![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 106 for MYB and GATA3. (0.10 seconds) |
Cooperative binding of c-Myb and Pax-5 activates the RAG-2 promoter in immature B cells - Full text - MIT Libraries
H Kishi, ZX Jin, XC Wei, T Nagata, T Matsuda, S … - Blood, 2002 - bloodjournal.org
... of mouse RAG-2 confers lymphoid specificity and may be regulated with distinct
transcription factors: Pax-5 18 , 19 in B cells and GATA3 18 or c-Myb 20 in T ...
Cited by 9 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov
… -1 binds and activates the recombination-activating gene-2 promoter together with c-Myb and Pax-5 in … - Full text - MIT Libraries
ZX Jin, H Kishi, XC Wei, T Matsuda, S Saito, A … - J. Immunol, 2002 - jimmunol.org
... of mouse RAG-2 confers lymphoid specificity and may be regulated with distinct
transcription factors: Pax-5 (18, 19) in B cells and GATA3 (18) or c-Myb (20) in ...
Cited by 7 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Distinct Roles for c-Myb and Core Binding Factor/Polyoma Enhancer-Binding Protein 2 in the Assembly … - Full text - MIT Libraries
C Hernandez-Munain, MS Krangel - J Immunol, 2002 - jimmunol.org
... c-Myb and core-binding factor/PEBP2 display functional synergy but bind independently ...
The human enhancer-binding protein Gata3 binds to several T-cell receptor ...
Cited by 4 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Regulation of the Murine D {delta} 2 Promoter by Upstream Stimulatory Factor 1, Runx1, and c-Myb - Full text - MIT Libraries
J Carabana, E Ortigoza, MS Krangel - The Journal of Immunology, 2005 - jimmunol.org
... Regulation of the Murine D 2 Promoter by Upstream Stimulatory Factor 1, Runx1, and
c-Myb 1. ... Myb, LEF, Runx, NF1, E47, and USF bind to the D 2 promoter in vitro. ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Table 1. Ets1 interacting proteins
H GM-CSF - pubmedcentral.nih.gov
... forms ternary complex with Ets1 and Sp1, enhances GATA3/Ets1 cooperation. ... LEF-1.
TCRa. LEF-1 induces DNA-bending that facilitates Ets1/ATF2 interaction. [48]. c- ...
Web Search
Separation de Sources pour l’Analyse de Donnees d’Expression
P Chiappetta, MC Roubaud, B Torresani - irisa.fr
... linéaires (par exemple, les coefficients de corrélation entre ESR1, GATA3,
XBP1 et MYB sont compris entre j §ph " k et h " lQm ). ...
View as HTML - Web Search - cmi.univ-mrs.fr
Conservation of Breast Cancer Molecular Subtypes and Transcriptional Patterns of Tumor Progression … - Full text - MIT Libraries
K Yu, CH Lee, PH Tan, P Tan - Clinical Cancer Research, 2004 - clincancerres.aacrjournals.org
... Asian-Chinese population within the Caucasian data set, after removal of several
well-known ER marker genes (ie, ESR1, GATA3, TFF1, TFF3, XBP1, MYB, IGFR1, MUC1 ...
Cited by 1 - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
A complex linkage in the developmental pathway of endothelial and hematopoietic cells
SI Nishikawa - Curr Opin Cell Biol, 2001 - cbi.pku.edu.cn
... On the other hand, roles for c-myb and GATA2 in vascular development have not been
documented, although GATA2 is expressed in ... [16] observed GATA3 expression in ...
Cited by 19 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Regulation of Human Immunodeficiency Virus Type-1 Gene Expression
SM Kingsman, AJ Kingsman - European Journal of Biochemistry, 1996 - blackwell-synergy.com
Page 1. Eur. J. Biochem. 240, 491-507 (1996) 0 FEBS 1996 Review The regulation
of human immunodeficiency virus type- 1 gene expression ...
Cited by 54 - Web Search - content.febsjournal.org - ejbiochem.org - ingentaconnect.com - all 5 versions » - Get it from MIT Libraries
L ENTIVIRUS R EPLICATION AND R EGULATION - Full text - MIT Libraries
H Tang, KL Kuhen, F Wong-Staal - Annual Review of Genetics, 1999 - genet.annualreviews.org
... These include TCF-1, USF, NF-AT, ILF-1, GRE, AP-1, COUP-TF, RAR, NRT1/2, T cell
factor B, myb, and GATA3 (8, 46, 78, 118, 146, 197, 204, 254). ...
Cited by 42 - Web Search - genet.annualreviews.org - ncbi.nlm.nih.gov
Blind Source Separation and the Analysis of Microarray Data - Full text - MIT Libraries
P Chiappetta, MC Roubaud, B Torresani - Journal of Computational Biology, 2004 - dx.doi.org
Page 1. JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 © Mary Ann Liebert,
Inc. Pp. 1090–1109 Blind Source Separation and the Analysis of ...
Cited by 1 - Web Search - liebertonline.com - cmi.univ-mrs.fr - ncbi.nlm.nih.gov - all 5 versions »
Gene expression profiling of primary breast carcinomas using arrays of candidate genes - Full text - MIT Libraries
F Bertucci, R Houlgatte, A Benziane, S Granjeaud, … - Human Molecular Genetics, 2000 - hmg.oupjournals.org
... GATA3, which is not estrogen regulated (25), is a transcription factor which could ...
that we found associated with ER status, some, such as MYB (10), stromelysin ...
Cited by 58 - Web Search - hmg.oupjournals.org - ncbi.nlm.nih.gov
Supplementary Material
C Thisse, LI Zon - sciencemag.org
... Despite expression in primitive erythroid cells, c-myb is not required for the genesis
of the ... Lymphoid cells express ikaros, Gata3, rag1, rag2, and lck (12, 13 ...
Web Search
Gene expression profiles of poor-prognosis primary breast cancer correlate with survival - Full text - MIT Libraries
F Bertucci, V Nasser, S Granjeaud, F Eisinger, J … - Human Molecular Genetics, 2002 - hmg.oupjournals.org
... Subtypes of ER-positive breast tumours have recently been reported by others using
discriminator genes such as ESR1, GATA3, XBP1 or MYB, also present in our ...
Cited by 41 - Web Search - hmg.oupjournals.org - ncbi.nlm.nih.gov
[PS] Classification mixte pour l’analyse de donnees d’expression
P Chiappetta, MC Roubaud, B Torresani - Proc. JOBIM’02, 2002 - cmi.univ-mrs.fr
... Le gène ESR1 est regroupé avec les gènes ANG, C4A, EGF, GLI3, MUC1, KRT19, BCL2,
GATA3, ILF1, MYB, SMARCA2, THBS1, VIL2, XBP1, IGFBP2, AMFR, PLAT,FOS. ...
Cited by 1 - View as HTML - Web Search
Vergleichende funktionelle und molekulare Charakterisierung humaner Zelllinienmodelle aus dem …
I Mathematik, S Physik - edoc.ub.uni-muenchen.de
... GATA2, GATA3, beta globin, Elf-1 und PECAM1 wurden in einem stärkeren Maß in der
Rh123low als in der Rh123high Population exprimiert. BMP-Rez., Myb, sowie ...
Cached - Web Search
IRF Regulation of HIV-1 Long Terminal Repeat Activity
A BATTISTINI, G MARSILI, M SGARBANTI, B ENSOLI, J … - JOURNAL OF INTERFERON AND CYTOKINE RESEARCH, 2002 - dx.doi.org
... positively and negatively (46,47) acting cellular transcriptionfac- tors, including
adaptor protein-1 (AP-1), T cell factor B, Gata3, Myb, upstream stimulating ...
Cited by 4 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Expression of the Runt domain-encoding PEBP2 genes in T cells during thymic development - Full text - MIT Libraries
M Satake, S Nomura, Y Yamaguchi-Iwai, Y Takahama, … - Mol. Cell. Biol, 1995 - mcb.asm.org
... GATA3 (12, 16, 20, 24, 47), TCF1/LEF-1 (33, 40, 41, 44, 45), Ikaros (6 ... Similarly,
PEBP2/CBF and c-Myb cooperate for the T-cell- specific expression of TCR (10). ...
Cited by 20 - Web Search
Associations between gene expressions in breast cancer and patient survival - Full text - MIT Libraries
TK Jenssen, WP Kuo, T Stokke, E Hovig - Hum Genet, 2002 - springerlink.com
... IFNGR1 H11482 1.5 E-08 Low 3 GATA3 H72474 1.9 E-08 High 3 TMSB10 AA486085 1.9
E-08 Low 3 ... SCYB14 W72294 7.4 E-07 High 3 MYB N49284 9.5 E-07 High 2 ...
Cited by 13 - Web Search - pubgeneserver.uio.no - pubgene.com - idi.ntnu.no - all 6 versions »
A Placenta-Specific Enhancer of the Human Syncytin Gene - Full text - MIT Libraries
YH Cheng, S Handwerger, S Handwerger - BIOLOGY OF REPRODUCTION, 2005 - biolreprod.org
... The expression vectors for mouse GATA2 and human GATA3 were kindly provided ...
Olignucleotide-directed mutagenesis of the SP1, ETS2, MYB ( v-myb ...
Web Search - biolreprod.org - ncbi.nlm.nih.gov
Transcription factors in hematopoiesis
I Engel, C Murre - Curr. Opin. Genet. Dev, 1999 - www-biology.ucsd.edu
... The c-Myb-null ES cells also failed to contribute to the B-cell or ... 2 expression in
T-cell acute lymphoblastic leukemia by acting as cofactors for GATA3. ...
Cited by 10 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
CD4/CD8-LINEAGE DIFFERENTIATION IN THE THYMUS: FROM NUCLEAR EFFECTORS TOMEMBRANE SIGNALS - Full text - MIT Libraries
R Bosselut - molecules - nature.com
... the identification of transcription factors required for CD4 gene silencing by
CD8-lineage cells (RUNX3) or for CD4 + T-cell differentiation (GATA3), and a ...
Cited by 4 - Web Search - nature.com - ncbi.nlm.nih.gov
Reciprocal Expression of Human ETS1 and ETS2 Genes During T-Cell Activation: Regulatory Role for the … - Full text - MIT Libraries
NK Bhat, CB Thompson, T Lindsten, CH June, S … - Proceedings of the National Academy of Sciences - pnas.org
... ETS1 AND ETS2, BUT NOT ELF-1, COOPERATE WITH GATA3 AND HTLV-I TAX1 J. Biol. ... EMBO
J. Home page AA Postigo, AM Sheppard, ML Mucenski, and DC Dean c-Myb and Ets ...
Cited by 53 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - adsabs.harvard.edu - all 5 versions »
Elf-1 binds to a critical element in a second CD4 enhancer - Full text - MIT Libraries
AL Wurster, G Siu, JM Leiden, SM Hedrick - Mol. Cell. Biol, 1994 - pubmedcentral.nih.gov
... Myb and Ets proteins cooperate in transcriptional activation of the mim-1 promoter. ...
Text]; Marine J, Winoto A. The human enhancer-binding protein Gata3 binds to ...
Cited by 51 - Web Search - ncbi.nlm.nih.gov
Sparse graphical models for exploring gene expression data
A Dobra, C Hans, B Jones, JR Nevins, M West - J. Multiv. Anal, 2004 - samsi.info
Page 1. Technical Report #2003-7 October 23, 2003 Statistical and Applied Mathematical
Sciences Institute PO Box 14006 Research Triangle Park, NC 27709-4006 ...
Cited by 18 - View as HTML - Web Search - stat.duke.edu - stat-ftp.berkeley.edu - portal.acm.org - all 9 versions »
Arthur Sackler Colloquia Home Help [Feedback][For Subscribers][Archive][Search][Contents] - Full text - MIT Libraries
A Skapenko, J Leipe, U Niesner, K Devriendt, R … - J. Exp. Med, 2004 - pnas.org
... Home page C. Hernandez-Munain and MS Krangel Distinct Roles for c-Myb and Core ... in
T-Cell Acute Lymphoblastic Leukemia by Acting as Cofactors for GATA3 Mol. ...
Web Search
Regulation of T Cell Receptor delta Gene Rearrangement by CBF/PEBP2 - Full text - MIT Libraries
P Lauzurica, XP Zhong, MS Krangel, JL Roberts - Regulation, 1997 - intl.jem.org
... Because mutation of the E3 binding site for the transcription factor c-Myb had
previously established a similar role for c-Myb, and because a 60-bp fragment of ...
Cited by 15 - Web Search - dx.doi.org - intl.jem.org - ncbi.nlm.nih.gov
Human T cell transcription factor GATA-3 stimulates HIV-1 expression - Full text - MIT Libraries
Z Yang, JD Engel - Nucleic Acids Res, 1993 - pubmedcentral.nih.gov
... Myb protein binds to human immunodeficiency virus 1 long terminal repeat (LTR)
sequences ... Marine J, Winoto A. The human enhancer-binding protein Gata3 binds to ...
Cited by 10 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Human TAF II 28 interacts with the human T cell leukemia virus type I Tax transactivator and … - Full text - MIT Libraries
C Caron, G Mengus, V Dubrowskaya, A Roisin, I … - Proc. Natl. Acad. Sci. USA, 1997 - dx.doi.org
... ETS1 AND ETS2, BUT NOT ELF-1, COOPERATE WITH GATA3 AND HTLV-I TAX1 J. Biol ... Adf-1
Is a Nonmodular Transcription Factor That Contains a TAF-Binding Myb-Like Motif ...
Cited by 18 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
A low-density DNA microarray for analysis of markers in breast cancer
M Lacroix, N Zammatteo, J Remacle, G Leclercq - Int J Biol Markers, 2002 - geocities.com
... VEGF receptor 3 FN1 Fibronectin 1 Adhesion 2q34 9306263 GATA3 GATA-binding protein
3 10p15 10037815 GJA1 Gap junction protein, alpha 1, 43kDa; ...
Cited by 6 - View as HTML - Web Search - geocities.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... AHRARNT MYCMAX 1424.3 HSF2 NFAT 170.3 BRN2 HNF1 56.6 ISRE MYB 28.7 ... MZF1
SP1 1089.2 CREBP1 XBP1 146.8 GATA3 NFY 51.9 AML1 E47 27.3 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
Identification and Characterization of the Hematopoietic Cell-Specific Enhancer-Like Element of the … - Full text - MIT Libraries
A Sato, VW Keng, T Yamamoto, S Kasamatsu, T Ban, H … - Journal of Biochemistry, 2004 - jb.oupjournals.org
... DW, Scott, WJ, Jr., and Potter, SS (1991) A functional c-myb gene is ... FG, Engel, JD,
and Lindenbaum, MH (1995) Targeted disruption of the GATA3 gene causes ...
Web Search - jb.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Gene expression signature of estrogen receptor α status in breast cancer - Full text - MIT Libraries
M Abba, Y Hu, H Sun, J Drake, S Gaddis, K Baggerly … - BMC Genomics, 2005 - biomedcentral.com
... over-expression in ERα (+) breast carcinomas: estrogen receptor 1 (ESR1), GATA-binding
protein 3 (GATA3), mucin 1 (MUC1), v-myb-myeloblastosis viral oncogene ...
Cached - Web Search - dx.doi.org - pubmedcentral.nih.gov - citebase.eprints.org - all 7 versions »
Erythropoietin receptor signalling is required for normal brain development - Full text - MIT Libraries
X Yu, JJ Shacka, JB Eells, C Suarez-Quian, RM … - Development, 2002 - dev.biologists.org
... GAG GGT CTC TTC A-3'; reverse primer, 5'-CCT CTA GGT GGG CAG GTG G-3'; probe,
5'-GGG TAA CTT CCA GCT ATG GCT GTT GCA AC-3'. The human GATA3 primer sequences ...
Cited by 51 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
BMC Genomics - Full text - MIT Libraries
MC Abba, Y Hu, H Sun, JA Drake, S Gaddis, K … - BMC Genomics, 2005 - biomedcentral.com
... displaying over-expression in ERα (+) breast carcinomas: estrogen receptor 1 (ESR1),
GATA-bind- ing protein 3 (GATA3), mucin 1 (MUC1), v-myb-myeloblast- osis ...
View as HTML - Web Search - sciencepark.mdanderson.org
TRANSCRIPTIONAL REGULATION OF T LYMPHOCYTE DEVELOPMENT AND FUNCTION - Full text - MIT Libraries
CT Kuo, JM Leiden - Annual Review of Immunology, 1999 - immunol.annualreviews.org
... These factors include GATA2, c-myb, Tal-1/Scl, AML1, and PU.1. The ... Two transcription
factors, Ikaros and GATA3, have been implicated in the earliest stages of ...
Cited by 125 - Web Search - immunol.annualreviews.org - ncbi.nlm.nih.gov
ORIGINAL ARTICLE Expression of human pim family genes is selectively up-regulated by cytokines … - Full text - MIT Libraries
TLT Aho, RJ Lund, EK Ylikoski, S Matikainen, R … - Immunology, 2005 - blackwell-synergy.com
... be induced by IL-4 and to promote Th2-cell expansion in synergy with GATA3. ... Dautry
F, Weil DYuJ, Dautry-Varsat A. Regulation of pim and myb mRNA accumulation ...
Web Search
Basal and luminal breast cancers: basic or luminous?(review). - Full text - MIT Libraries
D BIRNBAUM, F BERTUCCI, C GINESTIER, R TAGETT, J … - INTERNATIONAL JOURNAL OF ONCOLOGY, 2004 - 147.52.72.117
... GATA3 genes and comprises the gene encoding the transcription factor GATA4 (31). ...
that the same transcription networks (eg GATA, RUNX, CEBP, MYB, AGO…) and ...
Cited by 2 - View as HTML - Web Search - ncbi.nlm.nih.gov
GATA-1: Friends, Brothers, and Coworkers - Full text - MIT Libraries
F MORCEAU, M SCHNEKENBURGER, M DICATO, M DIEDERICH - Ann. NY Acad. Sci, 2004 - annalsnyas.org
... They suggested that binding of GATA-1 or c-Myb to CBP might be important for
hematopoietic differentiation and ... Structure and expression of the human GATA3 gene ...
Web Search - annalsnyas.org - ncbi.nlm.nih.gov
The Biology of the Ets 1 Proto-Oncogene - Full text - MIT Libraries
J Dittmer - Molecular Cancer, 2003 - dx.doi.org
... ester and ionomycin are needed for the cooperative effect of Ets1 with GATA3 on
the ... ZEB-induced Ets1 repression can be relieved by c-Myb, a protein that can ...
Cited by 18 - Web Search - pubmedcentral.nih.gov - molecular-cancer.com - citebase.eprints.org - all 11 versions »
Genetic lineage of poorly differentiated gastric carcinoma with a tubular component analysed by … - Full text - MIT Libraries
DF Peng, H Sugihara, K Mukaisho, ZQ Ling, T … - The Journal of Pathology, 2004 - doi.wiley.com
... Other amplifications of genes/markers detected in 35% or more of the cases by array
CGH were PIK3CA (3q), LAMC2 (1q), D5S23 (5p), FGFR2 (10q), MYB (6q), NRAS ...
Cited by 1 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... AAGTT not AAGT PPARA 01 PPAR/RXR heterodimers Core should be AAAGGT not
AAAG VMYB 02 v-Myb Core should be AACGG not AACG MYT1 01 B ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Functional characterization of the human phosphodiesterase 7A1 promoter - Full text - MIT Libraries
M Torras-Llort, F Azorin - Biochem. J, 2003 - biochemj.org
... NFAT-1 ATGTGCTGTAAAGAACACTGTAAAGAGCTGAAAAACTCTGGTCTTGAGATACTGTGTGGTAT
GGTGGAAAACGCATGGCTCTGAAATCATAGACCAGAGT GATA3 ... GATA3 NFAT-1 ...
Cited by 3 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genomic structure of mouse PIR-A6, an activating member of the paired immunoglobulin-like receptor … - Full text - MIT Libraries
MD Cooper, H Kubagawa - Tissue Antigens, 2003 - ingentaconnect.com
... These include hemopoiesis-specific factors (eg, MZF-1, c-Myb, Ikaros 2, NF-Y, GATA,
C/EBPb (30–32)); and ubiquitous factors (eg, AP-1 (Jun/Fos), NF-kB ...
Web Search - david.niaid.nih.gov - apps1.niaid.nih.gov - ncbi.nlm.nih.gov
Determination of lymphoid cell fate is dependent on the expression status of the IL-7 receptor - Full text - MIT Libraries
SJ Purohit, RP Stephan, HG Kim, BR Herrin, L … - The EMBO Journal, 2003 - embojournal.npgjournals.com
... Further studies will be necessary to integrate the roles of other signaling molecules
(like Notch1) and transcription factors (like GATA3 and c-myb) into a ...
Cited by 2 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 6 versions »
Identification of Cis-Element Regulating Expression of the Mouse Fgf10 Gene during Inner Ear …
H Ohuchi, A Yasue, K Ono, S Sasaoka, S Tomonari, A … - Key words, 2005 - doi.wiley.com
... hand, a zinc-finger transcription fac- tor, GATA3 is expressed in the sen- sory
domain of the developing inner ear and involved in specification of au- ditory ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The‘definitive’(and‘primitive’) guide to zebrafish hematopoiesis - Full text - MIT Libraries
AJ Davidson, LI Zon - Oncogene, 2004 - nature.com
... also expressed in the dorsal aorta during this time, including c-myb (Thomp- son ...
detected by examining the expression of genes such as ikaros, gata3, lck, and ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
Graphical model-based gene clustering and metagene expression analysis
A Dobra, Q Wang, M West - 2004 - isds.duke.edu
Page 1. A. Dobra et al. Graphical model-based gene clustering and metagene
expression analysis Adrian Dobra, Quanli Wang and Mike West ...
Cited by 1 - View as HTML - Web Search - stat.duke.edu - stat.duke.edu - isds.duke.edu - all 5 versions »
Origin and evolution of avian microchromosomes - Full text - MIT Libraries
DW Burt, FTC Alert - Cytogenetic and Genome Research, 2002 - content.karger.com
... GNRH1 1 8 14 Schmid et al. 2000 GATA3 1 10 2 Schmid et al. 2000 WNT11 1 11 7 10,
5 Schmid et al. ... ME1 3 6 9 Schmid et al. 2000 MYB 3 6 10 23 Schmid et al. 2000 ...
Cited by 21 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
The hare and the tortoise: an embryonic haematopoietic race - Full text - MIT Libraries
I Godin, A Cumano - Nat Rev Immunol, 2002 - nature.com
... | PubMed | ISI | ChemPort |. 27. Mucenski, ML et al. A functional c-myb gene is
required for normal murine fetal hepatic hematopoiesis. Cell 65, 677-689 (1991). ...
Cited by 26 - Web Search - nature.com - ncbi.nlm.nih.gov
| |
©2005 Google