![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 134 for LMO2 and MYB. (0.11 seconds) |
The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis - Full text - MIT Libraries
MA Thompson, DG Ransom, SJ Pratt, H MacLennan, MW … - Dev Biol, 1998 - ncbi.nlm.nih.gov
... embryos. The zebrafish homologs of lmo2, c-myb, fli1, flk1, and flt4 have
been cloned and characterized in this study. Expression ...
Cited by 90 - Web Search
Expression of alpha4-integrin defines the earliest precursor of hematopoietic cell lineage diverged … - Full text - MIT Libraries
M Ogawa, M Kizumoto, S Nishikawa, T Fujimoto, H … - Blood, 1999 - bloodjournal.org
... Different dilutions of cDNA prepared from sorted cells were subjected to PCR
amplification specific for Gata1, Gata2, Tal1, Lmo2, Myb, and Gapd transcripts. ...
Cited by 35 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
capacity of unilineage macrophage precursors and myeloid progenitor commitment are c-Myb independent - Full text - MIT Libraries
D Clarke, A Vegiopoulos, A Crawford, M Mucenski, C … - Oncogene, 2000 - nature.com
... In c-myb 7/7 EBs, expression of Lmo2 was detectable at day 4 and reached a maximum
at day 9. An equally dramatic, but qualitatively distinct, dier- ence ...
Web Search
Lmo2 and GATA-3 associated expression in intraembryonic hemogenic sites - Full text - MIT Libraries
A Manaia, V Lemarchandel, M Klaine, I Max-Audit, P … - Development, 2000 - dev.biologists.org
... Besides common signaling pathways involving, for example, Tal-1/SCL, Lmo2,
GATA-1 and GATA- 2, a number of specific genes (including GATA-3, c-myb, AML- 1 ...
Cited by 37 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Zebrafish: a genetic approach in studying hematopoiesis
BH Paw, LI Zon - Curr. Opin. Hematol, 2000 - co-hematology.com
... Zebrafish homologues of genes critical for hematopoiesis (GATA factors, LMO2, SCL,
c -myb, NFE2, PU.1, ikaros, lck, c -fms, c -kit, globins) and vasculogenesis ...
Cited by 16 - Web Search - co-hematology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Development of primitive and definitive hematopoiesis from nonhuman primate embryonic stem cells in … - Full text - MIT Libraries
K Umeda, T Heike, M Yoshimoto, M Shiota, H Suemori … - Development, 2004 - mphywww.tamu.edu
... 7). Brachyury, an early mesodermal marker, was expressed on day 4 but its expression
declined on day 6. The expression of FLK1, LMO2, MYB and GATA2, which were ...
Cited by 2 - View as HTML - Web Search - dev.biologists.org - dev.biologists.org - ncbi.nlm.nih.gov
XIX Symposium of the International Association for Comparative Research on Leukemia and Related … - Full text - MIT Libraries
A Hochhaus, U Berger, A Kr& x 000 E 4 mer, A … - Journal of Cancer Research and Clinical Oncology, 1998 - springerlink.com
... LMO2 is a gene normally involved in erythroid development that acts synergistically
with TAL1 ... that the avian leukemia virus E26 onco- gene v-myb down-regulates ...
Web Search
Developmental biology of zebrafish myeloid cells
MO Crowhurst, JE Layton, GJ Lieschke - Int. J. Dev. Biol, 2002 - ijdb.ehu.es
... Haemangioblast scl 1 R* N N R (ICM) hhex 2 R* lmo2 3 0 N Haematopoietic myb 3
R-0 (ICM, 24 hpf) R-0 (ICM, 24 hpf) stem cell (definitive cbfβ 1 R* N R* ...
Cited by 4 - View as HTML - Web Search - ncbi.nlm.nih.gov - ijdb.ehu.es - Get it from MIT Libraries
Transcription factors in hematopoiesis
I Engel, C Murre - Curr. Opin. Genet. Dev, 1999 - www-biology.ucsd.edu
... Furthermore, it was determined that c-myb –/– ES cells were also unable to contribute ...
LMO2/RBTN-2 (LMO2), a member of the LIM-only domain family, has been ...
Cited by 10 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Isolation and characterization of zebrafish NFE2 - Full text - MIT Libraries
SJ Pratt, A Drejer, H Foott, B Barut, A Brownlie, … - Physiological Genomics, 2002 - intl-physiolgenomics.physiology.org
... higher vertebrates. To date, we have isolated the genes encoding
GATA-1, -2, and -3, SCL, LMO2, fli1, and c-myb (12, 44). In an ...
Cited by 3 - Web Search - intl-physiolgenomics.physiology.org - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
Molecular definition of the germinal centre stage of B-cell differentiation
C Ma, LM Staudt - Philos Trans R Soc London Ser B Biol Sci, 2001 - journals.royalsoc.ac.uk
... Phil.Trans. R. Soc. Lond.B (2001) JAW1 BCL-7A BCL-6 A-myb CD10 OGG1=8-oxyguanine
DNA glycosylase LMO2 CD38 CD27 RGS13 PKC mu APS adapter protein NBK BDP1 ...
Cited by 7 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
A complex linkage in the developmental pathway of endothelial and hematopoietic cells
SI Nishikawa - Curr Opin Cell Biol, 2001 - cbi.pku.edu.cn
... The finding that tal1 (–/–) and lmo2 (–/–) ... remodelling Runt related transcription
factor 1 (Runx1), GATA-binding protein 2 (GATA2) and c-myb are group ...
Cited by 19 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of Interactions between Transcription Factors and a Regulatory Region Spanning nt …
LA Pereira, MJ Churchill, AG Elefanty, T Gouskos, … - Journal of Biomedical Science, 2002 - content.karger.com
... Key Words HIV-1 LTR promoter W c-Myb W Basic helix-loop-helix W ... The LTR 9 Myb –
oligonucleotide was unable to bind recombi- nant c-Myb (data not shown). ...
Cited by 4 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
A transcription factor party during blood cell differentiation
MH Sieweke, T Graf - Curr. Opin. Genet. Dev, 1998 - ciml.univ-mrs.fr
... c-Maf can inhibit the synergistic activity of c-Ets-1 and c-Myb on the ... Agulnick AD,
Westphal H, •• Forster A, Rabbitts TH: The LIM-only protein Lmo2 is a ...
Cited by 62 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic … - Full text - MIT Libraries
AG Elefanty, L Robb, R Birner, CG Begley - Blood, 1997 - bloodjournal.org
... Note the discordance in expression between control cells and scl-null cells for
GATA-1, EKLF, NF-E2, c-myb, vav, and globin at the day-8 timepoint. LMO2 is a ...
Cited by 65 - Web Search - bloodjournal.org - bloodjournal.org - ncbi.nlm.nih.gov - all 5 versions »
Ikaros expression as a marker for lymphoid progenitors during zebrafish development - Full text - MIT Libraries
CE Willett, H Kawasaki, CT Amemiya, S Lin, LA … - Developmental Dynamics, 2001 - doi.wiley.com
... Fig. 2d), gata-2, Scl-1, c-myb, lmo2, and flk-1 genes (Gering et al., 1998;
Liao et al., 1998; Thompson et al., 1998). Ikaros expres ...
Cited by 16 - Web Search - benaroyaresearch.org - benaroyaresearch.org - ncbi.nlm.nih.gov - all 5 versions »
Transcriptional regulation of erythropoiesis - Full text - MIT Libraries
C Perry, H Soreq - Eur. J. Biochem, 2002 - content.febsjournal.org
... Pannell, R. & Rabbitts, TH (1998) The T cell leukemia LIM protein Lmo2 is necessary ...
Pietryga, DW, Scott, WJ Jr & Potter, SS (1991) A functional c-myb gene is ...
Cited by 11 - Cached - Web Search - ejbiochem.org - blackwell-synergy.com - ingentaconnect.com - all 8 versions »
[CITATION] Book review
J Wilde, MYK Armstrong… - Entomologia Experimentalis et Applicata, 1958
... 0.25 0.50 1.00 2.00 4.00 Subgroup of Diffuse Large-B-Cell Lymphoma A-myb Gene LMO2
Jnk3 CD10 bcl-6 Cyclin D2 IRF-4 Flip CD44 0.0 1.0 C 0 10 0.2 0.4 0.6 0.8 ...
Web Search - springerlink.com - kluweronline.com - ingentaconnect.com - all 5 versions » - Get it from MIT Libraries
Molecular phenotyping of the immune system by microarray analysis.
J Geliebter, A Mittelman, RK Tiwari - Cancer Invest, 2003 - taylorandfrancis.metapress.com
... “in vitro activated B cell” DLBCL CD 10, CD 38, A-myb, LMO2, 8-oxoguanine DNA
glycosylase. BCL-6, BCL-7A IRF4, FLIP, BCL-2, [60] High grade, anaplastic vs. ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Use of the zebrafish (Danio rerio) to define hematopoiesis - Full text - MIT Libraries
N Bahary, LI Zon - Stem Cells, 1998 - stemcells.alphamedpress.org
... markers lmo2, GATA-2, and fli1 are expressed in the posterior region of the ICM
and in several regions of the anterior trunk. In contrast, GATA-1, c-myb, and ...
Cited by 9 - Web Search - stemcells.alphamedpress.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genomic organization of the human Arpp gene
A Miyazaki, Y Tsukamoto, K Sato, S Ohgi, M … - Yonago Acta Med, 2002 - lib.med.tottori-u.ac.jp
... AGGGCCACAGCGCTCATCGAGCAGCGGCTGGCACAGGAGGAGGAGAATGAGGTGCGAGCA +105 hArpp Nkx2-5
Nkx2-5 c-Myb Lmo2 CdxA USF USF TCF11 E box E47 E box USF +1 E box USF AP-4 TATA ...
Cited by 2 - View as HTML - Web Search
Molecular diagnosis of lymphoid malignancies by gene expression profiling
RE Davis, LM Staudt - Curr. Opin. Hematol, 2002 - co-hematology.com
... Germinal center B-like (GCB) DLBCLs express LMO2, CD10, BCL-6, A-myb and other genes
characteristically expressed in normal germinal center B cells. ...
Cited by 21 - Web Search - co-hematology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Erythroblasts from Friend virus infected- and phenylhydrazine-treated mice accurately model … - Full text - MIT Libraries
VM Hodges, PC Winter, TRJ Lappin - British Journal of Haematology, 1999 - blackwell-synergy.com
... The contributions of other transcription factors such as TAL1, Lmo2, c-myb, c-myc,
Id and other MARE binding factors during terminal erythropoiesis in PHZ and ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov
Early Hematopoiesis and Developing Lymphoid Organs in the Zebrafish
CE WILLETT, A CORTES, A ZUASTI, AG ZAPATA - Key words, 1999 - doi.wiley.com
... is the first embryonic area expressing mol- ecules involved in early blood cell
formation in mam- mals, including scl, GATA-1, GATA-2, c-myb, LMO2 and Ikaros ...
Cited by 46 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Zebrafish: An emerging genetic model for the study of cytokines and hematopoiesis in the era of …
GJ Lieschke - Int. J. Hematol, 2001 - cardenjennings.metapress.com
... 24]; lmo2 AF191560, NM_008505 [57]; pu1GL unpublished and reference 26; c/epb1-4
[59]; ikaros AF092175, NM_006060 [60]; oct1 AF030519, X56230; c-myb P06876 [57 ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Multiple Proteins Binding to a GATA-E Box-GATA Motif Regulate the Erythroid Kruppel-like Factor(EKLF … - Full text - MIT Libraries
KP Anderson, SC Crable, JB Lingrel - J Biol Chem, 1998 - jbc.org
... Evidence for a model in which Lmo2 interacts with both GATA-1 and Tal1 serving as ...
discovered three Sp1 sites, two GATA sites, an E box motif, a c-myb site, and ...
Cited by 21 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Important roles of reversible acetylation in the function of hematopoietic transcription factors - Full text - MIT Libraries
X Huo, J Zhang - J. Cell. Mol. Med, 2005 - jcmm.org
... include GATA-1, FOG (friends of GATA-1), EKLF, NF-E2, PU.1, C-myb, TAL-1 ... with many
other protein fac- tors such as FOG (friends of GATA), EKLF, LMO2 (a member ...
View as HTML - Web Search - jcmm.ro - jcmm.org - ncbi.nlm.nih.gov
Cancer-associated alternative usage of multiple promoters of human GalCer sulfotransferase gene - Full text - MIT Libraries
M Tsuda, M Egashira, N Niikawa, Y Wada, K Honke - European Journal of Biochemistry, 2000 - ejbiochem.org
... In the 5'-flanking region of exon 1a, there are consensus binding sites for the
transcription factors Sp1, MyoD, Lmo2, MZF-1, v-Myb, Ik-2 and C/EBP . ...
Cited by 6 - Web Search - content.febsjournal.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants - Full text - MIT Libraries
D Traver, BH Paw, KD Poss, WT Penberthy, S Lin, LI … - Nature Immunology, 2003 - nature.com
... The T cell leukemia LIM protein Lmo2 is necessary for adult mouse hematopoiesis ... A
functional c-myb gene is required for normal murine fetal hepatic hematopoiesis ...
Cited by 14 - Web Search - zfblasta.tch.harvard.edu - eanimal.snu.ac.kr - ncbi.nlm.nih.gov - all 6 versions »
Cell-autonomous and non-autonomous requirements for the zebrafish gene cloche in hematopoiesis - Full text - MIT Libraries
L Parker, DY Stainier - Development, 1999 - dev.biologists.org
... has revealed a severe reduction or elimination of the expression of a number of
genes, including flk-1, fli-1, SCL, gata-1, gata-2, lmo2 and c-myb (Stainier et ...
Cited by 18 - Web Search - ucsf.edu - dev.biologists.org - ncbi.nlm.nih.gov
PMA-induced phenotypic changes in K 562 cells: MAPK-dependent and-independent events
C Shelly, L Petruzzelli, R Herrera - Leukemia, 1998 - nature.com
... red blood cell. 3 Similarly, a role for the protoonco- gene c-myb in
hematopoiesis has been established. 4 Both megakaryocyte and ...
Cited by 13 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
RUNX1/AML1: a central player in hematopoiesis
T Okuda, M Nishimura, M Nakao, Y Fujita - Int J Hematol, 2001 - cardenjennings.metapress.com
... Tal1/SCL and LMO2/ rbtn2, and other factors, including RUNX1/AML1 (runt- related
transcription factor 1/acute myeloid leukemia 1), CBF (PEBP2 ), c-Myb, Pu.1 ...
Cited by 11 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Journal of Medicine
A Rosenwald, G Wright, WC Chan, JM Connors, E … - llmpp.nih.gov
... 0.25 0.50 1.00 2.00 4.00 Subgroup of Diffuse Large-B-Cell Lymphoma A-myb Gene LMO2
Jnk3 CD10 bcl-6 Cyclin D2 IRF-4 Flip CD44 0.0 1.0 C 0 10 0.2 0.4 0.6 0.8 ...
View as HTML - Web Search - pharmacology.cwru.edu - pharm.cwru.edu - pharmacology.case.edu - all 5 versions »
[CITATION] Journal of Medicine
A Conclusions
Web Search
The‘definitive’(and‘primitive’) guide to zebrafish hematopoiesis - Full text - MIT Libraries
AJ Davidson, LI Zon - Oncogene, 2004 - nature.com
... this time, including c-myb (Thomp- son et al., 1998), ikaros (Willett et al., 2001),
scl (Jenna Galloway and Liz, manuscript in preparation), and lmo2 (Hao Zhu ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
GENETICS OF ERYTHROPOIESIS: Induced Mutations in Mice and Zebrafish - Full text - MIT Libraries
SH Orkin, LI Zon - Annual Review of Genetics, 1997 - wwwlib.bionet.nsc.ru
... hematopoietic compartment as other factors, such as SCL/tal-1 and Rbtn2/Lmo2, and
also ... c-myb The cellular homolog of the v-myb nuclear oncoprotein, c-myb, is ex ...
Cited by 37 - View as HTML - Web Search - genet.annualreviews.org - ncbi.nlm.nih.gov
Recent advances in the molecular diagnosis of diffuse large B-cell lymphoma
K Fu, J Iqbal, WC Chan - Expert Rev. Mol. Diagn, 2005 - future-drugs.com
... 0.25 0.50 1.00 2.00 4.00 Relative level of expression (× median value) A-myb LMO2
Jnk3 CD10 Bcl-6 Cyclin D2 IRF-4 Flip CD44 Probability of survival 1.0 0.8 ...
Web Search - future-drugs.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcription Factors: Normal and Malignant Development of Blood Cells
IJ Hematol - Int J Hematol, 2001 - cardenjennings.metapress.com
... 8;21), TEL/ETV6, mixed lineage leukemia (MLL), coacti- vators, LMO2, and
acetyltransferases ... relatively short,with two chapters,one for myc and myb and another ...
Web Search
Hematopoietic differentiation of human embryonic stem cells progresses through sequential … - Full text - MIT Libraries
ET Zambidis, B Peault, TS Park, F Bunz, CI Civin - Blood, 2005 - bloodjournal.org
... Interestingly, several genes important for regulating HSPC development in MESCs
and embryos (eg, LMO2, AML1, C-MYB [data not shown], KDR/flk-1 [VEGFR2], and FLT ...
Web Search - bloodjournal.org - ncbi.nlm.nih.gov
HLS 7, a hemopoietic lineage switch gene homologous to the leukemia-inducing gene MLF 1 - Full text - MIT Libraries
JH Williams, LN Daly, E Ingley, JG Beaumont, PA … - The EMBO Journal, 1999 - embojournal.npgjournals.com
... Thus, HLS7 behaves like transcription factors PU.1, myc, myb, mafB and LMO2 (Coppola
and Cole, 1986 ; Todokoro et al., 1988 ; Sieweke et al., 1996 ; Visvader ...
Cited by 14 - Web Search - emboj.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Final Accepted Version
SJ Pratt, A Drejer, H Foott, B Barut, A Brownlie, … - physiolgenomics.physiology.org
... higher vertebrates. To date, we have isolated the genes encoding GATA-1,
2, and 3, SCL, LMO2, fli1, and c-myb 28,29 . In an effort ...
Web Search
TRANSCRIPTION FACTORS
OFB CELLS - doi.wiley.com
... 27 The LMO2 Master Gene; Its Role as a Transcription Regulator Determining Cell
Fate in ... 519 29 The Roles of the c-myc and c-myb Oncogenes in Hematopoiesis and ...
Web Search
Zebrafish as a model organism for blood diseases - Full text - MIT Libraries
J Berman, K Hsu, AT Look - British Journal of Haematology, 2003 - blackwell-synergy.com
... in blood are severely reduced by approximately 48 h, but c-myb (Thompson et al ... These
cells appear later than those expressing scl, lmo2 and gata-2, consistent ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Scl is required for dorsal aorta as well as blood formation in zebrafish embryos - Full text - MIT Libraries
LJ Patterson, M Gering, R Patient - Blood, 2005 - bloodjournal.org
... Fli1 and lmo2 expression in the ALM at 10 somites (14 hpf) was unaffected by ... As seen
in the PLM, pu.1, c-myb, and ikaros expression was substantially reduced ...
Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Annual Review of Genetics - Full text - MIT Libraries
SH Orkin, LI Zon - Annual Review of Genetics, 1997 - genet.annualreviews.org
... GATA-2 is expressed as early within the hematopoietic compartment as other factors,
such as SCL/tal-1 and Rbtn2/Lmo2, and also localizes to the caudal ... c-myb. ...
Web Search - genet.annualreviews.org
Nonparametric methods for identifying differentially expressed genes in microarray data - Full text - MIT Libraries
OG Troyanskaya, ME Garber, PO Brown, D Botstein, … - Bioinformatics, 2002 - bioinformatics.oupjournals.org
... BCL-6 and A-myb. Other genes in common with the Alizadeh study are genes that can
be altered by translocations in lymphoid malignancies: BCL-7A, LMO2 (TTG-2 ...
Cited by 58 - Web Search - cs.princeton.edu - vision.ime.usp.br - cmgm.stanford.edu - all 9 versions »
Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional … - Full text - MIT Libraries
AP Tsang, Y Fujiwara, DB Hom, SH Orkin - Genes Dev, 1998 - genesdev.org
... 1996 ) and c-myb (Mucenski et al. ... interest are the leukemia oncoproteins
SCL/tal-1, a basic helix-loop-helix transcription factor, and Rbtn2/LMO2, a LIM- ...
Cited by 116 - Web Search - genesdev.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Critical Review - Full text - MIT Libraries
E Ingley, PA Tilbrook, SP Klinken - IUBMB Life, 2004 - dx.doi.org
... There are several transcription factors required for commitment to the erythroid
lineage, including SCL, LMO2, GATA-2 and c-Myb, which must then be turned off ...
Web Search - taylorandfrancis.metapress.com
GATA-1 forms distinct activating and repressive complexes in erythroid cells. - Full text - MIT Libraries
P Rodriguez, E Bonte, J Krijgsveld, K Kolodziej, B … - The EMBO Journal, 2005 - embojournal.npgjournals.com
... functions, for example, myc and myb (Rylski et al, 2003), although its protein partners
are unknown. The multimeric GATA-1/TAL-1/Ldb1/E2A/LMO2 complex binds to ...
Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - dspace.ubib.eur.nl - all 8 versions »
ZEBRAFISH AS A MODEL ORGANISM FOR BLOOD DISEASES - Full text - MIT Libraries
OFV EMBRYOGENSIS - British Journal of Haematology, 2003 - ingentaconnect.com
... in blood are severely reduced by approximately 48 h, but c- myb (Thompson et al ... These
cells appear later than those expressing scl, lmo2 and gata-2, consistent ...
Web Search
| |
©2005 Google