - Web Search - dev.biologists.org - capecchi.genetics.utah.edu - ncbi.nlm.nih.gov
ORIGINAL ARTICLE Position-specific expression of Hox genes along the gastrointestinal tract - Full text - MIT Libraries
N Yahagi, R Kosaki, T Ito, T Mitsuhashi, H Shimada … - Congenital Anomalies, 2004 - blackwell-synergy.com
... 3A), and a subset of genes (ie HOXA13, HOXA6, HOXA9, HOXB2, HOXD13, HOXB13, HOXB3 ...
A monotonic decrease was observed at HOXA1 through HOXA3, whereas a monotonic ...
Cited by 1 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hox 11 paralogous genes are essential for metanephric kidney induction - Full text - MIT Libraries
DM Wellik, PJ Hawkes, MR Capecchi - Genes & Development, 2002 - genesdev.org
... 1999 ), and mice mutant for Eya1, Hoxa3, or Pax9 are athymic, aparathyroid ... Paralogous
mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control ...
Cited by 19 - Web Search - capecchi.genetics.utah.edu - pubmedcentral.nih.gov - dx.doi.org - all 8 versions »
SEQUENCE VARIATION IN THE UCSC GENOME BROWSER
D Thomas - cse.ucsc.edu
... Repeating Elements by RepeatMasker 7p15.2 HOXA1 HOXA1 HOXA2 HOXA3 AK056230 HOXA4
HOXA5 HOXA6 HOXA7 HOXA9 HOXA9 HOXA10 HOXA10 HOXA11 HOXA13 ...
View as HTML - Web Search - soe.ucsc.edu - cse.ucsc.edu - soe.ucsc.edu
Microarray and serial analysis of gene expression analyses identify known and novel transcripts … - Full text - MIT Libraries
RW Georgantas III, V Tanadve, M Malehorn, S … - Cancer Res, 2004 - cancerres.aacrjournals.org
... eg, KIT, FLT3, GATA-2, GATA-3, p27, HoxA5, and HoxA9), as well ... HoxA3 is involved
in formation of the nervous system (41 , 42) , pharyngeal glandular organs (43 ...
Cited by 7 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genesis and evolution of the Evx and Mox genes and the extended Hox and ParaHox gene clusters - Full text - MIT Libraries
C Minguillon, J Garcia-Fernandez - Genome Biology, 2003 - dx.doi.org
... P52946); amphioxus Xlox (AmphiXlox, AAC 39016); mouse Hoxa3 (mHoxa3, P02831 ... AmphiCdx,
AAC39017); Drosophila caudal (cad, P09085); mouse Hoxa9 (mHoxa9, P09631 ...
Cited by 6 - Web Search - bmc.ub.uni-potsdam.de - genomebiology.com - citebase.eprints.org - all 7 versions »
Genesis and evolution of the Evx and Mox genes and the extended Hox and ParaHox gene clusters - Full text - MIT Libraries
S Material, C Minguillon, J Garcia-Fernandez - Genome Biol, 2003 - pubmedcentral.nih.gov
... P52946); amphioxus Xlox (AmphiXlox, AAC 39016); mouse Hoxa3 (mHoxa3, P02831 ... AmphiCdx,
AAC39017); Drosophila caudal (cad, P09085); mouse Hoxa9 (mHoxa9, P09631 ...
Web Search
Homeodomain Proteins - Full text - MIT Libraries
WJ Gehring, M Affolter, T Burglin - Annual Review of Biochemistry, 1994 - biochem.annualreviews.org
Page 1. Annu. Rev. Biochem. 1994. 63.’487-526 Copyright © 1994 by Annual
Reviews Inc. All rights reserved HOMEODOMAIN PROTEINS ...
Cited by 261 - Web Search - biochem.annualreviews.org - ncbi.nlm.nih.gov
Complete mutation analysis panel of the 39 humanHOX genes
K Kosaki, R Kosaki, T Suzuki, H Yoshihashi, T … - Teratology, 2002 - doi.wiley.com
... of the following human HOX genes had been annotated in the GenBank database before
the present study: HOXA1, HOXA2, HOXA4, HOXA5, HOXA7, HOXA9, HOXA10, HOXA11 ...
Cited by 7 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
High-resolution detection and mapping of genomic DNA alterations in neuroblastoma.
YP Mosse, J Greshock, A Margolin, T Naylor, K Cole … - GENES, CHROMOSOMES & CANCER, 2005 - doi.wiley.com
... HOX gene cluster includes HOXA1, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9,
HOXA10, HOXA11, and HOXA13. 393 aCGH OF NEUROBLASTOMA Page 5. ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The duplication of the Hox gene clusters in teleost fishes
SJ Prohaska, PF Stadler - Th. Biosci, 2004 - bioinf.uni-leipzig.de
... One of them is an EST that is identified as HoxA3 (E = 10 − 50 with the tilipia
and medaka sequences). Three sequences from the survey by Fjose et al. ...
Cited by 5 - View as HTML - Web Search - bioinf.uni-leipzig.de
Regulation of vertebrate homeobox-containing genes by morphogens
F MAVILIO - European Journal of Biochemistry, 1993 - blackwell-synergy.com
... 11 Hoxa-11 HOXCll Hoxc-11 HOXDll Hoxd-11 HOXAlO Hoxa-l 0 HOXClO 10 Hoxc-10 HOXDlO
Hoxd-10 HOXA9 noxa -9 9 ... 3 HOXA3 Hoxa-3 HOXB3 Hoxb-3 Xhox2.7 HOXD3 Page 4. 276 ...
Cited by 30 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Altered expressions of HOX genes in human cutaneous malignant melanoma. - Full text - MIT Libraries
K Maeda, J Hamada, Y Takahashi, M Tada, Y Yamamoto … - Int. J. Cancer, 2005 - doi.wiley.com
... 25–28 For example, the thyroid defect seen in mice with Hoxa3 single mu- tants is
exacerbated in mice with double mutants with either of its paralogs. ...
Web Search - ncbi.nlm.nih.gov
HOX Genes in Human Lung - Full text - MIT Libraries
HA Golpon, MW Geraci, MD Moore, HL Miller, GJ … - American Journal of Pathology, 2001 - ajp.amjpathol.org
... our investigation, HOXA5 was most abundantly expressed, followed by HOXB2, HOXB6,
and HOXA3. ... Chen F, Capecchi MR: Paralogous mouse Hox genes, Hoxa9, Hoxb9, and ...
Cited by 13 - Web Search - ajp.amjpathol.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Requirement for Pbx1 in skeletal patterning and programming chondrocyte proliferation and … - Full text - MIT Libraries
L Selleri, MJ Depew, Y Jacobs, SK Chanda, KY Tsang … - Development, 2001 - dev.biologists.org
... These analyses examined Hoxa3 (cervical vertebrae, hyoid), Hoxb1 (hindbrain), Hoxb9
(sternum and ribs), Hoxd3 (cervical vertebrae), Hoxd9 (proximal fore limb ...
Cited by 27 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
How to make an egg: transcriptional regulation in oocytes - Full text - MIT Libraries
JL Song, GM Wessel - Differentiation, 2005 - blackwell-synergy.com
Full Article. View/Print PDF article (1191K). Download to reference manager.
Differentiation Volume 73 Issue 1 Page 1 - February 2005 ...
Web Search - ncbi.nlm.nih.gov
Polycomb group gene rae28 is required for sustaining activity of hematopoietic stem cells - Full text - MIT Libraries
H Ohta, A Sawada, JY Kim, S Tokimasa, S Nishiguchi … - J Exp Med, 2002 - jem.org
... Expression of multiple Hox genes from the three different clusters (Hoxa3, a4, a5 ...
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects ...
Cited by 29 - Web Search - intl.jem.org - ncbi.nlm.nih.gov
Human Homeobox HOXA 7 Regulates Keratinocyte Transglutaminase Type 1 and Inhibits Differentiation - Full text - MIT Libraries
PT La Celle, RR Polakowska - J Biol Chem, 2001 - jbc.org
... Synergistic and overlapping functions have also been observed with Hoxa3, Hoxb3,
and Hoxd3 and with Hoxa11 and Hoxd11 disruption in mouse development (reviewed ...
Cited by 9 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Hox Genes and Their Candidate Downstream Targets in the Developing Central Nervous System
ZN Akin, AJ Nazarali - springerlink.com
... function to replace the activity of another member of that same group that has been
disrupted (Horan et al., 1995a,b). As an example, Hoxa3, Hoxb3, and Hoxd3 ...
Web Search
EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS
ET Dermitzakis - etda.libraries.psu.edu
Page 1. The Pennsylvania State University The Graduate School The Eberly College
of Science EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS ...
View as HTML - Web Search
Large-scale reprogramming of cranial neural crest gene expression by retinoic acid exposure - Full text - MIT Libraries
SS Williams, JP Mear, HC Liang, SS Potter, BJ … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
Institution: Google Indexer Sign In as Member/Non-Member. Physiol. Genomics 19:
184-197, 2004; doi:10.1152/physiolgenomics.00136.2004 1094-8341/04 $5.00 ...
Cited by 1 - Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
| |
©2005 Google