![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 132 for IRF1 and SP1. (0.09 seconds) |
The Tumor Suppressor Interferon Regulatory Factor 1 Interferes with SP 1 Activation to Repress the … - Full text - MIT Libraries
RL Xie, S Gupta, A Miele, D Shiffman, JL Stein, GS … - J Biol Chem, 2003 - jbc.org
... activation through the SP1 element. We co-expressed IRF1 and SP1 together
with the wild type or mutant –68/CDK2 promoter (Fig. ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Oligo GEArray® Human JAK/STAT Signaling Pathway Microarray
I Response, S Conditions - search.cosmobio.co.jp
... Transcriptional activator activity: SMAD1, SMAD5, SP1. Other transcription factors
and regulators: CEBPB, CRK, GATA3, IRF1, ISGF3G, JUN, MCM5, MYC, NFKB1, NMI ...
View as HTML - Web Search
The exonuclease ISG20 is directly induced by synthetic dsRNA via NF-jB and IRF1 activation - Full text - MIT Libraries
MK Chelbi-Alix, N Mechti, C Gongora - Oncogene, 2004 - nature.com
... binding of IRF1 to a specific ISRE on the Isg20 promoter. Moreover, the TATA-less
Isg20 promoter contains one E-box and putative NF-kB and Sp1 binding sites ...
Web Search
Oligo GEArray® Mouse JAK/STAT Signaling Pathway Microarray
I Response, S Conditions - search.cosmobio.co.jp
... Isgf3g, Junb, Mcm5, Myc, Nr3c1, Sfpi1, Smad5, Smad6, Smad7, Smad9, Sp1, Usf1, Yy1
Genes Induced by STAT Proteins: Stat1: C2ta, Cxcl9, Indo, Irf1, Nos2 Stat3 ...
View as HTML - Web Search
Identification of a Novel Transcriptional Regulatory Element Common to the p 53 and Interferon … - Full text - MIT Libraries
C Lallemand, M Bayat-Sarmadi, B Blanchard, MG … - J Biol Chem, 1997 - jbc.org
... p53 promoter (27), and the IRF1 promoter contains several SP1 sites which could
be responsible at least in part for the basal activity of the IRF1 gene (15, 28 ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov
GEArray Q Series Human JAK/STAT Signaling Pathway Gene Array:
FG Grouping - eurogentec.be
... NCOA1, NFKB1, NMI, SH2B, SP1, SPI1 (PU.1), SRC, STAM, STUB1 (StIP1), USF1, YY1.
Genes induced by Stat proteins: Stat1: CXCL9 (MIG), INDO, IRF1, MHC2TA (CIITA ...
View as HTML - Web Search - eurogentec.com
GEArray Q Series Mouse JAK/STAT Signaling Pathway Gene Array: AR-SAMM-039
FG Grouping - eurogentec.com
... Sfpi1 (PU.1), Sh2bpsm1, Sp1, Src, Stam, Stub1 (StIP1), Usf1, Yy1. Genes induced
by Stat proteins: Stat1: C2ta (CIITA), Cxcl9 (MIG), Indo, Irf1, Nos2 (iNOS). ...
View as HTML - Web Search - eurogentec.be
Biology and functions of human leukocyte antigen-G in health and sickness - Full text - MIT Libraries
C Menier, J McCluskey, ED Carosella - Tissue Antigens, 2003 - ingentaconnect.com
... κB2 κB1 ISRE W/S X1 X2 Y CCAAT TCTAAA Basal transcriptional complex p50 p50 Sp1
Sp1 HSE HSF1 –480 GAS ISRE IRF1 –732 –746 –121 –220 –1185 –1438 ...
Web Search - www-dsv.cea.fr
Aging-related Deficiency of CD 28 Expression in CD 4+ T Cells Is Associated with the Loss of Gene- … - Full text - MIT Libraries
AN Vallejo, AR Nestel, M Schirmer, CM Weyand, JJ … - J Biol Chem, 1998 - jbc.org
... Fig. 6 and data not shown). Among the sequences examined were nuclear factor
B, STAT1 , IRF1, and SP1 (33). As indicated in Fig. ...
Cited by 51 - Web Search - jbc.org - ncbi.nlm.nih.gov
Transcriptional Response of T Cells to IFN-: Changes Induced in IFN--Sensitive and Resistant …
L Tracey, I Spiteri, P Ortiz, M Lawler, MA Piris, … - Journal of Interferon & Cytokine Research, 2004 - dx.doi.org
... Resistance to IFN-a appears to be associated with failure to induce IRF1 and IRF7
and deregulation of the apoptotic signals of HSXIAPAF1, TRADD, BAD, and BNIP3 ...
Cited by 2 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... AP1 TCF11 633.5 Oct-1 TST1 130.1 AHRARNT WHN 49.4 AHRARNT SP1 25.7 ... Oct-1
PBX1 573.9 IRF1 NFAT 125.3 CEBP FREAC2 46.5 CEBP ETS2 25.0 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
The interferon(IFN)-stimulated gene Sp 100 promoter contains an IFN-gamma activation site and an … - Full text - MIT Libraries
T Groetzinger, K Jensen, H Will - J Biol Chem, 1996 - jbc.org
... initiation is controlled by the transcription factors HIP1 and Sp1, similar as
described for promoters of several housekeeping genes, the ISGF2/IRF1 gene, and ...
Cited by 15 - Web Search - jbc.org
Functional promoter modules can be detected by formal models independent of overall nucleotide … - Full text - MIT Libraries
A Klingenhoff, K Frech, K Quandt, T Werner - Bioinformatics, 1999 - bioinformatics.oupjournals.org
... after viral infection in brain might be regulated by this common NFκB/IRF1 module ...
the rat CYP2D5 gene and requiring cooperativity between C/EBP-b and Sp1 factor ...
Cited by 73 - Web Search - bioinformatics.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
HLA-G Transactivation by cAMP-response Element-binding Protein (CREB) - Full text - MIT Libraries
SJP Gobin, P Biesta, JEM de Steenwinkel, G Datema, … - J. Biol. Chem, 2002 - jbc.org
... been found to bind also Sp1 (15). The directly flanking and downstream positioned
ISRE region is partly deleted and has no binding affinity for IRF1, IRF2, p48 ...
Cited by 8 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
GEArray S Series Human Immunology Signaling Pathways Gene Array: AR-SAHS-605
FG Grouping, A Molecules, I ICAM, CS Molecules, C … - eurogentec.com
... NIP45), FOS, FOSL1, FOXO1A, FOXO3A, GATA3, GATA4, GRLF1, ICOS, IRF1, ISGF3G, JUN ...
MYF5, NFKB2, NFKBIB, NFKBIE, NR4A2, PCNA, RAF1, RELA, RPS6KA5, SP1, SP3, TP53. ...
View as HTML - Web Search - eurogentec.be
Viral interferon regulatory factor 1 of Kaposi's sarcoma-associated herpesvirus binds to p53 and … - Full text - MIT Libraries
T Seo, J Park, D Lee, SG Hwang, J Choe - J Virol, 2001 - jvi.asm.org
... transfection assays, vIRF1 represses cellular interferon- and IRF1-mediated
transcriptional ... p53 expression plasmid (0.5 µg) or a Gal4-SP1 expression plasmid ...
Cited by 11 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Organization and Functional Analysis of the Mouse Transporter Associated with Antigen Processing 2 … - Full text - MIT Libraries
E Arons, V Kunin, C Schechter, R Ehrlich - J. Immunol, 2001 - jimmunol.org
... binding to IRF1. However, while the activity of the human TAP1 (as well as of the
human LMP2 gene) promoter is assisted by factors binding to the NF- B and Sp1 ...
Cited by 7 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Through Inactivation of Interferon Regulatory Factor 3 in HepG2 Cells - Full text - MIT Libraries
K Hisaeda, A Inokuchi, T Nakamura, Y Iwamoto, K … - Hepatology, 2004 - doi.wiley.com
... Anti-IRF1-4, 7-9, Sp1, and RXR antibodies were added to the nuclear extracts. A
50-fold excess of the unlabeled oligonucleotide was added for the competition. ...
Web Search - ncbi.nlm.nih.gov
Identification of cis-acting elements that can obviate a requirement for the C-terminal domain of … - Full text - MIT Libraries
AB Buermeyer, LA Strasheim, SL McMahon, PJ Farnham - J Biol Chem, 1995 - jbc.org
... However, we have identified promoters (rep-3b and Irf1) that lack an apparent TATA ...
The Sp1 site located at -41 was excluded from our analysis since both the ...
Cited by 8 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cloning and functional analyses of the mouse tapasin promoter - Full text - MIT Libraries
F Herrmann, J Trowsdale, C Huber, B Seliger - Immunogenetics, 2003 - springerlink.com
... the various tapasin deletion mutants suggests the involvement of NF-kB, SP1, E2F
and ... The importance of the IRF1/2 for IFN-g inducibility was further confirmed ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
MatInspector and beyond: promoter analysis based on transcription factor binding sites - Full text - MIT Libraries
K Cartharius, K Frech, K Grote, B Klocke, M … - Bioinformatics, 2005 - bioinformatics.oxfordjournals.org
... is IRF1 for both matches, but this does not mean that only IRF1 can bind to ... When
searching Sp1 binding sites in the murine PHGPx (Gpx4: glutathione peroxidase 4 ...
Web Search - bioinformatics.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Stat1 is induced and activated by all-trans retinoic acid in acute promyelocytic leukemia cells - Full text - MIT Libraries
M Gianni, M Terao, I Fortino, M LiCalzi, V … - Blood, 1997 - bloodjournal.org
... for EMSA: -5'CCTGATTTCCCCGAAATGATG3' corresponding to nucleotide -130/-110 of the
IRF1 gene promoter ... virus-1 (HIV-1) long-terminal repeat, containing a Sp1 site ...
Cited by 50 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Bioinformatics of transcription control
T Werner - iubio.bio.indiana.edu
... IRF1 site site IRF1 High score / Low score ... Tutorial regulatory sequences E2F HEPA
SP1 CAAT TATA Histone H1 promoters share a common basic framework of TF/sites ...
View as HTML - Web Search - iubio.bio.indiana.edu
HLA-G unique promoter region: functional implications - Full text - MIT Libraries
C Solier, VE Mallet, FE Lenfant, A Bertrand, A … - Immunogenetics, 2001 - springerlink.com
... The cis-regulatory ele- ments are enhancer A bound by NF-κB and/or Sp1 factors
(in blue), the ISRE bound by IRF1 (in purple), and the SXY com- prising the S ...
Cited by 12 - Web Search - ncbi.nlm.nih.gov
Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression - Full text - MIT Libraries
DR Johnson - The Journal of Immunology, 2003 - jimmunol.org
... B, IRF1 and IRF2 drive the expression of HLA-B and -C, but not -A, promoters. ...
Sp1-driven luciferase activity was not altered by NF- B coexpression. ...
Cited by 4 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Interferons Inhibit Tumor Necrosis Factor-alpha-mediated Matrix Metalloproteinase-9 Activation via … - Full text - MIT Libraries
J Sanceau, DD Boyd, M Seiki, B Bauvois - J Biol Chem, 2002 - jbc.org
... Experimental Procedures." The empty vector and the purified Sp1 protein were ... of
increasing quantities of recombinant proteins (p50, p65, or IRF1) as described ...
Cited by 21 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[CITATION] VCAM-1 mRNA induction and transcription factor activation in human endothelial cells
M Umetani, T Kodama
Web Search
Genomic Organization of the Human Adipocyte-Derived Leucine Aminopeptidase Gene and Its Relationship … - Full text - MIT Libraries
A Hattori, K Matsumoto, S Mizutani, M Tsujimoto - Journal of Biochemistry - jb.bcasj.or.jp
... On the other hand, several potential transcription factor binding motifs, such as
MZF-1, IRF1/2, C/EBPa/b Sp1, and NF-kB (22, 23), were identified in the ...
Cited by 5 - Cached - Web Search - jb.oupjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
TRANSCRIPTIONAL REGULATION OF T LYMPHOCYTE DEVELOPMENT AND FUNCTION - Full text - MIT Libraries
CT Kuo, JM Leiden - Annual Review of Immunology, 1999 - immunol.annualreviews.org
... Recent bone marrow transplant experiments have shown that IRF1 promotes NK ... domains
of several other mammalian transcription factors, including Sp1, BETB2, and ...
Cited by 125 - Web Search - immunol.annualreviews.org - ncbi.nlm.nih.gov
Histone modification enzymes: novel targets for cancer drugs
R Kristeleit, L Stimson, P Workman, W Aherne - Expert Opinion on Emerging Drugs, 2004 - dx.doi.org
... H2A, H2B, H3, H4 H2A, H2B, H3, H4 Co-activators p53, c-myb, NF-κB, HMG1, HMG14,
GATA1, EKLF, ACTR, SRC1, TIF2, AML1, TFIIE, TFIIF, IRF1, IRF2, SP1, MLL, MOZ ...
Web Search - extenza-eps.com - ashley-pub.com - ingentaconnect.com - all 8 versions »
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Elk1, Elk3, Fkbp1b, Fos, Fosb, Fosl1, Fosl2, Gata3, Gata4, Icos, Irf1, Jun, Junb ...
Nfkbie, Nfkbil1, P300-ESTs, Raf1, Rel, Rela, Relb, Runx1, Runx2, Sp1, Sp3, Srf ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... NIP45), FOS, FOSL1, FOSL2, FOXP3, GATA3, GATA4, GRLF1, ICOS, IRF1, JUN, JUNB ... NFKBIE,
NFKBIL1, NFKBIL2, NFRKB, RAF1, REL, RELA, RELB, RUNX1, RUNX2, SP1, SP3, SRF ...
View as HTML - Web Search - eurogentec.com
The Epstein-Barr virus major latent promoter Qp is constitutively active, hypomethylated, and … - Full text - MIT Libraries
Q Tao, KD Robertson, A Manns, A Hildesheim, RF … - J. Virol, 1998 - jvi.asm.org
... Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of ...
Epstein-Barr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and IRF2 ...
Cited by 21 - Web Search - pubmedcentral.nih.gov - dceg2.cancer.gov - dceg.cancer.gov - all 7 versions »
Interferon enhances tumor necrosis factor-induced vascular cell adhesion molecule 1 (CD106) … - Full text - MIT Libraries
S Lechleitner, J Gille, DR Johnson, P Petzelbauer - J Exp Med, 1998 - jem.org
... Sp1 is a component of the cytokine-inducible enhancer in the promoter of vascular
cell ... Two factors, IRF1 and KBF1/NF-kappa B, cooperate during induction of MHC ...
Cited by 25 - Web Search - jem.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Validating computer programs for functional genomics in gene regulatory regions
L Florea, M Li, C Riemer, B Giardine, W Miller, R … - Current Genomics, 2000 - ingentaconnect.com
... sites indistinguishable from the rest of the alignment (eg, APOA4, WT1, IRF1, OB,
MHC2 ... 265 in both mouse and human and common binding sites for Sp1 near -240 ...
Cited by 6 - Web Search
Autoregulation of the Stat 3 Gene through Cooperation with a cAMP-responsive Element-binding Protein - Full text - MIT Libraries
M Ichiba, K Nakajima, Y Yamanaka, N Kiuchi, T … - J Biol Chem, 1998 - jbc.org
... The STAT1 homodimer has been shown to make a complex with Sp1 for the interferon-
response ... repression of c-myb and c-myc, the induction of junB and IRF1, and IL ...
Cited by 35 - Web Search - jbc.org - ncbi.nlm.nih.gov
BIOINFORMATICS ORIGINAL PAPER
SW Cole, W Yan, Z Galic, J Arevalo, JA Zack - bioinformatics.oxfordjournals.org
... eg Oct1, V$OCT1_Q6: 0.930-fold change, z = −0.11, p = 0.918; Sp1, V$SP1_Q6 ... sometimes
yielded no results at all with short promoter sequences (eg IRF1 Figure 2B ...
Web Search
HOW CELLS RESPOND TO INTERFERONS - Full text - MIT Libraries
GR Stark, IM Kerr, BRG Williams, RH Silverman, RD … - Annual Review of Biochemistry, 1998 - dx.doi.org
... by IFN depends on the interaction of STAT1 and the transcription factor Sp1, which
occurs ... the expression of a minority of ISGs, such as the IRF1 gene, through ...
Cited by 1086 - Web Search - soc.annualreviews.org - immune.med.utoronto.ca - ncbi.nlm.nih.gov - all 7 versions »
STAT proteins and transcriptional responses to extracellular signals - Full text - MIT Libraries
CM Horvath - Trends Biochem Sci, 2000 - chosun.ac.kr
... 6 eg c-fos SIE FcγR GRR β -Cas PIE IRF1 GAS N N C C P P Cooperative transcription
regulation (d) Adjacent or composite DNA elements eg STAT1–SP1 STAT5–GR ...
Cited by 93 - View as HTML - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov
Identification of distal silencing elements in the murine interferon-A11 gene promoter - Full text - MIT Libraries
D Janine, G VODJDANI - Biochem. J, 1996 - biochemj.org
... is known for its repressing effect due mostly to competition with IRF1 for binding
to ... tk promoter by direct interaction with the activators (eg Sp1) or with ...
Cited by 5 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Novel interferon regulatory factor-1 polymorphisms in a Kenyan population revealed by complete gene … - Full text - MIT Libraries
H Ji, TB Ball, J Kimani, FA Plummer - Journal of Human Genetics, 2004 - springerlink.com
Page 1. ORIGINAL ARTICLE Hezhao Ji Æ Terry Blake Ball Æ Joshua Kimani Francis
Allan Plummer Novel interferon regulatory factor-1 polymorphisms ...
Web Search - ncbi.nlm.nih.gov
Mapping of a new quantitative trait locus for resistance to malaria in mice by a comparative mapping … - Full text - MIT Libraries
M Hernandez-Valladares, P Rihet, OK ole-MoiYoi, FA … - Immunogenetics, 2004 - springerlink.com
... 13 (Il-13), inter- feron regulatory factor 1 (Irf1), granulocyte-macrophage ... 1 present
similarities with cofactor required for sp1 transcriptional activation ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Transcriptional activation of the integrated chromatin-associated human immunodeficiency virus type … - Full text - MIT Libraries
A El Kharroubi, G Piras, R Zensen, MA Martin - Mol. Cell. Biol, 1998 - mcb.asm.org
... in the presence of Sp1 (Fig. 5 and 6, KBmt-LTR) or NF- B (Fig. 9B, right) are
responsive to Tat, whereas transcriptional complexes recruited by IRF1 and IRF2 ...
Cited by 42 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Activation of Signal Transducer and Activator of Transcription 1 (STAT1) Is Not Sufficient for the … - Full text - MIT Libraries
OF COMPARISON, M ONCOSTATIN - J. Biol. Chem, 2002 - jbc.org
... three STAT1-dependent gene products examined, namely transporter associated with
antigen processing-1 (TAP1), interferon regulatory factor-1 (IRF1), and class ...
Cited by 11 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Host Defense Responses to Infection by Mycobacterium tuberculosis
Y Qiao, S Prabhakar, EM Coccia, M Weiden, A Canova … - phri.org
... M. tuberculosis Induces IRF1 and a Serine Protease Inhibitor 22378 Page 3. ... M.
tuberculosis Induces IRF1 and a Serine Protease Inhibitor 22379 Page 4. ...
View as HTML - Web Search
Abundant raw material for cis-regulatory evolution in humans - Full text - MIT Libraries
MV Rockman, GA Wray - Mol. Biol. Evol, 2002 - mbe.oupjournals.org
... transcription factors, especially Sp1, and by the occurrence in our data set of
four transcription factors whose cis-regulation is polymorphic (IRF1, PAX3, PAX6 ...
Cited by 65 - Web Search - longitude.weizmann.ac.il - biology.duke.edu - ncbi.nlm.nih.gov - all 8 versions »
Transcription factor binding sites downstream of the human immunodeficiency virus type 1 … - Full text - MIT Libraries
C Van Lint, CA Amella, S Emiliani, M John, T Jie, … - J. Virol, 1997 - jvi.asm.org
... AP3-L/DBF, pLTR AP1 (I,II,III)/AP3-L/DBF, pLTR PS/SP1, and pLTR SP1. ... site for members
of the IFN regulatory factor (IRF) family, which includes IRF1, IRF2, and ...
Cited by 37 - Web Search - jvi.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Transcriptional Regulation of the Bovine Oxytocin Receptor Gene - Full text - MIT Libraries
R Telgmann, RAD Bathgate, S Jaeger, G Tillmann, R … - BIOLOGY OF REPRODUCTION, 2003 - biolreprod.org
... Unless otherwise indicated, cotransfected IRF1 and IRF2 expression plasmids were
applied all ... sequences for general transcription factors such as Sp1 (not shown ...
Web Search - bioone.org - biolreprod.org - ncbi.nlm.nih.gov - all 5 versions »
Expression-based monitoring of transcription factor activity: the TELiS database - Full text - MIT Libraries
SW Cole, W Yan, Z Galic, J Arevalo, JA Zack - Bioinformatics, 2004 - bioinformatics.oupjournals.org
... eg Oct1, V$OCT1_Q6: 0.930-fold change, z = –0.11, p = 0.918; Sp1, V$SP1_Q6 ... sometimes
yielded no results at all with short promoter sequences (eg IRF1 Figure 2B ...
Web Search - telis.ucla.edu - bioinformatics.oupjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Mechanisms of interferon mediated anti-viral resistance
CJ CLARK, JA TRAPANI, RW JOHNSTONE - Curr. Drug Targets Immune Endocr. Metabol. Disord, 2001 - ingentaconnect.com
... that are induced by IFNs are the IRF family of transcription factors (IRF1-7, p48 ...
A complex containing IFI 16 and Sp1 was found in Hela cell nuclear extract by ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
| |
©2005 Google