![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 77 for JUN and KLF4. (0.09 seconds) |
The Kruppel-like transcriptional factors Zf9 and GKLF coactivate the human keratin 4 promoter and … - Full text - MIT Libraries
J Okano, OG Opitz, H Nakagawa, TD Jenkins, SL … - FEBS Lett, 2000 - ingentaconnect.com
... Co-transfection of Zf9 and GKLF/KLF4, which is also a member of the Kruppel-like
factors and expressed in the esophageal squamous epithelium, leads to ...
Cited by 24 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Identification of aberrantly methylated genes in association with adult T-cell leukemia - Full text - MIT Libraries
J Yasunaga, Y Taniguchi, K Nosaka, M Yoshida, Y … - Cancer Res, 2004 - cancerres.aacrjournals.org
... Jun-ichirou Yasunaga 1 , Yuko Taniguchi 1 , Kisato Nosaka 1 , Mika Yoshida 1 , Yorifumi ...
Among these silenced genes, Kruppel-like factor 4 (KLF4) gene is a cell ...
Cited by 6 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
Ectopic expression of Kruppel like factor 4(Klf 4) accelerates formation of the epidermal … - Full text - MIT Libraries
J Jaubert, J Cheng, JA Segre - Development, 2003 - dev.biologists.org
Ectopic expression of Kruppel like factor 4 (Klf4) accelerates formation of the
epidermal permeability barrier. Jean Jaubert , Jun Cheng and Julia A. Segre * ...
Cited by 6 - Web Search - dx.doi.org - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
Geldanamycin treatment inhibits hemorrhage-induced increases in KLF6 and iNOS expression in … - Full text - MIT Libraries
JG Kiang, PD Bowman, BW Wu, N Hampton, AG Kiang, B … - J Appl Physiol, 2004 - jap.org
... and moieties assessed by immunoblotting included c-Fas, 65-kDa nuclear factor- B
(NF- B), c-Jun, KLF4, KLF6, iNOS, HSP70i, HSP90, HIF-1 , phosphotyrosine, and ...
Cited by 4 - Cached - Web Search - jap.physiology.org - intl-jap.physiology.org - ncbi.nlm.nih.gov - all 7 versions »
Gene Expression Signature of Benign Prostatic Hyperplasia RevealedbycDNAMicroarray Analysis
J Luo, T Dunn, C Ewing, J Sauvageot, Y Chen, J … - The Prostate, 2002 - doi.wiley.com
... Jun Luo, 1 Thomas Dunn, 1 Charles Ewing, 1 Jurga Sauvageot, 1 Yidong ... were less commonly
observed and included the transcription factor KLF4, thrombospondin 4 ...
Cited by 22 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
… for the Krueppel-like transcription factor KLF 6 as an inhibitor of c-Jun proto-oncoprotein function - Full text - MIT Libraries
DA Slavin, NP Koritschoner, CC Prieto, FJ Lopez- … - Oncogene, 2004 - nature.com
... Keywords: Krüppel-like; c-Jun; proliferation; TPA/io- nomycin ... proliferation such
as KLF10 (TIEG1), KLF11 (TIEG2) (Cook and Urrutia, 2000), KLF4 (GKLF) (Shie ...
Cited by 1 - Web Search - nature.com - ncbi.nlm.nih.gov
The keratin 19 promoter is potent for cell-specific targeting of genes in transgenic mice
FH Brembeck, J Moffett, TC Wang, AK Rustgi - Gastroenterology, 2001 - ncbi.nlm.nih.gov
2001 Jun;120(7):1720-8 ... Because endogenous K19 protein is transcriptionally regulated
by the Kruppel-like transcription factor 4 (KLF4), we determined the ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Regulation of PKG expression in vascular smooth muscle cells - Full text - MIT Libraries
Y Zeng, RB Pilz - BMC Pharmacology, 2005 - biomedcentral.com
... in the PKG I promoter were required for Rho regulation and bound nuclear proteins
in a cell density-dependent manner, including the Krüppel-like factor 4 (KLF4 ...
Cached - Web Search - biomedcentral.com - citebase.eprints.org
Resuscitation with lactated Ringer solution limits the expression of molecular events associated … - Full text - MIT Libraries
JG Kiang, X Lu, LS Tabaku, TB Bentley, JL Atkins, … - J Appl Physiol, 2005 - jap.physiology.org
... It indicated the order of protein appearance to be c-jun, KLF6, iNOS, HSP70i, and
hypoxia-inducible factor-1 (24). KLF4 (a repressor to iNOS; Ref. ...
Cited by 1 - Web Search - jap.org - jap.org - ncbi.nlm.nih.gov - all 5 versions »
Mouse Sprr locus: a tandem array of coordinately regulated genes - Full text - MIT Libraries
S Patel, T Kartasova, JA Segre - Mammalian Genome, 2003 - springerlink.com
... wild-type skin and upregulated approximately tenfold in the barrier- deficient Klf4)/)
mice ... Conserved binding site for Fos/Jun (AP-1), Oct, Ets and kruppel-like ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
Kruppel-like Factor 4 Abrogates Myocardin-induced Activation of Smooth Muscle Gene Expression - Full text - MIT Libraries
Y Liu, S Sinha, OG McDonald, Y Shang, MH Hoofnagle … - J Biol Chem, 2005 - jbc.org
... in both cases, KLF4 levels increased dramatically with kinetics equivalent to that
observed for immediate early response genes, such as c-fos and c-jun (50). ...
Cited by 1 - Web Search - dx.doi.org - ijmm.org - ncbi.nlm.nih.gov - all 5 versions »
Tetracycline-Regulated Transactivators Driven by the Involucrin Promoter to Achieve Epidermal … - Full text - MIT Libraries
J Jaubert, S Patel, J Cheng, JA Segre - Journal of Investigative Dermatology, 2004 - jidonline.org
... Jean Jaubert , Satyakam Patel , Jun Cheng and Julia A. Segre ... are both sufficient
to activate gene expression and produce phenotypes from our TRE-Klf4 lines. ...
Web Search - blackwell-synergy.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Inducible heat shock protein 70 kD and inducible nitric oxide synthase in hemorrhage/resuscitation- … - Full text - MIT Libraries
JG KIANG, JG Kiang - Cell Research, 2004 - cell-research.com
... also increased at 12 h and continued to increase at 48 h. The sequence of protein
appearance was c-JUN, KLF6, iNOS, HSP-70i, and HIF- 1α. KLF4 (a repressor to ...
View as HTML - Web Search - cell-research.com - ncbi.nlm.nih.gov
Transcriptome Analysis of Human Colon Caco-2 Cells Exposed to Sulforaphane
M Traka, AV Gasper, JA Smith, CJ Hawkey, Y Bao, RF … - nutrition.org
... KEY WORDS: • colon cancer • chemoprevention • sulforaphane • microarray • KLF4 •
AMACR • p21. ... elucidated, although the induction of the c-Jun NH(2 ...
Web Search - nutrition.org
See related Commentary on page v Transcriptional Profiling of Keratinocytes Reveals a Vitamin D- … - Full text - MIT Libraries
J Lu, KM Goldstein, P Chen, S Huang, LM Gelbert, S … - The Journal of Investigative Dermatology, 2005 - blackwell-synergy.com
... large number of genes encoded keratins, further indicating the importance of KLF4
in epithelial ... protein 1 (AP1), a complex of transcription factors c-jun and c ...
Web Search
Human Kruppel-like factor5/KLF5: synergy with NF-kappaB/Rel factors and expression in human skin and …
I Sur, AB Unden, R Toftgard - Eur. J. Cell Biol, 2002 - ncbi.nlm.nih.gov
2002 Jun;81(6):323-34. ... Considering the TPA-responsiveness and expression pattern,
we propose that KLF5 like another member of its family KLF4/GKLF may play an ...
Cited by 3 - Web Search - Get it from MIT Libraries
Follicle-Stimulating Hormone Induced Changes in Gene Expression of Murine Testis - Full text - MIT Libraries
PI Sadate-Ngatchou, DJ Pouchnik, MD Griswold - Molecular Endocrinology, 2004 - mend.endojournals.org
... hormone regulation of AP-1: inhibition of c-jun and stimulation of jun-B gene ... of
the zinc finger transcription factor Kruppel-like factor 4 (Klf4) in postnatal ...
Cited by 1 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
GETTING UNDER THE SKIN OF EPIDERMAL MORPHOGENESIS - Full text - MIT Libraries
E Fuchs, S Raghavan - Nature Reviews Genetics, 2002 - nature.com
1. Rochat, A., Kobayashi, K. & Barrandon, Y. Location of stem cells of human
hair follicles by clonal analysis. Cell 76, 1063-1073 (1994). ...
Cited by 72 - Web Search - nature.com - ncbi.nlm.nih.gov
Identification of novel AP-1 target genes in fibroblasts regulated during cutaneous wound healing - Full text - MIT Libraries
L Florin, L Hummerich, BT Dittrich, F Kokocinski, … - Oncogene, 2004 - nature.com
... X Kruppel-like factor 4 (klf4) Mm.4325 0.4 c-Jun act. X Serum/glucocorticoid-
regulated kinase (sgk) Mm.28405 0.8 Ant., c-Jun act. X [y] ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Genomic analysis of immediate/early response to shear stress in human coronary artery endothelial … - Full text - MIT Libraries
DG Peters, XC Zhang, PV Benos, E Heidrich-O’Hare … - Physiological Genomics, 2002 - physiolgenomics.physiology.org
... Like KLF4, TIEG exerts an ... S, Ichijo H, Kitajima S. Homocysteine-responsive ATF3 gene
expression in human vascular endothelial cells: activation of c-Jun NH(2 ...
Web Search - intl-physiolgenomics.physiology.org - intl-physiolgenomics.physiology.org - physiolgenomics.physiology.org
Genome-wide gene expression analysis for induced ischemic tolerance and delayed neuronal death …
N Kawahara, Y Wang, A Mukasa, K Furuya, T Shimizu, … - J Cereb Blood Flow Metab, 2004 - nature.com
... U78102 EGR-2 (KROX20) 31 4.84 7.45 2 X54686 Jun-B 34 3.44 4.38 2 ... U17254 NGFI-B (Nurr77)
271 2.13 2.19 7 L26292 Kruppel-like factor 4 (KLF4) 20 7.19 2 ...
Cited by 7 - View as HTML - Web Search - nature.com - dx.doi.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Cell and molecular biology of the small intestine: new insights into differentiation, growth and …
JR Walters - Curr Opin Gastroenterol, 2004 - co-gastroenterology.com
... The gut-enriched Krüppel-like factor KLF4 is also involved in expression of genes
in ... c-Jun and c-Fos, which bind to AP1 sites, are involved in gene expression ...
Cited by 1 - Web Search - co-gastroenterology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Structure and Regulation of the Envoplakin Gene - Full text - MIT Libraries
A Maeaettae, C Ruhrberg, FM Watt - J Biol Chem, 2000 - jbc.org
... affected by antibodies against upstream stimulatory factor-1 (Usf), c-Myc, or Klf4. ...
found in this region, although members of the Fos and Jun protein families ...
Cited by 13 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Lung cancers detected by screening with spiral computed tomography have a malignant phenotype when … - Full text - MIT Libraries
F Bianchi, J Hu, G Pelosi, R Cirincione, M … - Clin Cancer Res, 2004 - clincancerres.aacrjournals.org
... RAD6 involved in DNA repair) and klf4 (Kruppel like factor 4). klf4 has been ... We found
only seven overlapped genes (JUN, STAT1, ADE2H1, SDR1, CX43, SSP1, and ...
Cited by 4 - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
Genetic and functional differences between multipotent neural and pluripotent embryonic stem cells
KA D'Amour, FH Gage - Proceedings of the National Academy of Sciences - pnas.org
... Crtr1, forward 5 -CCTATCTCTTCCTGCTGGGT and reverse 5 -GCACAGAGCCCACATACAGA; Klf4,
forward 5 ... 4, Mash1, Hes5, Hey1, Dlx1, Cutl1, Cbx4, ArxGtf2h1, Jun, Lmyc1, ld4 ...
Cited by 19 - Web Search - 171.66.122.165 - pubmedcentral.nih.gov - unige.ch - all 9 versions » - Get it from MIT Libraries
Genomics of the periinfarction cortex after focal cerebral ischemia
A Lu, Y Tang, R Ran, JF Clark, BJ Aronow, FR Sharp - J Cereb Blood Flow Metab, 2003 - nature.com
Page 1. Genomics of the Periinfarction Cortex After Focal Cerebral Ischemia
*Aigang Lu, *Yang Tang, *Ruiqiong Ran, *Joseph F. Clark ...
Cited by 18 - View as HTML - Web Search - nature.com - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
beta-Carotene Interferes with Ultraviolet Light A-Induced Gene Expression by Multiple Pathways - Full text - MIT Libraries
K Wertz, PB Hunziker, N Seifert, G Riss, M Neeb, G … - Journal of Investigative Dermatology, 2005 - blackwell-synergy.com
... can also be induced by stress-activated protein kinase (SAPK)/c-Jun N-terminal ... ILK,
desmocollins, and Cx45, as well as upregulation of Cx31, KLF4, and GADD153 ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Transcriptional profiling of in vitro smooth muscle cell differentiation identifies specific … - Full text - MIT Libraries
JM Spin, S Nallamshetty, R Tabibiazar, EA Ashley, … - Physiological Genomics, 2004 - physiolgenomics.physiology.org
... some of the upregulated genes are thought to suppress SM -actin (Klf4, Purb, Rbms1 ...
Although AP-1 complex genes Fos and Jun are often assumed to be associated ...
Cited by 1 - Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Target genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal … - Full text - MIT Libraries
B Mann, M Gelos, A Siedow, ML Hanski, A Gratchev, … - Clin. Cancer Res, 2005 - dx.doi.org
... factor/lymphoid-enhancer-factor complex with the promoter region of c-jun and fra ...
S. Jamaluddin, and DD Boyd The Kruppel-like KLF4 Transcription Factor, a Novel ...
Cited by 232 - Web Search - pnas.org - pubmedcentral.nih.gov - all 7 versions »
Gene expression of TPA induced differentiation in HL-60 cells by DNA microarray analysis - Full text - MIT Libraries
X Zheng, R Ravatn, Y Lin, WC Shih, A Rabson, R … - Nucleic Acids Research, 2002 - nar.oupjournals.org
... loop-helix proteins and regulates early B-cell differentiation (19), and KLF4, which
binds ... B. and Liebermann,DA (1993) Proto-oncogenes of the fos/jun family of ...
Cited by 9 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Identifying genetic networks underlying myometrial transition to labor - Full text - MIT Libraries
N Salomonis, N Cotte, A Zambon, K Pollard, K … - Genome Biology, 2005 - dx.doi.org
... receptor subtypes, estrogen, cortisol and transcription factors c-Jun and c ... of cell
growth (Igfbp2 and Il1r2), and transcriptional regulation (Sfrp4 and Klf4). ...
Web Search - microarrays.berkeley.edu - bmc.ub.uni-potsdam.de - gladstone.ucsf.edu - all 10 versions »
Covering the limb- formation of the integument - Full text - MIT Libraries
C Byrne, M Hardman, K Nield - Journal of Anatomy, 2003 - blackwell-synergy.com
... Transcription factor Kruppel-like factor 4 (Klf4) null mice provide an example of ...
Bypassing the embryonic lethal phenotype of cJun and Jun-b (AP1 subunits ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov
Insights into developmental mechanisms and cancers in the mammalian intestine derived from serial … - Full text - MIT Libraries
M Lepourcelet, L Tou, L Cai, J Sawada, AJF Lazar, … - Development, 2005 - research.dfci.harvard.edu
... growth factor (HDGF) Maina Lepourcelet 1,2, *, Liqiang Tou 1,2, *, Li Cai
1 , Jun-ichi Sawada 1,3 , Alexander JF Lazar 4 , Jonathan N ...
View as HTML - Web Search - dev.biologists.org - dev.biologists.org - ncbi.nlm.nih.gov
Transcriptional profiling reveals evidence for signaling and oligodendroglial abnormalities in the …
C Aston, L Jiang, BP Sokolov - Molecular Psychiatry, 2005 - nature.com
Page 1. ORIGINAL RESEARCH ARTICLE Transcriptional profiling reveals evidence for
signaling and oligodendroglial abnormalities in the temporal cortex ...
Cited by 4 - Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification of tissue-specific genes in nasopharyngeal epithelial tissue and differentially …
B Zhang, X Nie, B Xiao, J Xiang, S Shen, J Gong, M … - Genes Chromosomes and Cancer, 2003 - doi.wiley.com
... 1 , Shiguo Zhu 1 , Jie Zhou 1 , Jun Qian 1 , Hongbin Lu 1 , Xianfeng He 3 ,
Xiaoling Li 1 , Gengxi Hu 3 , and Guiyuan Li 1 * 1 Cancer ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Search Article Keyword:
BC Sun, JM Shi, TH Zhang, K Gao, JJ Mao, B Li, YH … - wjgnet.com
... 6, BHLHB2, KLF4, LOC92906, FXR1, DUSP6, NRP1, MIR, C6orf166, DUSP1, XLKD1,
MAF, C11orf15, LRRC1, JUN, DLG1, FLJ90798, SPRY2, NPEPPS,. ...
Cached - Web Search - wjgnet.com - wjgnet.com - wjgnet.com
Fibroblast growth factor receptor 3 inhibition by short hairpin RNAs leads to apoptosis in multiple … - Full text - MIT Libraries
L Zhu, G Somlo, B Zhou, J Shao, V Bedell, ML … - Mol Cancer Ther, 2005 - mct.aacrjournals.org
... down-regulation of MYC and JUN, as well as changes in several genes not commonly
associated with multiple myeloma (ie, SAS, GADD45A, TLR4, and KLF4; Table 1 ...
Web Search - mct.aacrjournals.org - ncbi.nlm.nih.gov
APC10. 1: AN Apc Min/INTESTINAL CELL LINE WITH RETENTION OF HETEROZYGOSITY - Full text - MIT Libraries
C De Giovanni, L Landuzzi, G Nicoletti, A Astolfi, … - Int. J. Cancer, 2004 - doi.wiley.com
... activated signaling pathway showed a low (Cyclin D1 and c-Jun) or absent ... be related
to the high expression of Klf4, an epithelial-specific transcription factor ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene expression signatures identify novel regulatory pathways during murine lung development: … - Full text - MIT Libraries
AE Bonner, WJ Lemon, M You - Journal of Medical Genetics, 2003 - math.unm.edu
... The upregulation of these transcription factors as well as Klf4 and Math5 may lead
to ... in various tissues, targeting such genes as c-myc, cyclin D and c-jun. ...
Cited by 6 - View as HTML - Web Search - dx.doi.org - jmedgenet.com - jmg.bmjjournals.com - all 8 versions »
Identification of a Genetic Signature of Activated Signal Transducer and Activator of Transcription … - Full text - MIT Libraries
JV Alvarez, PG Febbo, S Ramaswamy, M Loda, A … - Cancer Research, 2005 - cancerres.aacrjournals.org
... other transcription factors, including myc, jun, and fos, are ... forward
GCAGGGATCTTTCACTTCCA and reverse GCTGAATGCACAAAGAGCAG; KLF4: forward ...
Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
Two Functionally Divergent p 53-responsive Elements in the Rat Bradykinin B 2 Receptor Promoter - Full text - MIT Libraries
J Marks, Z Saifudeen, S Dipp, SS El-Dahr - J Biol Chem, 2003 - jbc.org
... p53-Consensus (23), 5'-AGGCATGTCTAGGCATGTCT-3'; NF- B-Consensus, 5'-
AGTTGAGGGGACTTCCCAGGC-3'; KLF4 (human p21 ... KLF-4 and to a lesser extent by CRE and ...
Cited by 6 - Web Search - jbc.org - ncbi.nlm.nih.gov
Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B … - Full text - MIT Libraries
U Kim, R Siegel, X Ren, CS Gunther, T Gaasterland, … - Proceedings of the National Academy of Sciences, 2003 - pnas.org
... included BCL6 and many Krüppel-like factors such as KLF2 and KLF4 (data not ... kinase
kinase 7 (Mapkk7), a signaling molecule that activates c-Jun N-terminal ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - genomes.rockefeller.edu - dx.doi.org - all 8 versions »
Shear stress regulates gene expression in vascular endothelial cells in response to tumor necrosis …
JJ Chiu, PL Lee, SF Chang, LJ Chen, CI Lee, KM Lin … - Journal of Biomedical Science, 2005 - springerlink.com
... 2 for 10 min inhibits the TNF-a-mediated activation of c-Jun NH 2 -terminal ... These
novel genes include krüppel-like factor 4 (KLF4), CLOCK, a disintegrin and ...
Web Search
Lung Kruppel-like Factor Contains an Autoinhibitory Domain That Regulates Its Transcriptional … - Full text - MIT Libraries
MD Conkright, MA Wani, JB Lingrel - J Biol Chem, 2001 - jbc.org
... Krüppel-like factors, the erythroid (EKLF/KLF1) and gut-enriched (GKLF/EZF/KLF4)
Krüppel-like ... factors such as p53 (29), MAT 2 (30), c-Myc (31), c-Jun (32), c ...
Cited by 10 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Human T-cell leukemia virus type I (HTLV-I) infection and the onset of adult T-cell leukemia (ATL) - Full text - MIT Libraries
M Matsuoka - Retrovirology, 2005 - dx.doi.org
... HBZ directly interacts with c-Jun or JunB [36], or enhances their degradation ...
hypermethylation silences transcription of the p16 [73], EGR3 and KLF4 genes as ...
Web Search - pubmedcentral.nih.gov - retrovirology.com - bmc.ub.uni-potsdam.de - all 10 versions »
Sp 1 and krueppel-like factor family of transcription factors in cell growth regulation and cancer - Full text - MIT Libraries
AR Black, JD Black, J Azizkhan-Clifford - Journal of Cellular Physiology, 2001 - doi.wiley.com
... includes the Sp proteins, Sp1, Sp2, Sp3, Sp4, and the ``kruÈppel- like factors''
(KLFs), EKLF (KLF1), LKLF (KLF2), BKLF/TEF-2(KLF3),GKLF/EZF(KLF4),IKLF/BTEB2 ...
Cited by 157 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Defining the CREB Regulon: A Genome-Wide Analysis of Transcription Factor Regulatory Regions - Full text - MIT Libraries
S Impey, SR McCorkle, H Cha-Molstad, JM Dwyer, GS … - Cell, 2004 - ohsu.edu
Page 1. Cell, Vol. 119, 1041–1054, December 29, 2004, Copyright ©2004 by Cell Press
Resource Defining the CREB Regulon: A Genome-Wide Analysis of ...
Cited by 6 - View as HTML - Web Search - cmu.edu - neuro.med.harvard.edu - ncbi.nlm.nih.gov
Interplay between HIV-1 Vpr and Sp 1 Modulates p 21 WAF 1 Gene Expression in Human Astrocytes - Full text - MIT Libraries
S Amini, M Saunders, K Kelley, K Khalili, BE … - J Biol Chem, 2004 - jbc.org
... In their observations, the authors suggest that in HEPG2 cells, c-Jun and Smad proteins ...
acid (58), and the gut-enriched Kruppel-like factor (GKLF and KLF4) (59 ...
Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Patterns of Gene Expression Differentially Regulated by Platelet-derived Growth Factor and … - Full text - MIT Libraries
N Kaplan-Albuquerque, YE Bogaert, V Van Putten, MC … - J. Biol. Chem, 2005 - jbc.org
... of the G q family, leading to stimulation of c-Jun N-terminal ... Consistent with the
array data, Western blotting showed that GKLF (KLF4) protein expression was ...
Web Search - ncbi.nlm.nih.gov
PROGESTERONE RECEPTORS AND Sp/KRUePPEL-LIKE FAMILY MEMBERS IN THE UTERINE ENDOMETRIUM
RCM Simmen, FA Simmen - Frontiers in Bioscience, 2002 - xylian.igh.cnrs.fr
... D. Gallot, AM Gachon et al: Co-localization of KLF6 and KLF4 with pregnancy ... BH Davis:
The DNA binding protein BTEB mediates acetaldehyde-induced jun N-terminal ...
Cited by 1 - Cached - Web Search - bioscience.org - bioscience.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
| |
©2005 Google