![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 38 of 38 for MAFG and NFE2. (0.10 seconds) |
Did you mean: MFG and NFE2
NRF2, a member of the NFE2 family of transcription factors, is not essential for murine … - Full text - MIT Libraries
K Chan, R Lu, JC Chang, YW Kan - Proc. Natl. Acad. Sci. USA, 1996 - dx.doi.org
... and LI Zon Isolation and characterization of zebrafish NFE2 Physiol Genomics ... synthetic
lethality and hematopoietic defects in compound mafG::mafK mutant mice ...
Cited by 67 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Impaired megakaryopoiesis and behavioral defects in mafG-null mutant mice - Full text - MIT Libraries
JA Shavit, H Motohashi, K Onodera, J Akasaka, M … - Genes Dev, 1998 - genesdev.org
... F 2 (129/B6) mafG +/ and mafG / mice were intercrossed to generate F 3 pups ... NRF2,
a member of the NFE2 family of transcription factors, is not essential for ...
Cited by 36 - Web Search - genesdev.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Perinatal synthetic lethality and hematopoietic defects in compound mafG:: mafK mutant mice - Full text - MIT Libraries
K Onodera, JA Shavit, H Motohashi, M Yamamoto, JD … - The EMBO Journal, 2000 - embojournal.npgjournals.com
... pmMafG2 was made by inserting a 0.2 kbp PvuII-ApaI fragment of mouse MafG cDNA into ...
Lu, R. , Chan, JC and Kan, YW (1996) NRF2, a member of the NFE2 family of ...
Cited by 24 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 7 versions »
Dependence of globin gene expression in mouse erythroleukemia cells on the NF-E2 heterodimer - Full text - MIT Libraries
KJ Kotkow, SH Orkin - Mol Cell Biol, 1995 - mcb.asm.org
... members of the maf sub- family include other maf polypeptides (mafB, mafG, and mafF ...
specified 5 of the initiation codon in the forward p45 primer, NFE2-F1 (5 ...
Cited by 85 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Complexity of the erythroid transcription factor NF-E2 as revealed by gene targeting of the mouse p … - Full text - MIT Libraries
KJ Kotkow, SH Orkin - Genetics, 1996 - dx.doi.org
... R. Lu, J. C. Chang, and Y. W. Kan NRF2, a member of the NFE2 family of ... Home page,
Blood Home page V. Blank, MJ Kim, and NC Andrews Human MafG Is a Functional ...
Cited by 25 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
p 45 NF-E 2 regulates expression of thromboxane synthase in megakaryocytes - Full text - MIT Libraries
S Deveaux, S Cohen-Kaminsky, RA Shivdasani, NC … - The EMBO Journal, 1997 - embojournal.npgjournals.com
... anti-p45 antibodies (lane 6) and anti-MafG/K antibodies (lane 7), but not with
anti-GATA-1 antibodies (lane 8). One of the complexes formed on nfe2-2 (lane 9 ...
Cited by 38 - Web Search - emboj.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
MafT, a new member of the small Maf protein family in zebrafish - Full text - MIT Libraries
Y Takagi, M Kobayashi, L Li, T Suzuki, K Nishikawa … - Biochem Biophys Res Commun, 2004 - ncbi.nlm.nih.gov
... We identified homolog genes of MafG and MafK but not MafF in zebrafish ... bound MARE
sequence as a homodimer or heterodimers with zebrafish Nrf2 or p45 Nfe2. ...
Cited by 2 - Web Search
Cloning of Nrf1, an NF-E2-Related Transcription Factor, by Genetic Selection in Yeast - Full text - MIT Libraries
JY Chan, X Han, YW Kan - Proceedings of the National Academy of Sciences - pnas.org
... and LI Zon Isolation and characterization of zebrafish NFE2 Physiol Genomics ... synthetic
lethality and hematopoietic defects in compound mafG::mafK mutant mice ...
Cited by 126 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The Ubiquitous Subunit of Erythroid Transcription Factor NF-E2 is a Small Basic-Leucine Zipper … - Full text - MIT Libraries
NC Andrews, KJ Kotkow, PA Ney, H Erdjument-Bromage … - Proceedings of the National Academy of Sciences - pnas.org
... and LI Zon Isolation and characterization of zebrafish NFE2 Physiol Genomics ... synthetic
lethality and hematopoietic defects in compound mafG::mafK mutant mice ...
Cited by 136 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Erythropoiesis and Globin Gene Expression in Mice Lacking the Transcription Factor NF-E2 - Full text - MIT Libraries
RA Shivdasani, SH Orkin - Proceedings of the National Academy of Sciences - pnas.org
... and LI Zon Isolation and characterization of zebrafish NFE2 Physiol Genomics ... synthetic
lethality and hematopoietic defects in compound mafG::mafK mutant mice ...
Cited by 50 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Role of transcription factor Nrf2 in the induction of hepatic phase 2 and antioxidative enzymes in … - Full text - MIT Libraries
MK Kwak, K Itoh, M Yamamoto, TR Sutter, TW Kensler - Mol. Med, 2001 - muse.jhu.edu
... nuclear factor; NFE2, NF-E2 consensus sequence; GST, glutathione S-transferase;
NQO1, NAD(P)H:quinone oxidoreductase; UGT1A6, UDP-glucuronyltransferase 1A6; mEH ...
Cited by 48 - Web Search - muse.jhu.edu - molmed.org - ncbi.nlm.nih.gov
ZF, C1, VCAF, CFF 11 NP_067035 127 77
J Bacteriol, J Virol, E Cell, AASM Journals - intl-mcb.asm.org
... S-MAF, MAFK, NFE2U, p18, 7, NP_002351.1, 49, 40. MAFG, 17, NP_002350.1, 49, 46. ... NRF1,
NFE2L1, TCF11, LCR-F1, 17, NP_003195.1, 652, 53. NFE2, p45, 12, XP_028656, ...
Cached - Web Search
Isolation of NF-E2-Related Factor 2 (Nrf2), a NF-E2-Like Basic Leucine Zipper Transcriptional … - Full text - MIT Libraries
P Moi, K Chan, I Asunis, A Cao, YW Kan - Proceedings of the National Academy of Sciences - pnas.org
... Home page, Blood Home page MR Loyd, Y. Okamoto, MS Randall, and PA Ney Role of
AP1/NFE2 binding sites ... REGULATION BY Nrf2 AND MafG TRANSCRIPTION FACTORS J. Biol. ...
Cited by 167 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Transgenic expression of BACH1 transcription factor results in megakaryocytic impairment - Full text - MIT Libraries
T Toki, F Katsuoka, R Kanezaki, G Xu, H Kurotaki, … - Blood, 2005 - bloodjournal.org
... Small maf mutant mice, as well as mafG and mafG::mafK compound ... Primers (5' to 3')
were as follows: nfe2-1, ATTTTCCACCCCTCCGTCAACC and GTGATCTCAGCTCGTTGCAACCTC ...
Cited by 1 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
R ole du facteur de transcription NF-E2 dans la formation des plaquettes
CNC Cap’n’collar - medecine/sciences, 1998 - ist.inserm.fr
... Human MafG is a functional partner for p45 NF-E2 in activating globin gene ... NRF2,
a member of the NFE2 family of transcription factors, is not essential for ...
View as HTML - Web Search
Functional and placental expression analysis of the human NRF3 transcription factor - Full text - MIT Libraries
B Chenais, A Derjuga, W Massrieh, K Red-Horse, V … - Molecular Endocrinology - mend.endojournals.org
... mechanism in Chinese hamster ovary cells: regulation by Nrf2 and MafG transcription
factors ... K, Lu R, Chang JC, Kan YW 1996 NRF2, a member of the NFE2 family of ...
Web Search - mend.endojournals.org - dx.doi.org - ncbi.nlm.nih.gov
The Saga of Leucine Zippers Continues - Full text - MIT Libraries
LE Otterbein, AMK Choi - Am. J. Respir. Cell Mol. Biol, 2002 - ajrcmb.atsjournals.org
... Maf family proteins (MafF, MafG, and MafK) recognize DNA sequence motif called MARE
5'-TGCTGAG ... proteins, from the "classic AP-1" to ARE to MARE to NFE2 to Nrf2 ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov
Expression of the Aflatoxin B-8, 9-Epoxide-Metabolizing Murine Glutathione S-Transferase A3 Subunit … - Full text - MIT Libraries
IR Jowsey, Q Jiang, K Itoh, M Yamamoto, JD Hayes - Mol Pharmacol, 2003 - molpharm.aspetjournals.org
... Second, EMSA analyses demonstrated association of the mGSTA3 ARE with Nrf2/MafG. ...
oxidativestress response in red blood cells from p45 NFE2-deficient mice. ...
Cited by 4 - Web Search - intl-molpharm.aspetjournals.org - ncbi.nlm.nih.gov
Complexity of CNC Transcription Factors As Revealed by Gene Targeting of the Nrf3 Locus - Full text - MIT Libraries
A Derjuga, TS Gourley, TM Holm, HHQ Heng, RA … - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... NRF2, a member of the NFE2 family of transcription factors, is not ... Small Maf (MafG
and MafK) proteins negatively regulate antioxidant response element-mediated ...
Cited by 2 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov
Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of … - Full text - MIT Libraries
MK Kwak, K Itoh, M Yamamoto, TW Kensler - Mol. Cell. Biol, 2002 - mcb.asm.org
... NRF2, a member of the NFE2 family of transcription factors, is not ... Small Maf (MafG
and MafK) proteins negatively regulate antioxidant response element-mediated ...
Cited by 29 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular Mechanisms Activating the Nrf 2-Keap 1 Pathway of Antioxidant Gene Regulation
M Kobayashi, M Yamamoto - Antioxidants & Redox Signaling, 2005 - dx.doi.org
... subunit was shown to be one of the small Maf proteins, MafK, MafG, or MafF ... NRF2,
a member of the NFE2 family of transcription factors, is not essen- tial for ...
Cited by 3 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The``ß-Like-Globin''Gene Domain in Human Erythroid Cells - Full text - MIT Libraries
D Tuan, W Solomon, Q Li, IM London - J. Biol. Chem, 2004 - pnas.org
... Home page, Blood Home page MR Loyd, Y. Okamoto, MS Randall, and PA Ney Role of
AP1/NFE2 binding sites in endogenous {alpha}-globin gene transcription Blood ...
Cited by 45 - Web Search
REGULATION OF MEGAKARYOCYTE AND ERYTHROID DIFFERENTIATION BY NF-E2
SWE KIM, RA SHIVDASANI - doi.wiley.com
... The known small-Maf proteins MafK (p18 NF-E2),MafG,and MafF are composed of
149-162 amino acids,have a molecular mass of 18—20 kD,and share 60— 70% amino ...
Web Search
REGULATION OF GENE EXPRESSION BY REACTIVE OXYGEN - Full text - MIT Libraries
TP Dalton, HG Shertzer, A Puga… - Annual Review of Pharmacology and Toxicology, 1999 - pharmtox.annualreviews.org
Annual Reviews tagline graphic, ...
Cited by 223 - Web Search - pharmtox.annualreviews.org - ncbi.nlm.nih.gov
A strategy for cancer prevention: Stimulation of the Nrf2-ARE signaling pathway - Full text - MIT Libraries
Y Zhang, GB Gordon - Mol Cancer Ther, 2004 - mct.aacrjournals.org
... NRF2, a member of the NFE2 family of transcription factors, is not ... Small maf (MafG
and MafK) proteins negatively regulate antioxidant response element-mediated ...
Cited by 3 - Web Search - mct.aacrjournals.org - ncbi.nlm.nih.gov
Genetic dissection of systemic autoimmune disease in Nrf2-deficient mice - Full text - MIT Libraries
J Li, TD Stein, JA Johnson - Physiol Genomics, 2004 - physiolgenomics.physiology.org
... 22). Other known factors related to the nrf2 signaling pathway (nrf1, nrf3,
mafG, mafI, mafK, ... YW. NRF2, a member of the NFE2 family ...
Cited by 8 - Web Search - physiolgenomics.physiology.org - ncbi.nlm.nih.gov
The story so far: molecular regulation of the heme oxygenase-1 gene in renal injury - Full text - MIT Libraries
EM Sikorski, T Hock, N Hill-Kapturczak, A Agarwal - Am J Physiol Renal Physiol, 2004 - intl-ajprenal.physiology.org
... In the mouse HO-1 gene, the E1 and E2 regions are required for heme-mediated
HO-1 induction (7-9). Recent studies have identified Nrf2, MafG, ATF3, as well as ...
Cited by 14 - Web Search - dx.doi.org - intl-ajprenal.physiology.org - ncbi.nlm.nih.gov - all 5 versions »
Nrf 2 Regulates Thromboxane Synthase Gene Expression in Human Lung Cells
M Yaekashiwa, LH Wang - DNA and Cell Biology, 2003 - dx.doi.org
... It forms a heterodimer with a small Maf protein (MafF, MafG, or MafK, which ... NRF2,
a member of the NFE2 family of transcription factors, is not essential ...
Cited by 1 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Nrf1 is critical for redox balance and survival of liver cells during development - Full text - MIT Libraries
L Chen, M Kwong, R Lu, D Ginzinger, C Lee, L Leung … - Mol Cell Biol, 2003 - mcb.asm.org
... CNC-bZIP factors control transcription from an extended AP-1-like site
[TGCTGA(G/C)TCA(T/C)] called the NFE2 site and form heterodimers with other bZIP ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... product TATA 01 Cellular and viral TATA box elements TATA B General TATA box TCF11
01 TCF11/KCR-F1/Nrf1 homodimers TCF11MAFG 01 TCF11/MafG heterodimers TH1E47 ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Erk Activation Is Required for Nrf 2 Nuclear Localization during Pyrrolidine Dithiocarbamate … - Full text - MIT Libraries
LM Zipper, RT Mulcahy - Toxicological Sciences, 2003 - toxsci.oupjournals.org
... consisting of Cap-N-Collar family members (Nrf1, Nrf2, NFE2-p45) and other b ... Small
maf (MafG and MafK) proteins negatively regulate antioxidant response element ...
Cited by 9 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - all 8 versions »
[BOOK] Transcription factors: normal and malignant development of blood cells
K Ravid, J Licht - 2001 - print.google.com
Page 1. TRANSCRIPTION FACTORS I!I!i!i 1”IIIII Page 2. TRANSCRIPTION FACTORS
NORMAL AND MALIGNANT DEVELOPMENT OF BLOOD CELLS Edited ...
Web Search - Get it from MIT Libraries - Library Search
The Cap'n'Collar basic leucine zipper transcription factor Nrf2 (NF-E2 p45-related factor 2) … - Full text - MIT Libraries
M McMahon, K Itoh, M Yamamoto, SA Chanas, CJ … - Cancer Res, 2001 - cancerres.aacrjournals.org
... [Abstract/Free Full Text]; Dhakshinamoorthy S., Jaiswal AK Small Maf (MafG, and
MafK ... Text]; Chan K., Lu R., Chang JC, Kan YW NRF2, a member of the NFE2 family of ...
Cited by 66 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
DNA-dependent adenosine triphosphatase (helicaselike transcription factor) activates beta-globin … - Full text - MIT Libraries
MC Mahajan, SM Weissman - Blood, 2002 - bloodjournal.org
Abstract of this Article ( ). PDF Version of this Article. Citation Map. Email this
article to a friend. Similar articles found in: Blood Online PubMed. ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Nrf2 Transcription Factor, a Novel Target of Keratinocyte Growth Factor Action Which Regulates Gene … - Full text - MIT Libraries
S Braun, C Hanselmann, MG Gassmann, U auf dem … - Mol Cell Biol, 2002 - mcb.asm.org
... NRF2, a member of the NFE2 family of transcription factors, is not essential for ...
Interaction of the CNC-bZIP factor TCF11/LCR-F1/Nrf1 with MafG: binding-site ...
Cited by 6 - Web Search - pubmedcentral.nih.gov - icbxs.ethz.ch - dx.doi.org - all 5 versions »
Supporting Online Material
JRS Newman, AE Keating - sciencemag.org
... p21SNFT 29 29 DBP HLF TEF 11 11 MafG 31 31 MafK 31 31 cMaf 33 33 MafB 34 34
NFE2-p45 36 36 NFE2L1 46 NFE2L2 NFE2L3 BACH1 BACH2 0 . 6 3 n M 0 . 1 6 n M ...
Web Search - sciencemag.org
Induction of Cytoprotective Genes Through Nrf2/Antioxidant Response Element Pathway: A New …
XL Chen, C Kunsch - Current Pharmaceutical Design, 2004 - ingentaconnect.com
Page 1. Current Pharmaceutical Design, 2004, 10, 879-891 879 1381-6128/04
$45.00+.00 © 2004 Bentham Science Publishers Ltd. Induction ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Xenobiotic Receptors in Fishes: Structural and Functional Diversity and Evolutionary Insights
ME Hahn, RR Merson, SI Karchner, ME Hahn, WHO … - whoi.edu
Page 1. Revised November 2003 Xenobiotic Receptors in Fishes: Structural
and Functional Diversity and Evolutionary Insights Mark ...
View as HTML - Web Search
Did you mean to search for: MFG and NFE2
|
©2005 Google