![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 135 for HSF1 and REST. (0.09 seconds) |
A yeast heat shock transcription factor (Hsf1) mutant is defective in both Hsc82/Hsp82 synthesis and … - Full text - MIT Libraries
P Zarzov, H Boucherie, C Mann - J. Cell Sci, 1997 - jcs.biologists.org
... Page 3. 1881 Hsf1 and spindle pole body duplication ... 1 phase (Fig. 1A). The rest of
the population was arrested with a long elongated bud in S/G 2 phases. ...
Cited by 18 - Web Search - jcs.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Induction of HSF1 expression is associated with sporadic colorectal cancer
C Hui, S Zheng, YM Fang, Q Dong, H Cen, XP Tang - wjgnet.com
... 1, c-fos Stress signaling pathway c-myc, ATF-2, c-fos, p53, hsf1, hsp90, hsp27 ... a
patient (patient 1) was used to perform gene array analysis and the rest of 35 ...
Cached - Web Search - wjgnet.com
Induction of HSF1 expression is associated with sporadic colorectal cancer - Full text - MIT Libraries
H Cen, S Zheng, YM Fang, XP Tang, Q Dong - World J Gastroenterol, 2004 - wjgnet.com
... 1, c-fos Stress signaling pathway c-myc, ATF-2, c-fos, p53, hsf1, hsp90, hsp27 ... a
patient (patient 1) was used to perform gene array analysis and the rest of 35 ...
View as HTML - Web Search - wjgnet.com - wjgnet.com - ncbi.nlm.nih.gov - all 5 versions »
The regulatory domain of human heat shock factor 1 is sufficient to sense heat stress - Full text - MIT Libraries
EM Newton, U Knauf, M Green, RE Kingston - Mol. Cell. Biol, 1996 - mcb.asm.org
... demonstrated that the regulatory domain of HSF1 has both repression and heat induction
activity when isolated from the rest of the HSF1 protein, confirming ...
Cited by 59 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Attenuated HSP 70 response in skeletal muscle of aged rats following contractile activity - Full text - MIT Libraries
A Vasilaki, MJ Jackson, A McArdle - Muscle & Nerve, 2002 - doi.wiley.com
... the recent data from Locke, 16 who demonstrated that activation of HSF1 and subsequent ...
content of gastrocnemius muscle from adult and aged rats at rest and at ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Mapping of quantitative trait loci (QTL) of differential stress gene expression in rat recombinant …
P Dumas, Y Sun, G Corbeil, S Tremblay, Z Pausova, … - J Hypertens, 2000 - jhypertension.com
... standardized 1 h immobilization stress, followed by 1 h of rest to allow ... The sense
primer was HSF1-1419 (GACAAGACAGTTGGGTAGTC) and the antisense primer was HSF1 ...
Cited by 10 - Web Search - jhypertension.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Lowered Temperature Set Point for Activation of the Cellular Stress Response in T-lymphocytes - Full text - MIT Libraries
LQ Gothard, ME Ruffner, JG Woodward, OK Park-Sarge … - J Biol Chem, 2003 - jbc.org
... Interestingly, the lowered temperature threshold for HSF1 activation is exhibited
by T-cells ... 15 min and then remained at that temperature for the rest of the ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
Exercise-induced oxidative stress and muscle stress protein responses in trotters - Full text - MIT Libraries
S Kinnunen, S Hyyppae, J Lappalainen, N Oksala, M … - Eur J Appl Physiol, 2004 - springerlink.com
... Alexis, San Diego, Calif.) was used for the detection of heat shock factor-1 (HSF1). ...
Pre-stage Rest – 0.62 (0.04) 1.7 Walk 10 Not measured 4.2 Slow trot 15 ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
A novel heat shock response in prolactin-dependent Nb 2 node lymphoma cells. - Full text - MIT Libraries
MJ Blake, AR Buckley, M Zhang, DJ Buckley, KP … - J Biol Chem, 1995 - jbc.org
... This apparent degradation intensified throughout the rest of the treatment. In contrast,
HSF1 in heat-stressed Nb2-SFJCD1 cells did not appear to suffer the ...
Cited by 2 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Obesity is associated with increased myocardial oxidative stress - Full text - MIT Libraries
HK Vincent, SK Powers, DJ Stewart, RA Shanely, H … - International Journal of Obesity, 1999 - nature.com
... resting values, and blood pressures at least 30% greater than at rest) can up ... due
to inactivation of transcription factors (such as heat shock factor 1 (HSF1)). ...
Cited by 20 - Web Search - nature.com - ncbi.nlm.nih.gov
Artificial recruitment of certain Mediator components affects requirement of basal transcription … - Full text - MIT Libraries
H Sakurai, T Fukasawa - Genes to Cells, 2003 - genestocellsonline.org
... yeast also lacks Med2, Pgd1 and Gal11, suggesting that association of the subcomplex
with the rest of the ... Role of Hsf1 in TFIIE-independent activation of CUP1 ...
Cited by 1 - Web Search - blackwell-synergy.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Reperfusion but Not Acute Ischemia in Pig Small Intestine Induces Transcriptionally Mediated Heat …
NKJ Oksala, K Kaarniranta, JJ Tenhunen, R Tiihonen … - European Surgical Research, 2002 - content.karger.com
... HSF1 becomes activated, which is characterized by trimerization of HSF1 monomers,
translocation of ... stabilization period and every 30 min during the rest of the ...
Cited by 2 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Transcriptional activation in chondrocytes submitted to hydrostatic pressure
R Sironen, M Elo, K Kaarniranta, HJ Helminen, MJ … - Biorheology, 2000 - iospress.metapress.com
... in electrophoretic mobility shift assay, no hyperphosphorylation nor trimerization
of HSF1 (events needed for ... of the gene and to find whether the rest of the ...
Cited by 13 - Web Search - ingentaconnect.com - uku.fi - ncbi.nlm.nih.gov - Get it from MIT Libraries
Thermotolerant Cells Show an Attenuated Expression of Hsp 70 after Heat Shock - Full text - MIT Libraries
NG Theodorakis, D Drujan, A De Maio… - J Biol Chem, 1999 - jbc.org
... Hsp70 has been found associated with HSF1, suggesting that Hsp70 may autoregulate
its own ... and fluorography (A). Total RNA was isolated from the rest of the ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Randomized, Prospective, Placebo-Controlled Double-Blind Study of Dextrose Prolotherapy for …
KD Reeves, K Hassanein - Journal of Alternative and Complementary Medicine, 2000 - dx.doi.org
... Outcome Measures: One-hundred millimeter (100 mm) Visual Analogue Scale (VAS) for
pain at rest, pain with joint movement and pain with grip, and goniometrically ...
Cited by 9 - Web Search - liebertonline.com - integrativemedicineresearchonline.com - drreevesonline.com - all 7 versions »
Activation and regulation of Hsp 32 and Hsp 70 - Full text - MIT Libraries
KM Stuhlmeier - European Journal of Biochemistry, 2000 - content.febsjournal.org
... inducible form of Hsp70) as well as anti-(heat shock factor 1) (HSF1) IgG were ... hours
following this procedure, medium was changed and EC allowed to rest for an ...
Cited by 14 - Cached - Web Search - ejbiochem.org - blackwell-synergy.com - ncbi.nlm.nih.gov - all 6 versions »
The DNA-binding Domain of Yeast Heat Shock Transcription Factor Independently Regulates Both the N- … - Full text - MIT Libraries
AL Bulman, ST Hubl, HCM Nelson - J Biol Chem, 2001 - jbc.org
... allow viability (25), the transformant was cured of the pGAL1-HSF1 URA3-based ... The
rest of the mutants have increased either constitutive or induced levels of ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov
Mutant small heat-shock protein 27 causes axonal Charcot-Marie-Tooth disease and distal hereditary … - Full text - MIT Libraries
OV Evgrafov, I Mersiyanova, J Irobi, L Van Den … - Nature Genetics, 2004 - nature.com
... | PubMed | ISI | ChemPort |; Fontaine, JM, Rest, JS, Welsh ... for induction of the stress
response in motor neurons is associated with failure to activate HSF1. ...
Cited by 27 - Web Search - nature.com - ncbi.nlm.nih.gov - origin.www.nature.com - all 5 versions »
Sulfadoxine-pyrimethamine for uncomplicated falciparum malaria
CV Plowe, JG Kublin, FK Dzinjalamala, DS Kamwendo, … - dx.doi.org
... and in contrast to increasing infant and child mortality in the rest of the region ...
of Maryland School of Medicine, 685 West Baltimore Street, HSF1-480, Baltimore ...
Web Search - bmj.bmjjournals.com - bmj.org
BIOINFORMATICS - Full text - MIT Libraries
M Middendorf, A Kundaje, C Wiggins, Y Freund, C … - BIOINFORMATICS, 2004 - bioinformatics.oupjournals.org
... functions. In Figure 1, we describe Adaboost in these terms. We shall refer
to F(x) as the prediction score in the rest of the paper. The ...
Web Search
Predicting Genetic Regulatory Response Using Classification
M Middendorf, A Kundaje, C Wiggins, Y Freund, C … - Arxiv preprint q-bio.QM/0411028, 2004 - arxiv.org
... We shall refer to F(x) as the prediction score in the rest of the ... eral stress response
target genes [4]. The other high scoring motifs include HSF1 (heat-shock ...
Cited by 10 - View as HTML - Web Search - cs.princeton.edu - math.biu.ac.il - cs.utsa.edu - all 14 versions »
In vivo growth of a murine lymphoma cell line alters regulation of expression of HSP72 - Full text - MIT Libraries
S Davidson, P Hoj, T Gabriele, RL Anderson - Mol Cell Biol, 1995 - mcb.asm.org
... to be phosphorylated after heat shock to the same extent as HSF1 from CH12 ... of the
spectrum (region 1) were collected as CH1 cells, and the rest were designated ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Heat shock and the role of the HSPs during neural plate induction in early mammalian CNS and brain … - Full text - MIT Libraries
D Walsh, Z Li, Y Wu, K Nagata - Cell Mol Life Sci, 1997 - springerlink.com
... During neuroectoderm differentiation the activation of HSF1 and 2 appears to correlate
with high ... culture period to 40, 40.5 or 41 °C, and for the rest of the ...
Cited by 23 - Web Search - ncbi.nlm.nih.gov
Dual regulation of a heat shock promoter during embryogenesis: stage-dependent role of heat shock … - Full text - MIT Libraries
C Almoguera, P Prieto-Dapena, J Jordano - The Plant Journal, 1998 - blackwell-synergy.com
... a protein extract obtained from E. coli BL21 cells expressing human HSF1 from plasmid ...
The DNA fragment with the rest of the chimeric gene was gel purified and ...
Cited by 19 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com
Kinetic Role for Mammalian SF 1/BBP in Spliceosome Assembly and Function after Polypyrimidine Tract … - Full text - MIT Libraries
S Guth, J Valcarcel - J Biol Chem, 2000 - jbc.org
... 1A, lane 4) nor by two additional antisera generated against hSF1-C4 or the amino ...
extracts was arbitrarily set to 1000 arbitrary scan units, and the rest of the ...
Cited by 13 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov
Cadmium Toxicity and Cell Stress Response - Full text - MIT Libraries
AA Al-Khedhairy, SA Al-Rokayan, FA Al-Misned, S … - The Sciences, 2001 - ansinet.org
... of the body burden of cadmium is present in the kidneys and the rest is distributed ...
Like HSF1, this factor is activated by stress under different conditions. ...
Cited by 1 - View as HTML - Web Search - ansinet.org - ansinet.org - ansinet.org
Molecular Chaperones and Their Roles in Neural Cell Differentiation
V Calabrese, G Scapagnini, A Ravagna, AM Giuffrida … - Developmental Neuroscience, 2002 - content.karger.com
... such as MyoD [39] or single-minded proteins [40], HSF1 and a ... The transformation of
‘rest- ing’ astrocytes to their ‘reactive’ form is characterized by ...
Cited by 10 - Web Search - content.karger.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Mathematical modeling of the eukaryotic heat shock response: Dynamics of the hsp70 promoter
C To, PV Hatzimanikatis - Office - biophysj.org
... characteristic time scale of the rest of the reactions, including hsp70 mRNA
half-life. Assumption 5. HSF1 is present in excess compared to the HSEs ([HSF ...
Web Search - systemsbiology.northwestern.edu - Get it from MIT Libraries
A novel hnRNP protein (HAP/SAF-B) enters a subset of hnRNP complexes and relocates in nuclear … - Full text - MIT Libraries
F Weighardt, F Cobianchi, L Cartegni, I Chiodi, A … - J. Cell Sci, 1999 - jcs.biologists.org
... a transcription- dependent recruitment of HAP to a few large nuclear granules that
exactly coincide with sites of accumulation of Heat Shock Factor 1 (HSF1). ...
Cited by 37 - Web Search - jcs.biologists.org - elib.tiho-hannover.de - ncbi.nlm.nih.gov - all 5 versions »
Elevation of the Hsp 70 chaperone does not effect toxicity in mouse models of familial amyotrophic … - Full text - MIT Libraries
J Liu, LA Shinobu, CM Ward, D Young, DW Cleveland - Journal of Neurochemistry, 2005 - blackwell-synergy.com
... recently, treatment with arimoclomol, a coinducer of heat shock factor 1 (Hsf1),
a transcription ... conducted for each mouse with at least a 5-min rest in between ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
A Plant Small Heat Shock Protein Gene Expressed during Zygotic Embryogenesis but Noninducible by … - Full text - MIT Libraries
R Carranco, C Almoguera, J Jordano - J Biol Chem, 1997 - jbc.org
... and 2 µg of a protein extract, obtained from Escherichia coli BL21 cells expressing
human HSF1 from plasmid ... The rest of the symbols are as in the legend of Fig ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov
EPITOPE TAGGING - Full text - MIT Libraries
JW Jarvik, CA Telmer - Annual Review of Genetics, 1998 - genet.annualreviews.org
... external loops or at termini where they do not greatly perturb the rest of the ...
Stress-induced HSF1 granules in the nucleus were discovered using tagged HSF1 (13 ...
Cited by 40 - Web Search - genet.annualreviews.org - ncbi.nlm.nih.gov
MAP kinase pathways: molecular plug-and-play chips for the cell
I Meskiene, H Hirt - Plant Mol. Biol, 2000 - kluweronline.com
... Allowing cells to rest for 1 hour abolishes SAMK activity, and shaking re- stores ...
of heat shock genes by the human transcription fac- tor Hsf1 is repressed by ...
Cited by 42 - Web Search - ingentaconnect.com - univie.ac.at - at.embnet.org - all 7 versions »
Mathematical Modeling of the Eukaryotic Heat-Shock Response: Dynamics of the hsp70 Promoter
TR Rieger, RI Morimoto, V Hatzimanikatis - Biophys J, in press - biophysj.org
... ie, their half-life is longer than characteristic timescale of the rest of the
reactions, including hsp70 mRNA half-life. Assumption 5. HSF1 is present in ...
Cited by 1 - Web Search - biophysj.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Exercise training modulates heat shock protein response in diabetic rats - Full text - MIT Libraries
M Atalay, NKJ Oksala, DE Laaksonen, S Khanna, C … - J Appl Physiol, 2004 - jap.physiology.org
... After the 8-week period of endurance exercise training, all the rats were killed
at rest ... in SID rats at rest compared to non-diabetic rats (Figs. 1a and 1b). ...
Cited by 2 - Web Search - jap.org - dx.doi.org - ncbi.nlm.nih.gov - all 8 versions »
Transcriptional targets of the chromatin-remodelling factor SMARCA 4/BRG 1 in lung cancer cells - Full text - MIT Libraries
PP Medina, J Carretero, E Ballestar, B Angulo, F … - Human Molecular Genetics, 2005 - hmg.oxfordjournals.org
... stimulating factor 1 (CSF1) (20 ), heat shock factor 1 (HSF1) (21 ), E2F1 ... 43 upregulated
transcripts corresponded to known genes, whereas the rest were ESTs ...
Web Search - hmg.oupjournals.org - hmg.oupjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Properties of Binary Vector Dissimilarity Measures
B Zhang, SN Srihari - Proc. JCIS Int’l Conf. Computer Vision, Pattern …, 2003 - cedar.buffalo.edu
... In the rest of the paper, any dissimilarity measure men- tioned refers to the ...
512-dimensional binary feature vectors from the im- ages in NIST hsf1 data set. ...
Cited by 1 - View as HTML - Web Search - cedar.buffalo.edu
The role of heat shock proteins in reproduction - Full text - MIT Libraries
A Neuer, SD Spandorfer, P Giraldo, S Dieterle, Z … - Human Reproduction Update, 2000 - humupd.oupjournals.org
... The relative abundance of HSF1 is correlated with the high amount of HSP70 gene ... The
rest were grown in an endometrial co- culture (ECC) system in addition to ...
Cited by 22 - Web Search - ingentaconnect.com - oup.co.uk - ncbi.nlm.nih.gov - all 6 versions »
Protein-damaging stresses activate c-Jun N-terminal kinase via inhibition of its dephosphorylation: … - Full text - MIT Libraries
AB Meriin, JA Yaglom, VL Gabai, L Zon, S Ganiatsas … - Mol Cell Biol, 1999 - mcb.asm.org
... exposed to UV (400 J/m 2 ) followed by a 15-min rest or to ... Overexpression of
Hsp-70 inhibits the phosphorylation of HSF1 by activating protein phosphatase and ...
Cited by 81 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Modeling the Combinatorial Functions of Multiple Transcription Factors
CH Yeang, T Jaakkola - springerlink.com
... 10]. This approach, though more reliable, is also expensive and time-consuming.
The rest of the paper is organized as follows. We ...
Web Search
A Seed-specific Heat-shock Transcription Factor Involved in Developmental Regulation during … - Full text - MIT Libraries
C Almoguera, A Rojas, J Diaz-Martin, P Prieto- … - J Biol Chem, 2002 - jbc.org
... In vertebrate systems, three different HSFs (HSF1, HSF2, and HSF3) have ubiquitous
expression patterns (for ... from pCR R 4-TOPO R ::HSFA9-5' with the rest of the ...
Cited by 4 - Web Search - genetics.biol.ttu.edu - jbc.org - ncbi.nlm.nih.gov
Pathways for protection from noise-induced hearing loss
CG Le Prell, DF Dolan, J Schacht, JM Miller, MI … - Noise Health, 2003 - ingentaconnect.com
... the floor of the fourth ventricle and innervate the contralateral cochlea, while
the rest project to ... They found differences in Hsf1 versus caspase 3 activation ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Changes in skeletal muscle heat shock proteins: pathological significance
Y Liu, JM Steinacker - Front Biosci, 2001 - xylian.igh.cnrs.fr
... that other mechanisms may additionally control the oligomeric transition of HSF1
(95). ... stage III, in which the muscle suffers from ischemia at rest but remains ...
Cited by 21 - Cached - Web Search - ncbi.nlm.nih.gov - bioscience.org - bioscience.org - all 7 versions » - Get it from MIT Libraries
Modulation of Drosophila heat shock transcription factor activity by the molecular chaperone DROJ 1 - Full text - MIT Libraries
G Marchler, C Wu - The EMBO Journal, 2001 - embojournal.npgjournals.com
... and to some extent HSP40 have been implicated in feedback repression of human HSF1
(Abravaya et ... an aliquot was taken (hs–, lanes 1 and 3) and the rest of the ...
Cited by 16 - Web Search - nature.com - emboj.org - bioweb.usc.edu - all 8 versions »
Negative information for motif discovery
KT Takusagawa, D Gifford - Master’s project, Massachusetts Institute of Technology, …, 2003 - psrg.lcs.mit.edu
... GCN4 TGACTCA GCR1 CTTTCC HAP2 CCAATNA HAP3 CCAATNA HAP4 CCAATNA HSF1 GAANNTTTCNNGAA
INO2 ... 10 • Number of candidate motifs for scanning the rest sequences: 20 ...
Cited by 3 - View as HTML - Web Search - helix-web.stanford.edu - www-smi.stanford.edu - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Myocardial protection conferred by electromagnetic fields - Full text - MIT Libraries
AL DiCarlo, JM Farrell, TA Litovitz - Circulation, 1999 - circ.ahajournals.org
... Hz EM fields for 20 minutes followed by a 1-hour rest period before ... embryo fibroblasts,
temperature elevations of at least 2°C are required to activate HSF1. ...
Cited by 12 - Web Search - ahavj.ahajournals.org - circ.ahajournals.org - ncbi.nlm.nih.gov - all 5 versions »
Cells Preconditioned with Mild, Transient UVA Irradiation Acquire Resistance to Oxidative Stress and … - Full text - MIT Libraries
Y Yang, A Sharma, R Sharma, B Patrick, SS Singhal, … - J. Biol. Chem, 2003 - jbc.org
... preconditioned with UVA exposure for 5 min and were allowed to rest in normal ... the
expression of HSP70 through its interaction with heat shock factor (HSF1) (42 ...
Cited by 7 - Web Search - dx.doi.org - ijmm.org - ncbi.nlm.nih.gov - all 6 versions »
Enhancement of In Vitro hsp 72 Expression by Placental IL-6 - Full text - MIT Libraries
S MIRANDA, T GENTILE, R MARGNI - American Journal Of Reproductive Immunology, 2001 - blackwell-synergy.com
... Dead and nonadherent cells were removed and the rest (viability\95%) were resus ... that
IL-6 induced activation of HSF1-DNA binding and HSP70 expression in ...
Cited by 1 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Emerging Therapeutic Targets
M Tytell, PL Hooper - dx.doi.org
... of the photoreceptors contain readily detectable levels of Hsp70, whereas the rest
of the ... heat shock factor (Hsf), of which there are two forms, Hsf1 and Hsf2 ...
Web Search - ingentaconnect.com - ashley-pub.com - ashley-pub.com
Sed 1 p and Srl 1 p are required to compensate for cell wall instability in Saccharomyces cerevisiae … - Full text - MIT Libraries
I Hagen, M Ecker, A Lagorce, JM Francois, S Sestak … - Molecular Microbiology, 2004 - blackwell-synergy.com
... expected to remain attached to the plasma membrane, and the rest are thought ... of the
transcription factors encoded by RLM1, CRZ1, MSN2/4 and HSF1; however, none ...
Web Search - ingentaconnect.com - dkfz.de - dkfz-heidelberg.de - all 5 versions »
| |
©2005 Google