![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 90 for MYC and HOXA5. (0.13 seconds) |
Hoxa5 overexpression correlates with IGFBP1 upregulation and postnatal dwarfism: evidence for an … - Full text - MIT Libraries
I Foucher, M Volovitch, M Frain, JJ Kim, JC … - Development, 2002 - dev.biologists.org
... of heterozygous B4B2A5m mice: transient growth arrest and dwarfism The regulatory
elements used to drive the ectopic expression of Myc-tagged Hoxa5 (Hoxa5m) in ...
Cited by 10 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Regulation of the Hoxa4 and Hoxa5 Genes in the Embryonic Mouse Lung by Retinoic Acid and TGF 1: …
AI PACKER, KG MAILUTHA, LA AMBROZEWICZ, DJ … - Key words, 2000 - doi.wiley.com
... Transcription factors such as N-myc (Moens et al., 1992); TTF-1 (Minoo et al., 1995);
Gli2 and 3 (Motoyama et al., 1998); Hoxa5 (Aubin et al., 1997); and the ...
Cited by 12 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Stomach regional specification requires Hoxa5-driven mesenchymal-epithelial signaling - Full text - MIT Libraries
J Aubin, U Dery, M Lemieux, P Chailler, L … - Development, 2002 - dev.biologists.org
Stomach regional specification requires Hoxa5-driven mesenchymal-epithelial
signaling. ... 1. Hoxa5 expression in the developing stomach. ...
Cited by 11 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Overexpression of translocation-associated fusion genes of FGFRI, MYC, NPMI, and DEK, but absence of … - Full text - MIT Libraries
ML Larramendy, T Niini, E Elonen, B Nagy, J Ollila … - Haematologica, 2002 - haematologica.org
... Overexpression of translocation- associated fusion genes of FGFR1, MYC, NPM1, and
DEK, but absence of the translocations in acute myeloid leukemia. ...
Cited by 10 - View as HTML - Web Search - haematologica.it - haematologica.org - ncbi.nlm.nih.gov - all 10 versions »
Identification of N-myc Regulatory Regions Involved in Embryonic Expression - Full text - MIT Libraries
J CHARRON, JF GAGNON, JF CADRIN-GIRARD - Pediatric Research, 2002 - pedresearch.org
... cis-acting regulatory regions are required for restricted spatio-temporal Hoxa5
gene expression. ... RK 1995 Cell type-specific activity of the N-myc promoter in ...
Cited by 1 - Web Search - pedresearch.org - ncbi.nlm.nih.gov
Early postnatal lethality in Hoxa-5 mutant mice is attributable to respiratory tract defects - Full text - MIT Libraries
J Aubin, M Lemieux, M Tremblay, J Berard, L … - Dev Biol, 1997 - ncbi.nlm.nih.gov
... Proteins; Homeodomain Proteins; Hoxa5 protein, mouse; Nuclear Proteins;
Phosphoproteins; Proto-Oncogene Proteins c-myc; Transcription ...
Cited by 40 - Web Search - ncbi.nlm.nih.gov
Identificacao de Mensagens Induzidas
ID Louro, APS Louro, JLO Lima - rsbcancer.com.br
... Northern blot de diferentes linhagens celulares mostra que PTC é especificamente
induzido por GLI (painel A); HOXA5 é induzido por MYC (painel B); e BMP4 é ...
Cached - Web Search
Current concepts on lung development
D Warburton, MK Lee - Curr Opin Pediatr, 1999 - co-pediatrics.com
... Epithelial expression of TTF-1, HNF-3β, and N-myc were also distorted. Because Hoxa5
expression is restricted to the lung mesenchyme, the null mutant ...
Cited by 13 - Web Search - co-pediatrics.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Lineage-Restricted Expression of Homeobox-Containing Genes in Human Hematopoietic Cell Lines - Full text - MIT Libraries
WF Shen, C Largman, P Lowney, JC Corral, K Detmer, … - J. Biol. Chem, 2004 - pnas.org
... P. Malik, PK Pattengale, DB Kohn, and JC Gasson Constitutive HOXA5 Expression Inhibits ...
Home page Q. Pan and RU Simpson c-myc Intron Element-binding Proteins ...
Cited by 37 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Distinction of acute lymphoblastic leukemia from acute myeloid leukemia through microarray-based DNA … - Full text - MIT Libraries
CSINM Burger, EBBD Wolf-Dieter, LS Maier - Ann Hematol, 2005 - springerlink.com
... 1 Hypermethylated in cancer 1 NM_019102 HOXA5 Homeo box A5 (HOXA5) NM_000612 IGF2 ...
MOS v-mos Moloney murine sarcoma viral oncogene homolog NM_002467 MYC v-myc ...
Web Search - ncbi.nlm.nih.gov
Neutrophil lactoferrin upregulates the human p53 gene through induction of NF-jB activation cascade - Full text - MIT Libraries
SM Oh, CW Pyo, Y Kim, SY Choi - Oncogene, 2004 - nature.com
Page 1. Neutrophil lactoferrin upregulates the human p53 gene through induction
of NF-jB activation cascade Sang-Muk Oh 1 , Chul-Woong ...
Web Search - ncbi.nlm.nih.gov
Proteolytic Cleavage of MLL Generates a Complex of N-and C-Terminal Fragments That Confers Protein … - Full text - MIT Libraries
JDH James, P Ernst, H Erdjument-Bromage, P Tempst, … - Mol Cell Biol, 2003 - mcb.asm.org
... some of the well-recognized targets of wt MLL, including HOXA4, HOXA5, and HOXA9
(1 ... potential of MLL chimeric proteins (7). In contrast, Mll-exon8 Myc mice in ...
Cited by 20 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Joint regulation of the MAP1B promoter by HNF3ss/Foxa2 and Engrailed is the result of a highly … - Full text - MIT Libraries
I Foucher, ML Montesinos, M Volovitch, A … - Development, 2003 - dev.biologists.org
... of monoclonal antibodies specific for human c-myc proto-oncogene ... Hoxa5 overexpression
correlates with IGFBP1 upregulation and postnatal dwarfism: evidence for ...
Cited by 3 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The STATs of cancer—new molecular targets come of age - Full text - MIT Libraries
H Yu, R Jove - Nat Rev Cancer, 2004 - nature.com
1. Bishop, JM The molecular genetics of cancer. Science 235, 305–311 (1987). |
PubMed | ISI | ChemPort |. 2. Vogelstein, B. & Kinzler ...
Cited by 51 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Human securin interacts with p 53 and modulates p 53-mediated transcriptional activity and apoptosis - Full text - MIT Libraries
JA Bernal, R Luna, A Espina, I Lazaro, F Ramos- … - Nature Genetics, 2002 - nature.com
... | Article | PubMed | ISI | ChemPort |; Pei, L. Identification of c-myc as a down ...
Compromised HOXA5 function can limit p53 expression in human breast tumors. ...
Cited by 27 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genes, chromatin, and breast cancer: an epigenetic tale
LM Mielnicki, HL Asch, BB Asch - J Mammary Gland Biol Neoplasia, 2001 - kluweronline.com
... of aberrant DNA methylation and histone deacetylation to c-myc expression in ... The
homeotic gene, HoxA5,is important for proper specification of the axial skele ...
Cited by 10 - Web Search - springerlink.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Amplification of PPM 1 D in human tumors abrogates p 53 tumor-suppressor activity - Full text - MIT Libraries
DV Bulavin, ON Demidov, S Saito, P Kauraniemi, C … - Nature Genetics, 2002 - nature.com
... Compromised HOXA5 function can limit p53 expression in human breast. ... Myc is an essential
negative regulator of platelet-derived growth factor. Mol. Cell. Biol. ...
Cited by 37 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - nature.com
GEArray Q series Mouse p53 Signaling Pathway Gene Array: AR-SAMM-027
FG Grouping - eurogentec.be
... p53 expression: Hoxa5, Nfkb1 ... p53 interactions: Apex (Ref-1), Bap1, Brap, Brca1, Cdkn2a
(p14ARF), E2f1, Hmgb1, Mdm2, Myc, Rasa1 (Ras), Rb1 (pRB), Tead1 (SV40 ...
View as HTML - Web Search - eurogentec.com
MLL, Hox genes, and leukemia: the plot thickens - Full text - MIT Libraries
JL Hess - Blood, 2004 - bloodjournal.org
... outside the Hox genes, such as Lmo2, Flt3, and N-Myc, that possibly ... however, MLL
fusion proteins up-regulate multiple Hox genes (including Hoxa5, Hoxa7, Hoxa9 ...
Web Search
GEArray Q series Mouse p53 Signaling Pathway Gene Array Cat. No.* Kit Size MM-027-2/MM-027N-2 2 …
FG Grouping - tebu-bio.com
... p53 upstream signal/p53 modifiers: p53 expression: Hoxa5, Nfkb1 ... Apex (Ref-1), Bap1,
Brap, Brca1, Cdkn2a (p14ARF), E2f1, Hmgb1, Mdm2, Myc, Rasa1 (Ras), Rb1 (pRB ...
View as HTML - Web Search
GEArray Q series Mouse p53 Signaling Pathway Gene Array
FG Grouping - cosmobio.co.jp
... p53 expression: Hoxa5, Nfkb1 ... p53 interactions: Apex (Ref-1), Bap1, Brap, Brca1, Cdkn2a
(p14ARF), E2f1, Hmgb1, Mdm2, Myc, Rasa1 (Ras), Rb1 (pRB), Tead1 (SV40 ...
View as HTML - Web Search - superarray.com - cosmobio.co.jp - superarray.com
Additional hox clusters in the zebrafish: divergent expression patterns belie equivalent activities …
AEE Bruce, AC Oates, VE Prince, RK Ho - Evolution and Development, 2001 - blackwell-synergy.com
... enzymes, subcloned into pCS2+ and pCS2+MT (which produces a myc epitope-tagged ... In
addition, the sequence of hoxB5b (previously identified as hoxa5, Prince et al ...
Cited by 11 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Human Homeobox HOXA 7 Regulates Keratinocyte Transglutaminase Type 1 and Inhibits Differentiation - Full text - MIT Libraries
PT La Celle, RR Polakowska - J Biol Chem, 2001 - jbc.org
... forward (GGCGCTGACATGGATCTTCTTCATCC) and reverse (CAACTACATCGAGCCCAAGTTCCCTCC),
HOXA5 forward (CCTCTCTGCTGCTGATGTGGGTGC ... overexpressed as a c-myc fusion (pCS ...
Cited by 9 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Implication des genes Hox dans les processus d’organogenese chez les mammiferes
J Aubin, L Jeannotte - Medecine/Sciences, 2001 - ist.inserm.fr
... est diminuée, alors que celle du gène N-myc aug- mente. L’expression de ces gènes
est limitée à l’épithélium, alors que celle de Hoxa5 durant la ...
Cited by 4 - View as HTML - Web Search
The neuronal microtubule-associated protein 1B is under homeoprotein transcriptional control - Full text - MIT Libraries
ML Montesinos, I Foucher, M Conradt, G Mainguy, L … - J. Neurosci, 2001 - jneurosci.org
... driven myc-tagged chick En2 (pCL9mEn2) (Mainguy et al., 2000 ), En2 HD1 (pCL9mEn2
H1; derived from pTL1mEn2 H1) (Joliot et al., 1998 ), and mouse Hoxa5 (pCL9A5m ...
Cited by 10 - Web Search - jneurosci.org - ncbi.nlm.nih.gov
HOXB13 is downregulated in colorectal cancer to confer TCF4-mediated transactivation - Full text - MIT Libraries
C Jung, RS Kim, H Zhang, SJ Lee, H Sheng, PJ … - British Journal of Cancer, 2005 - nature.com
... cells, SW480 cells showed much less downregulation of c-myc protein expression in ...
studies have reported that some HOX proteins, including HOXA5, HOXB6, HOXB8 ...
Web Search - nature.com - ncbi.nlm.nih.gov
Transcriptional regulation during myelopoiesis
N Lenny, JJ Westendorf, SW Hiebert - Mol Biol Rep, 1997 - springerlink.com
... genes, including CD34, CD13/APN, mim-1, c-myc, cdc2, CD4 ... For example, antisense
oligonucleotides against HOXA5 simultaneously inhibited myeloid colony formation ...
Cited by 41 - Web Search - kluweronline.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Correlation of expression of BP 1, a homeobox gene, with estrogen receptor status in breast cancer - Full text - MIT Libraries
S Fu, A Schwartz, H Stevenson, J Pinzone, G … - Breast Cancer Res, 2003 - dx.doi.org
... Raman V, Martensen SA, Reisman D, Evron E, Odenwald WF, Jaffee E, Marks J, Sukumar
S: Compromised HOXA5 function can ... Liao DJ, Dickson RB: c-Myc in breast cancer ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - breast-cancer-research.com - bmc.ub.uni-potsdam.de - all 10 versions »
Transcription factors in mouse lung development and function - Full text - MIT Libraries
RH Costa, VV Kalinichenko, L Lim - Am J Physiol Lung Cell Mol Physiol, 2001 - ajplung.physiology.org
... of TTF-1, HNF-3 and N-myc (5), suggesting that HFH-8 may also regulate
mesenchyme-mediated lung epithelial cell development through regulation of the Hoxa5 ...
Cited by 62 - Web Search - ajplung.physiology.org - lungtranscriptome.bwh.harvard.edu - ncbi.nlm.nih.gov
Targeting STAT3 affects melanoma on multiple fronts
M Kortylewski, R Jove, H Yu - Cancer and Metastasis Reviews, 2005 - springerlink.com
... In melanoma cells, it has been shown that cyclin D1 be- comes upregulated, together
with c-Myc and several ... It has been shown that lack of HOXA5 gene expression ...
Web Search - ingentaconnect.com
Targeted down-regulation of MLL-AF9 with antisense oligodeoxyribonucleotide reduces the expression …
H Kawagoe, R Kawagoe, K Sano - nature.com
... while the knock-in of the N-terminal truncated MLL fused to a MYC-tag did not ...
Homeodomain-free cDNA probes of HOXA5 and -A9 32 were made by RT-PCR with the ...
Web Search - nature.com
Identification of a Novel Homeobox-Containing Gene, LAGY, Which Is Downregulated in Lung Cancer - Full text - MIT Libraries
Y Chen, S Petersen, M Pacyna-Gengelbach, A Pietas, … - Oncology, 2003 - content.karger.com
... The loss of the HOXA5 gene causes disruption in mesen- chymal-epithelial signaling,
leading to decreased TTF-1, HNF-3B and N-myc expression in pulmonary ...
Cited by 5 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
A Role for p 53 in Maintaining and Establishing the Quiescence Growth Arrest in Human Cells - Full text - MIT Libraries
K Itahana, GP Dimri, E Hara, Y Itahana, Y Zou, PY … - J Biol Chem, 2002 - jbc.org
... Where indicated, extracts were preincubated with 0.1 g of p53 (Ab6; DO-1) or Myc
(Ab1) antibodies (Calbiochem) for 1 h on ice prior to binding. ...
Cited by 18 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Progress in Hematology
Y Hayashi - cardenjennings.metapress.com
... differences in expression [13].The genes HOXA9 and HOXA5 were not ... ALLs, including
overexpressed oncogene [HOXA9, MEIS1, HOXA10, LMO2(RMBT2), MYC, LGALSI, PDGFR ...
Web Search
Amplification of PPM1D in human tumors abrogates p53 tumor-suppressor activity - Full text - MIT Libraries
N Genetics - Nature Genetics, 2002 - nature.com
... To determine whether PPM1D has oncogenic potential, we co-infected retroviruses
containing PPM1D and different oncogenes, including H-rasV12, MYC or NEU1, into ...
Web Search - nature.com
Transcriptional Control of the Cell Cycle in Mammary Gland Development and Tumorigenesis
RD Coletta, P Jedlicka, A Gutierrez-Hartmann, HL … - Journal of Mammary Gland Biology and Neoplasia, 2004 - springerlink.com
... are also altered in breast cancer (see Steroid Receptor and C-myc articles in ... While
HOXA5 expression has been detected in normal mammary cells in culture (37,43 ...
Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Insulin inhibition of Foxo1-stimulated transcription is not solely due to nuclear exclusion - Full text - MIT Libraries
W TSAI, N BHATTACHARYYA, LIY HAN, JA HANOVER, MM … - Endocrinology, 2003 - endo.endojournals.org
... permeabilized in 0.5% Triton X-100. Myc-tagged Foxo1 was visualized using anti-myc ...
α (59, 72), the androgen receptor (72), Hoxa5 (73) and Hoxa10 (74). ...
Cited by 1 - Web Search - endo.endojournals.org
The Androgen Receptor Gene is Preferentially Hypermethylated in Follicular Non-Hodgkin’s Lymphomas - Full text - MIT Libraries
H Yang, CM Chen, P Yan, TH Huang, H Shi, M Burger, … - Clin Cancer Res, 2003 - 140.120.130.112
... NM_006497 HIC-1 17p13.3 Hypermethylated in cancer 1 NM_019102 HOXA5 7p15 Homeo
box A5, mRNA ... NM_002467 MYC 8q24.12 c-myc proto-oncogene gene ...
Cited by 3 - View as HTML - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Inhibition of Human p 53 Basal Transcription by Down-regulation of Protein Kinase C {delta} - Full text - MIT Libraries
T Abbas, D White, L Hui, K Yoshida, DA Foster, J … - J Biol Chem, 2004 - sonhouse.hunter.cuny.edu
... human p53 transcription including AP-1, HoxA5, YY1, NFκB, and Myc (40).
Using a human p53 promoter luciferase construct containing ...
Cited by 5 - View as HTML - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 8 versions »
Supplementary Data ‘Stemness’: Transcriptional Profiling of Embryonic and Adult Stem Cells
M Ramalho-Santos, S Yoon, Y Matsuzaki, RC Mulligan … - intl.sciencemag.org
... p21, the Ap-1 components Fos, FosB, Jun and JunB, Myc, N-Myc, Meis1, and
Yes. Strikingly, ... th , LCB=6.9) and HoxA5 (172 nd , LCB=4.4). ...
Web Search
The amyloid precursor protein interacts with G o heterotrimeric protein within a cell compartment … - Full text - MIT Libraries
E Brouillet, A Trembleau, D Galanaud, M Volovitch, … - J. Neurosci, 1999 - jneurosci.org
... below) were incubated overnight at 4°C with an anti-myc monoclonal antibody ... The HoxA5
sequence present in pTmHoxA5R (Chatelin et al., 1996 ) was deleted (SacI ...
Cited by 41 - Web Search - jneurosci.org - ncbi.nlm.nih.gov
Genes expressed in the developing endocrine pancreas and their importance for stem cell and diabetes …
JM Wells - Diabetes/Metabolism Research and Reviews, 2003 - doi.wiley.com
... Bin1 Myc box–dependent interacting protein 1 (u86405) Delta Id Inhibitor of DNA
binding 3 (M60523) Foxa2, 3 Forkhead box A2, A3 (NM 010446, MN 008260) Hoxa5, ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa 7 and Hoxa 9 - Full text - MIT Libraries
PM Ayton, ML Cleary - Genes & Development, 2003 - genesdev.org
... Multiple Hoxa cluster genes (Hoxa1, Hoxa3, Hoxa5, Hoxa7, Hoxa9, Hoxa10, and Hoxa11)
were ... with the BCR-ABL kinase or wild-type c-MYC, respectively (Felsher and ...
Cited by 27 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation … - Full text - MIT Libraries
AC Brun, JM Bjornsson, M Magnusson, N Larsson, P … - Blood, 2004 - bloodjournal.org
... Constitutive HOXA5 expression inhibits erythropoiesis and increases myelopoiesis
from human ... HOXB4 blocks 1,25-dihydroxyvitamin D3 inhibition of c-myc expression ...
Cited by 8 - Web Search - dx.doi.org - ncbi.nlm.nih.gov - lu-research.lub.lu.se - all 6 versions »
Meis1-mediated apoptosis is caspase-dependent and can be suppressed by coexpression of HoxA9 in … - Full text - MIT Libraries
PJ Wermuth, AM Buchberg - Blood, 2005 - bloodjournal.org
... The c-myc proto-oncogene cotransforms cells with a variety of proteins (eg, Max
and activated H-ras), activating proliferation pathway gene transcription. ...
Cited by 3 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Breast cancer gene discovery
K Polyak - Expert Reviews in Molecular Medicine, 2002 - journals.cambridge.org
... CDH1 Mutation/methylation Cell adhesion 60, 64 17q- erbB2 Amplification Receptor
tyrosine kinase 73, 121 8q-c-myc Amplification Transcription factor 73, 122 ...
Cited by 1 - Web Search - expertreviews.org - www-ermm.cbcu.cam.ac.uk - dx.doi.org - all 7 versions »
Recruitment of octamer transcription factors to DNA by glucocorticoid receptor - Full text - MIT Libraries
GG Prefontaine, ME Lemieux, W Giffin, C Schild- … - Mol Cell Biol, 1998 - mcb.asm.org
... prospero enhances the DNA binding of the homeodomain proteins Dfd and HoxA5 in the ...
and GR with the L501P mutation (GR L501P ) with N-terminal c-myc tags (pMTG ...
Cited by 48 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Molecular targets as therapeutic strategies in the management of breast cancer
SM Russo, R Ove - Expert Opinion on Therapeutic Targets, 2003 - dx.doi.org
... protein is a tran- scription regulator for a number of genes, including GADD-45
(growth-arrest and DNA damage-inducible gene), p21, MDM2, BAX, c-Myc and c ... HOXA5 ...
Web Search - extenza-eps.com - ashley-pub.com - ingentaconnect.com - all 10 versions »
The Molecular Basis for Abnormal Human Lung Development - Full text - MIT Libraries
F Groenman, S Unger, M Post, M Post, F Alert - Biology of the Neonate, 2005 - content.karger.com
... Mouse studies for Hox show that Hoxa5–/– mice have laryngotracheal malformations
and lung ... involved in the branching morpho- genesis are GATA-6 and N-myc. ...
Web Search - content.karger.com - dx.doi.org - ncbi.nlm.nih.gov
MLL: How complex does it get? - Full text - MIT Libraries
R Popovic, NJ Zeleznik-Le - Journal of Cellular Biochemistry, 2005 - doi.wiley.com
... downregulation of more 5 0 Hoxa and Hoxc cluster genes (Hoxa5, -a7, -a9 ... However,
myc fusion with MLL does not lead to leukemia, indicating that stability of the ...
Web Search
| |
©2005 Google