![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 35 of 35 for HOXA9 and NF1. (0.07 seconds) |
Oncogenic interaction between BCR-ABL and NUP98-HOXA9 demonstrated by the use of an in vitro purging … - Full text - MIT Libraries
N Mayotte, DC Roy, J Yao, E Kroon, G Sauvageau - Blood, 2002 - bloodjournal.org
... U, Mayotte N, Nakamura T, Sauvageau G. NUP98-HOXA9 expression in ... Nf1 deficiency causes
Ras-mediated granulocyte/macrophage colony stimulating 7factor ...
Cited by 6 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov
Evi27 encodes a novel membrane protein with homology to the IL17 - Full text - MIT Libraries
J D Shaughnessy Jr - Oncogene, 2000 - nature.com
... Four of the genes are proven or suspected human disease genes: EVI1, NF1 and HOXA9
are causally associated with myeloid leukemia and EVI5 with stage 4S ...
Web Search
Cooperative activation of Hoxa and Pbx1-related genes in murine myeloid leukaemias
N Genetics - Nature Genetics, 1996 - nature.com
... with proviral activation of Meis1 implying that Hoxal and Hoxa9 cooperate with ... 2
locus in BXH-2 myeloid leukemia cell lines disrupts Nf1 expression without ...
Web Search - nature.com - Get it from MIT Libraries
Myeloid Leukemia: Disease Genes and Mouse Models
BXH Mice - content.karger.com
... Lange BJ, Freedamn MH, McCormick F, Jacks T, Shannon K: Loss of NF1 results in ... C:
Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects ...
Web Search - content.karger.com
Mrvi1, a common MRV integration site in BXH2 myeloid leukemias, encodes a protein with homology to a … - Full text - MIT Libraries
JD Shaughnessy Jr, DA Largaespada, E Tian, CF … - Oncogene, 1999 - nature.com
... Two of these genes, Nf1 and Hoxa9 are also involved in human myeloid leukemia (Shannon
et al., 1994; Nakamura et al., 1996b; Borrow et al., 1996). ...
Cited by 9 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Activation of the Rap 1 Guanine Nucleotide Exchange Gene, CalDAG-GEF I, in BXH-2 Murine Myeloid … - Full text - MIT Libraries
AJ Dupuy, K Morgan, FC von Lintig, H Shen, H Acar, … - J Biol Chem, 2001 - jbc.org
... Importantly, two of these genes, NF1 and HOXA9, are known human myeloid leukemia
disease genes, validating the usefulness of this approach for human disease ...
Cited by 12 - Web Search - dx.doi.org - intl.jbc.org - ncbi.nlm.nih.gov - all 6 versions »
Sox4 blocks cytokine-induced differentiation of 32Dcl3 cells and is a possible cooperating partner …
KE Boyd, A Poholek, O Mironenko, NG Copeland, NA … - yalepath.org
... and IL-3 3-5 ), growth factor receptors (c-fms 6 ), signaling molecules (Nf1 7 ),
and transcription factors including cMyb, Hoxa9, Hoxa7, Fli1, Meis1, and Evi1 ...
View as HTML - Web Search
Evi9 encodes a novel zinc finger protein that physically interacts with BCL6, a known human B-cell … - Full text - MIT Libraries
T Nakamura, Y Yamazaki, Y Saiki, M Moriyama, DA … - Mol. Cell. Biol, 2000 - mcb.asm.org
... At least three of these genes are proven or suspected human disease genes: NF1 and
HOXA9 are causally associated with myeloid leukemia, and EVI5 is associated ...
Cited by 15 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Somatic activation of oncogenic Kras in hematopoietic cells initiates a rapidly fatal … - Full text - MIT Libraries
BS Braun, DA Tuveson, N Kong, DT Le, SC Kogan, J … - Proc Natl Acad Sci US A, 2004 - pubmedcentral.nih.gov
... Ras such as BCR-ABL, mutant FLT3, and loss of NF1 all induce ... may be accompanied by
translocations involving transcription factors such as AML1 or HOXA9 (46, 47 ...
Cited by 20 - Web Search - dx.doi.org - pnas.org - ncbi.nlm.nih.gov - all 6 versions »
Evolutionary Conservation of Regulatory Elements in Vertebrate Hox Gene Clusters - Full text - MIT Libraries
S Santini, JL Boore, A Meyer - Genome Research, 2003 - genome.org
... into the analysis, only the length of the HoxA4 to HoxA9 portion of ... 12 in Table 2).
The matches most frequently obtained are: nuclear factor NF1 binding sites ...
Cited by 37 - Web Search - evolutionsbiologie.uni-konstanz.de - repositories.cdlib.org - dx.doi.org - all 13 versions »
Molecular pathogenesis of MDS
H Hirai - Int J Hematol, 2002 - haem.nus.edu.sg
... RAS gene mutations or inactivation of NF1 gene are thought to be critical events ...
q11), and inv(11) (p15q22) result in generation of NUP98/HOXA9, NUP98/ HOXD13 ...
Cited by 3 - View as HTML - Web Search - ishapd.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Blood First Edition Paper, prepublished online August 1, 2002; DOI 10.1182/blood-2002-04-1244
W Count - bloodjournal.org
... NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid
leukemias in mice. EMBO J. 2001;20:350-361. Page 21. 21 ... Nf1 deficiency ...
Web Search
Molecular Mechanisms of Myelodysplastic Syndrome - Full text - MIT Libraries
H Hirai - Japanese Journal of Clinical Oncology, 2003 - jjco.oupjournals.org
... RAS gene mutations or inactivation of NF1 gene are thought to be critical events ...
q11) and inv(11)(p15q22) result in the generation of NUP98/HOXA9, NUP98/HOXD13 ...
Cited by 5 - Web Search - jjco.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Large-scale identification of disease genes involved in acute myeloid leukemia - Full text - MIT Libraries
SJ Erkeland, M Valkhof, C Heijmans-Antonissen, A … - J. Virol, 2004 - pubmedcentral.nih.gov
... Examples of this latter group of CISs are p53 (39, 41), Notch-1 (12, 13, 31),
Evi-1 (38), NF1 (Evi-2) (5), Lck-1 (1, 11, 35), Pim-1 (50), HoxA9 (Evi-6) (43 ...
Cited by 4 - Web Search - jvi.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Retroviral insertions in Evi12, a novel common virus integration site upstream of Tra1/Grp94, … - Full text - MIT Libraries
PJ Valk, Y Vankan, M Joosten, NA Jenkins, NG … - J Virol, 1999 - jvi.asm.org
... 35, 36, 40) or inactivation of tumor suppressor genes (7). Multiple human
proto-oncogenes and tumor suppressors, eg, EVI1 (34), NF1 (47), and HOXA9 (39) have ...
Cited by 15 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
The inv (11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies … - Full text - MIT Libraries
Y Arai, F Hosoda, H Kobayashi, K Arai, Y Hayashi, … - Blood, 1997 - bloodjournal.org
... a part of the NUP98 gene, was isolated using PCR primers NF1 (CACAAATACCAGTGGTGGGAATA)
and NR1 ... on 11p15 that becomes rearranged and fused to the HOXA9 gene at ...
Cited by 53 - Web Search - bloodjournal.org - bloodjournal.org - ncbi.nlm.nih.gov - all 6 versions »
Bone marrow reconstitution as a relevant model of genetically programmed leukemia.
A Dolnikov, S Shen, T Passioura, G Symonds - Curr Med Chem Cardiovasc Hematol Agents, 2003 - ingentaconnect.com
... In addition, it was shown that combinations of the HoxA9 gene with some ... It was recently
shown that mice transplanted with hematopoietic cells from NF1-null mice ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Making Better Drugs for Children with Cancer
PC Adamson, SL Weiner, JV Simone - ipcr.us
... TEL-AML1 <2,500 AML-ETO MLL (HOXA9, Meis1) Juvenile myelomonocytic leukemia Somatic
PTPN11 mutations NF1 GM-CSF hypersensitivity Overactivation of SHP ...
View as HTML - Web Search
Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing … - Full text - MIT Libraries
ML Givens, R Kurotani, N Rave-Harel, NLG Miller, … - Molecular Endocrinology, 2004 - mend.endojournals.org
... matrices for the following factors from the MatInspector (38) library: V$CEBPB.01,
V$DLX1.01, V$GATA2.01, V$GATA2.02, V$HOXA9.01, V$MEIS1_HOXA9.01, V$NF1.01, V ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Appearance of leukemia in peripheral blood
A Neutropenia, B Anemia, C Thrombocytopenia, C Mac - bloodjournal.org
... Myeloproliferative disease (Lethally irradiated recipients of Nf1 -/- fetal liver
cells). ... Lethally irradiated recipients of Nf1 -/- fetal liver cells. ...
Web Search
Inaugural-Dissertation zur Erlangung des Doktorgrades der Naturwissenschaftlichen Fakultaet der …
U Fuchs - deposit.ddb.de
... Zelle ein, so zB als • GTPase-stimulierende Proteine, die in den RAS-
Signaltransduktionsweg eingreifen wie zB NF1 (I NGRAM et al., 2001); ...
Web Search - bibl7.hrz.uni-giessen.de - geb.uni-giessen.de - bibd.uni-giessen.de
Animal models of acute myelogenous leukaemia– development, application and future perspectives
E Mc Cormack, O Bruserud, BT Gjertsen - Leukemia, 2005 - nature.com
... 110 Secondly, the HOXA9 80, 111 oncogene, a poor prognosis marker in AML ... 113 Finally,
patients exhibiting mutations in the Nf1 45, 87, 114 tumour suppressor ...
Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
A stable human-derived packaging cell line for production of high titer retrovirus/vesicular … - Full text - MIT Libraries
DS Ory, BA Neugeboren, RC Mulligan - J. Biol. Chem, 2004 - dx.doi.org
Vol. 93, Issue 21, 11400-11406, October 15, 1996. This paper was presented
at a colloquium entitled "Genetic Engineering of Viruses ...
Cited by 320 - Web Search - pnas.org - ncbi.nlm.nih.gov - adsabs.harvard.edu - all 6 versions »
High-resolution detection and mapping of genomic DNA alterations in neuroblastoma.
YP Mosse, J Greshock, A Margolin, T Naylor, K Cole … - GENES, CHROMOSOMES & CANCER, 2005 - doi.wiley.com
... be exceedingly rare in this tumor, with CDKN2A or NF1 biallelic deletion ... gene cluster
includes HOXA1, HOXA3, HOXA4, HOXA5, HOXA6, HOXA7, HOXA9, HOXA10, HOXA11 ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The gene encoding the transcriptional regulator Yin Yang 1 (YY1) is a myeloid transforming gene … - Full text - MIT Libraries
SJ Erkeland, M Valkhof, C Heijmans-Antonissen, R … - Blood, 2003 - bloodjournal.org
... demonstrated to be involved in MuLV-induced leukemias (eg, Notch-1, Nf1, p53, Fli ...
Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes ...
Cited by 9 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Transcription factors, normal myeloid development, and leukemia - Full text - MIT Libraries
DG Tenen, R Hromas, JD Licht, DE Zhang - Blood, 1997 - bloodjournal.org
PDF Version of this Article. Citation Map. Email this article to a friend. Similar
articles found in: Blood Online PubMed. PubMed Citation. ...
Cited by 353 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The Molecular Basis of Leukemia - Full text - MIT Libraries
DG Gilliland, CT Jordan, CA Felix, CT Jordan - Hematology, 2004 - asheducationbook.org
... 6 Germline NF1 mutations and somatic RAS mutations are known to activate the same ...
with MLL translocations, it recently was observed that the Hoxa9 and Meis1 ...
Cited by 1 - Web Search - neuroscienzemolecolari.it - asheducationbook.org - ncbi.nlm.nih.gov
Pore membrane and/or filament interacting like protein 1 (POMFIL1) is predominantly expressed in the … - Full text - MIT Libraries
JF Coy, S Wiemann, I Bechmann, D Bachner, R Nitsch … - Gene, 2002 - uni-marburg.de
Page 1. Pore membrane and/or filament interacting like protein 1 (POMFIL1)
is predominantly expressed in the nervous system and encodes ...
Cited by 4 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Pathogenesis of acute myeloid leukaemia and inv (16)(p 13; q 22): a paradigm for understanding … - Full text - MIT Libraries
JT Reilly - British Journal of Haematology, 2005 - blackwell-synergy.com
... 1999), AML1-EVI1 (Cuenco & Ren, 2001) and NUP98 HOXA9 (Yamamoto et ... mutual exclusivity
characterizes the proliferative mutations that involve RAS, NF1 and SHP1 ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Satellite Symposium V
T HAFERLACH, W KERN, S SCHNITTGER, C SCHOCH - springerlink.com
Page 1. Satellite Symposium V Modern Diagnostics in Chronic Myeloproliferative
Diseases (CMPDs) T. HAFERLACH, W. KERN, S. SCHNITTGER ...
Web Search
Plenary Talk P01: Experience-dependent modification of neural circuits–cellular and molecular … - Full text - MIT Libraries
MM Poo - Journal of Neurochemistry - blackwell-synergy.com
... USA Benign peripheral nerve tumors called neurofibromas are a major source of morbidity
for patients with the inherited disease neurofibro- matosis type 1 (NF1 ...
Web Search - blackwell-synergy.com
Bibliography Current World Literature
L Benboubker, H Watier, A Carion, MT Georget, I … - Current Opinion in Hematology, 2002 - co-hematology.com
... Fujino T, Yamazaki Y, Largaespada DA, Jenkins NA, Copeland NG, Hirokawa K, Nakamura
T: Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox ...
Web Search
Publicaties CME-UZ–UZ Leuven-1998-2004
S CLAES, T AGUIRRE, V SIMOSA, T BUSTOS, R LANDER, … - Am. J. Surg. Pathol, 1998 - uzleuven.be
Page 1. 1 CLAES, S., AGUIRRE, T., SIMOSA, V., BUSTOS, T., LANDER, R., PIRAS,
M., LEGIUS, E., CASSIMAN, JJ, RAEYMAEKERS, P. Hydrocephalus ...
View as HTML - Web Search
EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS
ET Dermitzakis - etda.libraries.psu.edu
Page 1. The Pennsylvania State University The Graduate School The Eberly College
of Science EVOLUTION OF COMPONENTS OF GENE REGULATION IN DROSOPHILA AND MAMMALS ...
View as HTML - Web Search
Bibliography Current World Literature
H Ashush, LA Rozenszajn, M Blass, M Barda-Saad, D … - Current Opinion in Oncology, 2001 - co-oncology.com
January 2001, 13:1 > Bibliography Current World Literature. < Previous |
Next >. ARTICLE LINKS: Permissions | View full size inline ...
Web Search
|
©2005 Google