![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 63 for LMO2 and PBX1. (0.15 seconds) |
E2a/Pbx1 induces the rapid proliferation of stem cell factor-dependent murine pro-T cells that cause … - Full text - MIT Libraries
DB Sykes, MP Kamps - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... coexpressing SCL/Tal1 and LMO2 (29) or SCL/Tal1 and LMO1 (10). In contrast, the
T-cell leukemias that arise in transgenic mice expressing E2a/Pbx1 from the Eμ ...
Cited by 4 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Activating FLT3 mutations in CD117/KIT T-cell acute lymphoblastic leukemias - Full text - MIT Libraries
E Paietta, AA Ferrando, D Neuberg, JM Bennett, J … - Blood, 2004 - bloodjournal.org
... cells and tested by RT-PCR for BCR-ABL, MLL-AF4, E2A-PBX1, and TEL-AML1 ... levels of
the T-cell oncogenes, TAL1, LYL1, HOX11, HOX11L2, LMO1, and LMO2, and the ...
Cited by 6 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 5 versions »
Progress in Hematology
Y Hayashi - cardenjennings.metapress.com
... in chromosomal translocations of ALL, such as the E2A-PBX1 chimeric gene in t ... expressed
in hematopoietic pro- genitors, PROML1, FLT3, and LMO2; myeloid-specific ...
Web Search
Childhood and Adolescent Lymphoid and Myeloid Leukemia - Full text - MIT Libraries
CH Pui, M Schrappe, RC Ribeiro, CM Niemeyer - Hematology, 2004 - asheducationbook.org
... Although pre-B cell ALL with the t(1;19)/E2A-PBX1 fusion was associated ... the basis
of involvement of one or more specific oncogenes: LYL1 plus LMO2, HOX11, TAL1 ...
Cited by 1 - Web Search - dx.doi.org - asheducationbook.org - ncbi.nlm.nih.gov
Formation of in vivo Complexes Between the TAL1 and E2A Polypeptides of Leukemic T Cells - Full text - MIT Libraries
H Hsu, I Wadman, R Baer - Proceedings of the National Academy of Sciences - pnas.org
... deletion mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic
mice ... Larson, and TH Rabbitts The oncogenic T cell LIM-protein Lmo2 forms part ...
Cited by 65 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Distinct gene expression profiles determine molecular treatment response in childhood acute … - Full text - MIT Libraries
S Tables - Blood, 2005 - bloodjournal.org
... 4 E2A-PBX1 fusion gene transcripts were amplified as ... TGGATCCAGCTATTTGGTTTGA; ATM
reverse primer, CCAAGTATGTAACCAACAATAGAAGAAGTAG 10 ; LMO2 forward primer ...
Cited by 2 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Chromosomal Translocation in a Human Leukemic Stem-Cell Line Disrupts the T-Cell Antigen Receptor … - Full text - MIT Libraries
CG Begley, PD Aplan, MP Davey, K Nakahara, K … - N. Engl. J. Med, 2004 - pnas.org
... and TH Rabbitts Activation of the T-Cell Oncogene LMO2 after Gene ... deletion mutant
of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic mice Blood ...
Cited by 59 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Notch signaling in leukemia
JC Aster, WS Pear - Curr. Opin. Hematol, 2001 - co-hematology.com
... other genes implicated in human T-ALL, such as TAL1, LMO1, and LMO2, which are ... showing
that Notch1 cooperates in the induction of T-ALL by E2A-PBX1 [35•] and ...
Cited by 27 - Web Search - co-hematology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Chromosomal abnormalities and tumor development: from genes to therapeutic mechanisms - Full text - MIT Libraries
C Cobaleda, J Perez-Losada, I Sanchez-Garcia - BioEssays, 1998 - doi.wiley.com
... include homeodomain proteins, such as HOX11 in T-ALL (10–12) and PBX1 in pre-B ...
containing a zinc-finger LIM domain, (19) which include LMO1 and LMO2 in T-ALL. ...
Cited by 13 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
acquises de la cellule souche hematopoietique ou d’un precurseur deja commis vers les lignees …
S YNTHESE - MEDECINE/SCIENCES, 2003 - ist.inserm.fr
... Précurseur lymphocytaire LYL1 TAL1 LMO2 HOX11 HOX11L2 ProB ... Pré-B Mégacaryocyte Myélocyte
Thymocytes simple positif E2A-PBX1 t(17;19) E2A-HLF t(17;19) ...
View as HTML - Web Search - erudit.org
Clinical strategies for expansion of haematopoietic stem cells - Full text - MIT Libraries
BP Sorrentino - Nature Reviews Immunology, 2004 - nature.com
... Krosl, J. et al. Cellular proliferation and transformation induced by HOXB4 and
HOXB3 proteins involves cooperation with PBX1. Oncogene 16, 3403–3412 (1998). ...
Cited by 3 - Web Search - nature.com - utminers.utep.edu - ncbi.nlm.nih.gov - all 5 versions »
Disordered T-cell development and T-cell malignancies in SCL LMO1 double-transgenic mice: parallels … - Full text - MIT Libraries
DS Chervinsky, XF Zhao, DH Lam, M Ellsworth, KW … - Mol Cell Biol, 1999 - mcb.asm.org
... Chimeric homeobox gene E2A-PBX1 induces proliferation, apoptosis, and malignant
lymphomas in ... The oncogenic T cell LIM-protein LMO2 forms part of a DNA-binding ...
Cited by 34 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Cytogenetics and molecular genetics of childhood leukemia
SK Ma, TSK Wan, LC Chan - Hematological Oncology, 1999 - doi.wiley.com
... t(1;19)(q23;p13) PBX1-E2A B 5 ... 1 t(7;9)(q34;q34) TAN1-TCRb T <1 t(8;14)(q24;q11)
myc-TCRa/d T <1 t(11;14)(p15;q11) LMO1-TCRd T <1 t(11;14)(p13;q11) LMO2-TCRd T ...
Cited by 15 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Involvement of the TCL5 Gene on Human Chromosome 1 in T-Cell Leukemia and Melanoma - Full text - MIT Libraries
LR Finger, J Kagan, G Christopher, J Kurtzberg, MS … - Development, 2004 - pnas.org
... terminal deletion mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1
transgenic mice ... A. Forster, and T. H. Rabbitts The LIM-only protein Lmo2 is a ...
Cited by 60 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Expression of E2A-HLF chimeric protein induced T-cell apoptosis, B-cell maturation arrest, and … - Full text - MIT Libraries
H Honda, T Inaba, T Suzuki, H Oda, Y Ebihara, K … - Blood, 1999 - bloodjournal.org
... p13), the C-terminal region of E2A gene, including the bHLH DNA-binding and
dimerization domains, is replaced with the DNA-binding domain of PBX1 homeobox gene ...
Cited by 11 - Web Search - bloodjournal.org - bloodjournal.org - ncbi.nlm.nih.gov - all 6 versions »
Molecular basis for catecholaminergic neuron diversity - Full text - MIT Libraries
S Material, J Grimm, A Mueller, F Hefti, A … - Proc Natl Acad Sci US A, 2004 - pubmedcentral.nih.gov
... Such a cascade would include the DA midbrain- and forebrain-specific transcription
factors PBX1, ZFH-4, IFI 116, Bteb2, Lmo2, Prox1, and Hnf-6 that have been ...
Web Search
[CITATION] Acute Lymphoblastic Leukemia
MG Alterations
Web Search
Gene expression profiles in a panel of childhood leukemia cell lines mirror critical features of the … - Full text - MIT Libraries
UR Kees, J Ford, M Watson, A Murch, M Ringner, RL … - Molecular Cancer Therapeutics, 2003 - thep.lu.se
... Simi- larly, high LMO2 expression was recorded for PER-550 cells, both by microarray
and ... exhibit at(1;19), and both showed high RNA levels of PBX1 by profile. ...
Cited by 3 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Disrupted differentiation and oncogenic transformation of lymphoid progenitors in E2A-HLF transgenic … - Full text - MIT Libraries
KS Smith, JW Rhee, L Naumovski, ML Cleary - Mol Cell Biol, 1999 - mcb.asm.org
... For example, thymocytes from E2A-PBX1 mice are arrested at a transitional ... mice
ectopically expressing the oncogenes LMO1/RBTN1/TTG1 (32), LMO2/RBTN2 (27), TAL ...
Cited by 8 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Leukaemia- a developmental perspective - Full text - MIT Libraries
S Izraeli - British Journal of Haematology, 2004 - blackwell-synergy.com
... paradigm of leukaemogenesis: RUNX1 abnormalities in acute leukaemias, GATA1 mutations
in the leukaemias of Down syndrome, and SCL and LMO2 ectopic expression ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
CONSEQUENCES OF CHROMOSOMAL ABNORMALITIES IN TUMOR DEVELOPMENT - Full text - MIT Libraries
I Sanchez-Garcia - Annual Review of Genetics, 1997 - dx.doi.org
... are homeodomain proteins such as HOX11 in T-ALL (54, 64, 79) or PBX1, which can ...
zinc-finger type domain called LIM domain (1, 111, 113), like LMO1 and LMO2 in T ...
Cited by 25 - Web Search - wwwlib.bionet.nsc.ru - genet.annualreviews.org - ncbi.nlm.nih.gov - all 6 versions »
Molecular basis for catecholaminergic neuron diversity - Full text - MIT Libraries
J Grimm, A Mueller, F Hefti, A Rosenthal - Proceedings of the National Academy of Sciences - pnas.org
... Such a cascade would include the DA midbrain- and forebrain-specific transcription
factors PBX1, ZFH-4, IFI 116, Bteb2, Lmo2, Prox1, and Hnf-6 that have been ...
Cited by 2 - Web Search - dx.doi.org - pnas.org - ncbi.nlm.nih.gov
PCR CUANTITATIVA EN TIEMPO REAL. UTILIDAD EN EL DIAGNOSTICO Y MONITORIZACION DE LA ENFERMEDAD MINIMA …
JRCSR Sofia - db2.doyma.es
... t(1;19)(q23;p13) E2A-PBX1 (mRNA) 5-8 3-4 ... t(8;14)(q24;q11) c-MYC-TCRA/D (DNA)
t(11;14)(p15;q11) LMO1-TCRD (DNA) t(11;14)(p13;q11) LMO2-TCRD (DNA) 5-10 5-10 ...
View as HTML - Web Search
Pathogenese und Biologie der Leukaemien - Full text - MIT Libraries
M Feuring-Buske, W Hiddemann, C Buske - Der Internist, 2002 - springerlink.com
Page 1. Der Internist 10•2002 | 1179 Zum Thema Die Leukämien stellen eine
heterogene Gruppe von Erkrankungen dar.So können die ...
Web Search
Molecular genetics of childhood leukemias
JE Rubnitz, AT Look - J Pediat Hematol Oncol, 1998 - jpho-online.com
... Pediatric ALL cases that express E2A-PBX1 frequently have elevated leukocyte counts
at ... members of the LIM family of transcription factors (LMO1, LMO2)(122-124 ...
Cited by 28 - Web Search - jpho-online.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Hoxa9 and Meis1 are key targets for MLL-ENL-mediated cellular immortalization - Full text - MIT Libraries
BB Zeisig, T Milne, MP Garcia-Cuellar, S Schreiner … - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... CGCAGTTCAGGACCCGACAGGAA, forward primer, CGGCCGAAGCCAGTTTC, reverse primer,
GCGCCGCGTCAGGTAG; Pbx1, Taqman probe ... Flt-3, Meis-1, Hoxa9, Ptprc, Lmo2, Adam10, and ...
Cited by 12 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 6 versions »
DNA microarray analysis in malignant lymphomas - Full text - MIT Libraries
C Schwaenen, S Wessendorf, HA Kestler, H Doehner, … - Annals of Hematology, 2003 - springerlink.com
... GC-DLBCL a CD10, CD38, A-MYB, OGG1, BCL-6, BCL7A, LMO2 (TTG-2 ... fication of widely
recognized, clinically distinct leukemia subtypes (T-ALL, E2A-PBX1, BCR-ABL, TEL ...
Cited by 6 - Web Search - utoronto.ca - ncbi.nlm.nih.gov
Genomic approaches to hematologic malignancies - Full text - MIT Libraries
BL Ebert, TR Golub - Blood, 2004 - bloodjournal.org
... the top panel, the 3 component dimensions separate cases of T-ALL, E2A-PBX1,
TEL-AML1 ... of the key oncogenes HOX11, TAL1 (SCL), LYL1, LMO1, and LMO2 and indicated ...
Cited by 8 - Web Search - broad.mit.edu - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Transcript profiling of human dendritic cells maturation-induced under defined culture conditions: … - Full text - MIT Libraries
F Moschella, A Maffei, RP Catanzaro, KP … - British Journal of Haematology, 2001 - ingentaconnect.com
... protein pbx1/prl, M86546 8 VLA2; CD49B antigen, M28249 8 CD5, X04391 8 MIP1alpha
R: Rantes R; CCR; D10925 8 BCL-6, U00115 8 LIM-only protein 2 (LMO2), X61118 8 ...
Cited by 11 - Web Search - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... PBX1 02 Homeo domain factor Pbx-1 Core should be CAATC not CAAT ... LMO2COM 01 Complex
of Lmo2 bound to Tal-1, E2A proteins, and GATA-1, half-site 1 Core should be ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
New Molecular Methods for Classification, Diagnosis and Therapy Prediction of Hematological … - Full text - MIT Libraries
A Zvara, L Hackler Jr, BZ Nagy, T Micsik, LG … - Pathol. Oncol. Res, 2002 - webio.hu
... with t(12;21)/TEl-AML1 and t(1;19)/E2A-PBX1 translocations is ... regulated genes that
important for cell-maturation (eg HOX11, LMO1, LMO2) become regulated by ...
Cited by 1 - View as HTML - Web Search - ncbi.nlm.nih.gov - webio.hu
Helix-loop-helix(E 2-5, HEB, TAL 1 and Id 1) protein interaction with the TCRalphadelta enhancers - Full text - MIT Libraries
M Bernard, E Delabesse, L Smit, C Millien, IR … - International Immunology, 1998 - intimm.oupjournals.org
Page 1. International Immunology, Vol. 10, No. 10, pp. 1539–1549 © 1998 Oxford
University Press Helix-loop-helix (E2-5, HEB, TAL1 and Id1) ...
Cited by 6 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Retroviral insertional mutagenesis identifies oncogene cooperation. - Full text - MIT Libraries
T Nakamura - Cancer Science, 2005 - blackwell-synergy.com
... LMO2 is a known T-cell oncogene, (59) and it is very likely that the gene ... Cooperative
activation of Hoxa and Pbx1-related genes in murine myeloid leukaemias. ...
Web Search - ncbi.nlm.nih.gov
Oncogenes et leucemies: historique et perspectives
S Gisselbrecht, BG Roussy - M e decine et Science, 2003 - erudit.org
... complexes transcriptionnels comme les protéines LYL1, TAL1/SCL, LMO1 et LMO2, HOX11
et ... de fixation à l’ADN de la protéine à homéodomaine PBX1 alors que ...
Cited by 2 - Cached - Web Search
CLUB ESPANOL DE CITOLOGIA HEMATOLOGICA: EL LINFOBLASTO EN EL CONTEXTO
A DE LA LEUCEMIA LINFOBLASTICA - db2.doyma.es
Page 1. CLUB ESPAÑOL DE CITOLOGÍA HEMATOLÓGICA: EL LINFOBLASTO EN EL CONTEXTO DE
LA LEUCEMIA LINFOBLÁSTICA AGUDA C OORDINADORAS : M.ªC. J IMÉNEZ . ...
View as HTML - Web Search
Cytogenetics and molecular genetics of acute lymphoblastic leukemia - Full text - MIT Libraries
CJ Harrison, L Foroni - Reviews in Clinical and Experimental Hematology, 2002 - blackwell-synergy.com
... This oncogenic potential of E2a-Pbx1 is dependent on the Hox cooperativity motif
(HCM ... The genes TAL2, LYL1, LMO1, LMO2, cMYC, LCK, TAN1, IGH, TCL1 and BCL3 are ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov
Protection and selection for gene therapy in the hematopoietic system - Full text - MIT Libraries
MD Milsom, LJ Fairbairn - The Journal of Gene Medicine, 2004 - doi.wiley.com
Page 1. THE JOURNAL OF GENE MEDICINE REVIEW ARTICLE J Gene Med 2004; 6: 133–146.
Published online in Wiley InterScience (www.interscience.wiley.com). ...
Web Search - angt.net - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL … - Full text - MIT Libraries
J Soulier, E Clappier, JM Cayuela, A Regnault, M … - Blood, 2005 - bloodjournal.org
... helix-loop-helix proteins (TAL1/SCL, TAL2, LYL1), homeodomain-containing proteins
(TLX1/HOX11, TLX3/HOX11L2), and LIM only proteins (LMO1, LMO2), which are ...
Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Molecular signatures of self-renewal, differentiation, and lineage choice in multipotential … - Full text - MIT Libraries
L Bruno, R Hoffmann, F McBlane, J Brown, R Gupta, … - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... Six3 and Irx3, the stem and erythroid cell-associated Lim-only protein Lmo2, and
the ... as a regulator of SCL (9). The expression of the homeoprotein PBX1 and its ...
Cited by 4 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov
Progress in Hematology
M Eguchi, M Eguchi-Ishimae, M Greaves - Int J Hematol, 2005 - cardenjennings.metapress.com
... Cre, the gene for a recombinase that induces MLL-ENL fusion by means of Cre-Lox
recombination, is introduced into the genomic locus of LMO2, the expression of ...
Web Search
Clinical and biological importance of cytogenetic abnormalities in childhood and adult acute …
B Johansson, F Mertens, F Mitelman - Annals of Medicine, 2004 - dx.doi.org
Page 1. Clinical and biological importance of cytogenetic abnormalities
in childhood and adult acute lymphoblastic leukemia Bertil ...
Web Search - taylorandfrancis.metapress.com - ncbi.nlm.nih.gov - lu-research.lub.lu.se - Get it from MIT Libraries
Clinical significance of cytogenetic abnormalities in adult acute lymphoblastic leukemia - Full text - MIT Libraries
S Faderl, HM Kantarjian, M Talpaz, Z Estrov - Blood, 1998 - bloodjournal.org
... 148 Comparable data for adult patients with ALL and expression of E2A-PBX1 who share ...
The two genes RBTN1 (or Lmo1, Ttg1, Rhom1) and RBTN2 (or Lmo2, Ttg2, Rhom2 ...
Cited by 88 - Web Search - doe.unimo.it - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Molecular genetic analysis of haematological malignancies: I. Acute leukaemias and … - Full text - MIT Libraries
AJ BENCH, WN ERBER, MA SCOTT - Clinical & Laboratory Haematology, 2005 - blackwell-synergy.com
... of one in 10 4 cells, have been developed to detect minimal E2A-PBX1 levels (Gabert
et ... loci include t(11;14) that results in overexpression of LMO1 or LMO2, t(7 ...
Web Search - ncbi.nlm.nih.gov
Early steps in the evolution of multicellularity: deep structural and functional homologies among … - Full text - MIT Libraries
CC Coutinho, RN Fonseca, JJC Mansure, R Borojevic - Mechanisms of Development, 2003 - faculty.virginia.edu
... The identified promoter elements are putative binding sites for transcrip- tion
factors of the following families: TCF-1, CAAT binding protein, LMO2, USF-1 and ...
Cited by 4 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions »
Gene expression profiling and its application in studies of haematological malignancy - Full text - MIT Libraries
M Hubank - British Journal of Haematology, 2004 - blackwell-synergy.com
... to subdivide ALL into T-ALL, hyperdiploid, BCR-ABL, E2A-PBX1, TEL-AML ... clustering
of tumours associated with dysregulation of HOX11, TAL1, LYL1, LMO1 and LMO2. ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The T-cell oncogenic protein HOX11 activates Aldh1 expression in NIH 3T3 cells but represses its … - Full text - MIT Libraries
WK Greene, S Bahn, N Masson, TH Rabbitts - Mol Cell Biol, 1998 - mcb.asm.org
... via their association with chromosomal translocations, viz., LMO1 and LMO2 (38). ...
that HOX protein interactions with cofactors such as PBX1 can determine ...
Cited by 10 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Luciferase Reporters: Less is More
A Paguio, B Almond, F Fan, P Stecha, D Garvin, M … - promega.com
... NF Y NF-kB MRE MIS POZ HLF SF1 Tax Lmo2 ST/TA RP58 HLF NUDR NUDR NUDR NUDR AC-t
Pbx1 TCF11 BACH1 GBF1 AD-b FLI Hox1.3 CREB CREB PAR PAR Lmo2 KLF3 Cut-like ...
Web Search
Side effects of retroviral gene transfer into hematopoietic stem cells - Full text - MIT Libraries
C Baum, J Dullmann, Z Li, B Fehse, J Meyer, DA … - Blood, 2003 - bloodjournal.org
... Importantly, activation of HOXB4-interacting partners such as PBX1 (possibly by
insertional mutagenesis) may be sufficient to promote transformation of HSCs ...
Cited by 71 - Web Search - viro.med.uni-erlangen.de - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Acute Lymphoblastic Leukemia - Full text - MIT Libraries
D Hoelzer, N Gokbuget, O Ottmann, CH Pui, MV … - Hematology, 2002 - asheducationbook.org
Page 1. 162 American Society of Hematology Acute Lymphoblastic Leukemia
Dieter Hoelzer, Nicola Gökbuget, Oliver Ottmann, Ching-Hon ...
Cited by 23 - Web Search - ohsu.edu - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Reduced proliferative capacity of hematopoietic stem cells deficient in Hoxb3 and Hoxb4 - Full text - MIT Libraries
JM Bjornsson, N Larsson, AC Brun, M Magnusson, E … - Mol Cell Biol, 2003 - mcb.asm.org
... targeting of genes such as GATA-2, SCL/tal-1, Rbtn2/Lmo2, AML1, PU.1 ... important for
maintenance of hematopoietic activity include molecules such as Pbx1 (14) and ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - ask.lub.lu.se - dx.doi.org - all 7 versions »
|
©2005 Google