![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 90 for MYC and KLF4. (0.19 seconds) |
Comparative gene expression profile analysis of GLI and c-MYC in an epithelial model of malignant … - Full text - MIT Libraries
ID Louro, EC Bailey, X Li, LS South, PR McKie-Bell … - Cancer Res, 2002 - cancerres.aacrjournals.org
... with endogenous GLI in Ptch-deficient murine fibroblasts or in human skin tumors,
but are not up-regulated in RK3E cells transformed by c-MYC, KLF4, or HRAS1. ...
Cited by 19 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
KLF 2 inhibits Jurkat T leukemia cell growth via upregulation of cyclin-dependent kinase inhibitor p … - Full text - MIT Libraries
J Wu, JB Lingrel - Oncogene, 2004 - nature.com
... Many tumor suppressors, such as AP2, BRCA1, c-myc, KLF4 and KLF6, contribute to
cell cycle and growth suppression through the induction of p21 WAF1/CIP1 . ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
Transcription factor LKLF is sufficient to program T cell quiescence via a c-Myc-dependent pathway - Full text - MIT Libraries
AF Buckley, CT Kuo, JM Leiden - Nat. Immunol, 2001 - nature.com
... 4. Segre, J., Bauer C. & Fuchs, E. Klf4 is a transcription factor required for ... Berns,
K., Hijmans, EM & Bernards, R. Repression of c-Myc responsive genes in ...
Cited by 24 - Web Search - nature.com - ncbi.nlm.nih.gov
Identification of MoKA, a novel F-box protein that modulates Kruppel-like transcription factor 7 … - Full text - MIT Libraries
S Smaldone, F Laub, C Else, C Dragomir, F Ramirez - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... MoKA-Flag was transfected together with either KLF7-Myc or KLF4 expression
vectors into COS7 cells with Lipofectamine 2000 (Invitrogen). ...
Cited by 1 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Nuclear localization of KLF4 is associated with an aggressive phenotype in early-stage breast cancer - Full text - MIT Libraries
AY Pandya, LI Talley, AR Frost, TJ Fitzgerald, V … - Clin Cancer Res, 2004 - intl-clincancerres.aacrjournals.org
... A functional screen identified multiple independent cDNA clones of KLF4 and c-MYC,
implicating these molecules as major transforming activities in the human ...
Cited by 4 - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Developmental signals in skin morphogenesis - Full text - MIT Libraries
M Chidgey, C Brakebusch, E Gustafsson… - Experimental Dermatology, 2004 - blackwell-synergy.com
... In this report, they show that keratin 5 promoter-driven ectopic Klf4 expression
causes ... C, Li ER, Arnold I, Watt F M. Evidence that Myc activation depletes the ...
Web Search
Structure and Regulation of the Envoplakin Gene - Full text - MIT Libraries
A Maeaettae, C Ruhrberg, FM Watt - J Biol Chem, 2000 - jbc.org
... probe (NS). Moreover, the complexes were not affected by antibodies against
upstream stimulatory factor-1 (Usf), c-Myc, or Klf4. ...
Cited by 13 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Live and let die in the intestinal epithelium
E Sancho, E Batlle, H Clevers - Curr Opin Cell Biol, 2003 - cbi.pku.edu.cn
... a role in the terminal differentiation of these cells, such as KLF4 and ELF-3 ... the
expression of several target genes, including those expressing c-Myc or EphB2 ...
Cited by 28 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Ectopic expression of Kruppel like factor 4(Klf 4) accelerates formation of the epidermal … - Full text - MIT Libraries
J Jaubert, J Cheng, JA Segre - Development, 2003 - dev.biologists.org
... vitro studies and microinjection. A unique BamHI and a Myc tag were inserted
into the Klf4 cDNA by PCR. This fragment was inserted ...
Cited by 6 - Web Search - dx.doi.org - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
GETTING UNDER THE SKIN OF EPIDERMAL MORPHOGENESIS - Full text - MIT Libraries
E Fuchs, S Raghavan - Nature Reviews Genetics, 2002 - nature.com
... 13. Waikel, RL, Kawachi, Y., Waikel, PA, Wang, XJ & Roop, DR Deregulated expression
of c-Myc depletes epidermal stem cells. Nature Genet. 28, 165-168 (2001). ...
Cited by 72 - Web Search - nature.com - ncbi.nlm.nih.gov
Transcriptional control of epidermal specification and differentiation.
X Dai, JA Segre - Curr Opin Genet Dev, 2004 - ncbi.nlm.nih.gov
... Based on the skin phenotype observed with misregulation of transcription factors
such as p63, c-Myc, RelA, pRb, Klf4 and others, their function in controlling ...
Web Search - Get it from MIT Libraries
Cell and molecular biology of the small intestine: new insights into differentiation, growth and …
JR Walters - Curr Opin Gastroenterol, 2004 - co-gastroenterology.com
... Nuclear β-catenin was absent, c-Myc expression inhibited, and p21 up-regulated. ... The
gut-enriched Krüppel-like factor KLF4 is also involved in expression of ...
Cited by 1 - Web Search - co-gastroenterology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Krueppel-like factors 4 and 5: the yin and yang regulators of cellular proliferation
AM GHALEB, MO NANDAN, S CHANCHEVALAP, WB DALTON, … - cell-research.com
... transformation of a host with epithelial fea- tures by c-MYC and the ... Nuclear
localization of KLF4 is associated with an aggressive phenotype in early-stage ...
View as HTML - Web Search - cell-research.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcriptional repression of WEE 1 by Kruppel-like factor 2 is involved in DNA damage-induced … - Full text - MIT Libraries
F Wang, Y Zhu, Y Huang, S McAvoy, WB Johnson, TH … - Oncogene, 2005 - nature.com
... repressors, including the nuclear DEAF-1-related (NUDR) protein Elk-1, Myc-associated
zinc ... is the third member of the KLF family, in addition to KLF4 and KLF6 ...
Web Search - nature.com - ijp-online.com - ncbi.nlm.nih.gov
Induction of KLF 4 in basal keratinocytes blocks the proliferation–differentiation switch and … - Full text - MIT Libraries
KW Foster, Z Liu, CD Nail, X Li, TJ Fitzgerald, SK … - Oncogene, 2005 - nature.com
... To generate a 4-OHT-dependent allele, the protein-coding region of KLF4 was amplified
by PCR, incorporating a myc epitope tag at the N-terminus and BamHI sites ...
Web Search - nature.com - ncbi.nlm.nih.gov
Sp1/Krueppel 样转录因子家族研究进展 - Full text - MIT Libraries
张安平, 张连阳 - J Biochem (Tokyo), 1995 - wjgnet.com
... KLF4也可通过抑制组氨酸脱乙酰化酶的启动子发挥抑 制因子的功能
[39] . KLF13 可激活如 ... by c-MYC and the ...
View as HTML - Web Search - wjgnet.com - wjgnet.com - wjgnet.com
Regulation of quiescence in lymphocytes - Full text - MIT Libraries
I Yusuf, DA Fruman - Trends Immunol, 2003 - mbb.bio.uci.edu
... (2002) B Cell growth is controlled by phos- phatidylinosotol 3-kinase-dependent
induction of Rel/NF-kB regulated c-myc transcription. Mol. ... (1999) Klf4 is a ...
Cited by 14 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Gene expression profiling of plasma cell dyscrasias reveals molecular patterns associated with … - Full text - MIT Libraries
M Mattioli, L Agnelli, S Fabris, L Baldini, F … - Oncogene, 2005 - nature.com
... expressed in MGUS versus PCL PCs, several encode for MYC molecular targets ... The highest
consistency was reached by Kruppel- like factor 4 (KLF4), a zinc-finger ...
Cited by 3 - Web Search - nature.com - ncbi.nlm.nih.gov
Intestinal stem cells and mucosal gut development.
A Vidrich, JM Buzan, SM Cohn - Current Opinion in Gastroenterology, 2003 - co-gastroenterology.com
... regulation of c-myc transcription; protein stability; and c-myc transactivation
of ... Another example is the zinc-finger transcription factor, Klf4, required for ...
Web Search - co-gastroenterology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Drastic Down-regulation of Krueppel-Like Factor 4 Expression Is Critical in Human Gastric Cancer … - Full text - MIT Libraries
D Wei, W Gong, M Kanai, C Schlunk, L Wang, JC Yao, … - Cancer Research, 2005 - cancerres.aacrjournals.org
... growth inhibitory effect of epithelial-type Kruppel-like transcription factor KLF4,
but not ... transformation of a host with epithelial features by c-MYC and the ...
Cited by 1 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
Krueppel-like Zinc Fingers Bind to Nuclear Import Proteins and Are Required for Efficient Nuclear … - Full text - MIT Libraries
KJ Quadrini, JJ Bieker - J. Biol. Chem, 2002 - jbc.org
... Next, all three zinc fingers were fused to Myc-PK, and cells were analyzed for ... for
the nuclear localization of the closely related protein GKLF/KLF4 (36), all ...
Cited by 10 - Web Search - jbc.org - ncbi.nlm.nih.gov
Recent findings in the cell and molecular biology of the small intestine.
JRF Walters - Current Opinion in Gastroenterology, 2005 - co-gastroenterology.com
... the original crypt-villus axis, expressing Ki-67, c-Myc and EphB3 ... These studies include
investigations of GATA-factors, KLF4, glucocorticoid-, retinoid-, thyroid ...
Web Search - co-gastroenterology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Increase of GKLF messenger RNA and protein expression during progression of breast cancer - Full text - MIT Libraries
KW Foster, AR Frost, P McKie-Bell, CY Lin, JA … - Cancer Res, 2000 - cancerres.aacrjournals.org
... rat kidney RK3E cells: transformation of a host with epithelial features by c-MYC
and the zinc ... [Abstract/Free Full Text]; Segre JA, Bauer C., Fuchs E. Klf4 is a ...
Cited by 26 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Histone deacetylase inhibitors, anticancerous mechanism and therapy for gastrointestinal cancers - Full text - MIT Libraries
JY FANG - Journal of Gastroenterology and Hepatology, 2005 - blackwell-synergy.com
... No variation of transcription levels of p53, p73, c-myc, c-Ki ... significantly attenuated
transcriptional activation of Kruppel-like factor-4 (KLF4) promoter by ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
FONDATION RENE TOURAINE POUR LA RECHERCHE EN DERMATOLOGIE
T BERGADERM, LP FABRE, L ROCHE, L SEROBIOLOGIQUES - ingentaconnect.com
... that keratin 5 promoter-driven ectopic Klf4 expression causes com- petent barrier
formation ... C, Li ER, Arnold I, Watt F M. Evidence that Myc activation depletes ...
Web Search - ingentaconnect.com
Early Genetic Mechanisms Underlying the Inhibitory Effects of Endostatin and Fumagillin on Human … - Full text - MIT Libraries
CM Mazzanti, A Tandle, D Lorang, N Costouros, D … - Genome Research, 2004 - genome.org
... We selected four genes (DOC1, KLF4, TC-1, ID1) from the microarray profile ... 2002 ),
inhibition of metalloproteinases, and down-regulation of c-myc and cyclin D1 ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Fibroblast growth factor receptor 3 inhibition by short hairpin RNAs leads to apoptosis in multiple … - Full text - MIT Libraries
L Zhu, G Somlo, B Zhou, J Shao, V Bedell, ML … - Mol Cancer Ther, 2005 - mct.aacrjournals.org
... down-regulation of MYC and JUN, as well as changes in several genes not commonly
associated with multiple myeloma (ie, SAS, GADD45A, TLR4, and KLF4; Table 1 ...
Web Search - mct.aacrjournals.org - ncbi.nlm.nih.gov
Acid Suppression and Chemoprevention in Barrett’s Oesophagus
ARJ Jankowski - Dig Dis, 2004 - content.karger.com
... This is supported by data showing that COX-2 induction and c-myc up-regulation only
occurs when bile is acidified [55, 56], and not at neutral pH. ... (KLF4) [99]. ...
Web Search - content.karger.com
Downregulation of gut-enriched Kruppel-like factor expression in esophageal cancer - Full text - MIT Libraries
N Wang, ZH Liu, F Ding, XQ Wang, CN Zhou, M Wu - World J Gastroenterol, 2002 - wjgnet.com
... cells: transforma- tion of a host with epithelial features by c-MYC and the ... The
tissue-dependent keratin 19 gene transcription is regulated by GKLF/KLF4 and Sp1 ...
Cited by 8 - View as HTML - Web Search - wjgnet.com - wjgnet.com - ncbi.nlm.nih.gov - all 6 versions »
Acid Suppression and Chemoprevention in Barrett's Oesophagus
F Alert, GR Disease - Digestive Diseases, 2004 - content.karger.com
... of the oncogene c-myc in Barrett's adenocarcinoma: induction of c-myc by acidified ...
W, Liu Y, Langois M, Wang T: Kruppel-like factor 4(KLF4) represses histidine ...
Web Search - karger.com
Gene expression of TPA induced differentiation in HL-60 cells by DNA microarray analysis - Full text - MIT Libraries
X Zheng, R Ravatn, Y Lin, WC Shih, A Rabson, R … - Nucleic Acids Research, 2002 - nar.oupjournals.org
... Reh, to a mature non-dividing state (7). Differential regulation of c-myc, c-max ...
factors E12/E47, tcf3) (16), Kruppel-like zinc finger factor (KLF4) (17) and ...
Cited by 9 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Down-regulation of gamma-synuclein in human esophageal squamous cell carcinoma - Full text - MIT Libraries
CQ Zhou, S Liu, LY Xue, YH Wang, HX Zhu, N Lu, NZ … - World J Gastroenterol, 2003 - wjgnet.com
... and tumor suppressor genes are closely related to ESCC, such as c-myc, cyclin D1 ...
was also observed in many other studies, among which GKLF/ KLF4 (gut-enriched ...
Cited by 3 - View as HTML - Web Search - wjgnet.com - wjgnet.com - ncbi.nlm.nih.gov - all 6 versions »
Down-regulation of g-synuclein in human esophageal squamous cell carcinoma
CQ Zhou, S Liu, YH Wang, HX Zhu, NZ Xu, LY Xue, N … - wjgnet.com
... tumor suppressor genes are closely related to ESCC, such as c-myc, cyclin D1 ... status
was also observed in many other studies, among which GKLF/KLF4 (gut-enriched ...
Cached - Web Search - wjgnet.com
Tetracycline-Regulated Gene Expression in Epidermal Keratinocytes
RB Presland, P Fleckman - Methods Mol Biol, 2005 - journals.humanapress.com
... enhancer, or with or without epitope tags such as c-myc (see Subheading ... JA (2003)
Ectopic expression of Kruppel like factor 4 (Klf4) accelerates formation of
Web Search - biomed.humanapress.com - now.humanapress.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Identification of a Genetic Signature of Activated Signal Transducer and Activator of Transcription … - Full text - MIT Libraries
JV Alvarez, PG Febbo, S Ramaswamy, M Loda, A … - Cancer Research, 2005 - cancerres.aacrjournals.org
... Finally, other transcription factors, including myc, jun, and ... forward
GCAGGGATCTTTCACTTCCA and reverse GCTGAATGCACAAAGAGCAG; KLF4: forward ...
Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
Gut-enriched Kruppel-like factor represses cyclin D 1 promoter activity through Sp 1 motif - Full text - MIT Libraries
JL Shie, ZY Chen, M Fu, RG Pestell, CC Tseng - Nucleic Acids Research, 2000 - nar.oupjournals.org
... enriched Krüppel-like factor (GKLF; also named Krüppel-like factor 4, KLF4) is a ...
Recently, c-MYC has been found to be a downstream target of the adenomatous ...
Cited by 51 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
The Transcription Factor Snail Induces Tumor Cell Invasion through Modulation of the Epithelial Cell … - Full text - MIT Libraries
B De Craene, B Gilbert, C Stove, E Bruyneel, F van … - Cancer Research, 2005 - cancerres.aacrjournals.org
... B, staining with an anti-cMyc antibody reveals nuclear staining for the Myc-tagged
hSnail ... It is likely that some key factors, such as KLF4, are involved in the ...
Web Search - cancerres.aacrjournals.org
Differentiation-dependent activation of the human intestinal alkaline phosphatase promoter by HNF-4 … - Full text - MIT Libraries
L Olsen, S Bressendorff, JT Troelsen, J Olsen - Am J Physiol Gastrointest Liver Physiol, 2005 - ajpgi.physiology.org
... The IF-III region with the KLF4 site is therefore not sufficient to secure a ... Schroeder
M, Fernandez P, Taubert S, and Amati B. Binding of c-Myc to chromatin ...
Web Search - ajpgi.physiology.org - ncbi.nlm.nih.gov
Transcription Factor KLF7 Is Important for Neuronal Morphogenesis in Selected Regions of the Nervous … - Full text - MIT Libraries
F Laub, L Lei, H Sumiyoshi, D Kajimura, C Dragomir … - Mol Cell Biol, 2005 - mcb.asm.org
... 30, 31, 61); terminal differentiation of dermal and intestinal epithelia (KLF4)
(28, 53 ... was cotransfected into NIH 3T3 cells together with the Myc-tagged KLF7 ...
Web Search - mcb.asm.org - ncbi.nlm.nih.gov
Twists and turns in the development and maintenance of the mammalian small intestine epithelium
AL Hauck, KS Swanson, PJA Kenis, DE Leckband, HR … - Birth Defects Research Part C Embryo Today Reviews, 2005 - doi.wiley.com
... inhibitor noggin Villi are wider, blunted, contain invaginations of proliferative
cells, ectopic crypts expressing c-myc, ki-69 ... Relationship to KLF4 expression ...
Web Search - scs.uiuc.edu - swinegenomics.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Gene expression signatures identify novel regulatory pathways during murine lung development: … - Full text - MIT Libraries
AE Bonner, WJ Lemon, M You - Journal of Medical Genetics, 2003 - math.unm.edu
... The upregulation of these transcription factors as well as Klf4 and Math5 may lead ...
mental processes in various tissues, targeting such genes as c-myc, cyclin D ...
Cited by 6 - View as HTML - Web Search - dx.doi.org - jmedgenet.com - jmg.bmjjournals.com - all 8 versions »
Gut-enriched Kruppel-like Factor Represses Ornithine Decarboxylase Gene Expression and Functions as … - Full text - MIT Libraries
ZY Chen, JL Shie, CC Tseng - J Biol Chem, 2002 - jbc.org
... GKLF (KLF4) is a recently identified and developmentally regulated transcription
factor (9). Several ... such as ras (25), fos (26), mos (27), and myc (28, 29 ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Analysis of gene-expression profiles in testicular seminomas using a genome-wide cDNA microarray - Full text - MIT Libraries
K Okada, T Katagiri, T Tsunoda, Y Mizutani, Y … - Int J Oncol, 2003 - 147.52.72.117
... D87116 MAP2K3 Mitogen-activated protein kinase kinase 3 AA845512 KLF4 Kruppel-like ...
oncogene homolog A (ras related) M13228 MYCN v-myc avian myelocytomatosis ...
Cited by 4 - View as HTML - Web Search - virology.med.uoc.gr - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Synergistic activation of the rat laminin gamma 1 chain promoter by the gut-enriched Kruppel-like … - Full text - MIT Libraries
Y Higaki, D Schullery, Y Kawata, M Shnyreva, C … - Nucleic Acids Research, 2002 - nar.oupjournals.org
... F. (2000) Transcriptional regulation of the CLC-K1 promoter by myc-associated zinc ...
dependent keratin 19 gene transcription is regulated by GKLF/KLF4 and Sp1. ...
Cited by 11 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Stem cells in the skin: waste not, Wnt not - Full text - MIT Libraries
L Alonso, E Fuchs - Development, 2003 - dx.doi.org
... 2001 ); and the proliferation-associated transcription factor, c-myc
(Gandarillas and Watt 1997 ). ... These include c-myc (He et al. ...
Cited by 35 - Web Search - genesdev.org - genesdev.org - ncbi.nlm.nih.gov - all 6 versions »
Molecular characterizations of derivatives of HCT116 colorectal cancer cells that are resistant to … - Full text - MIT Libraries
PM de Angelis, B Fjell, KL Kravik, T Haug, SH … - Int J Oncol, 2004 - 147.52.72.117
... c-MYC/8q24 from Vysis Inc., Downers Grove, IL) and spectrum orange-labeled
locus-specific MALT1/18q21 (kindly provided by Dr E. Galteland ... IL18 -1.3 KLF4 -2.4 ...
Cited by 5 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
APC10. 1: AN Apc Min/INTESTINAL CELL LINE WITH RETENTION OF HETEROZYGOSITY - Full text - MIT Libraries
C De Giovanni, L Landuzzi, G Nicoletti, A Astolfi, … - Int. J. Cancer, 2004 - doi.wiley.com
... Page 5. be related to the high expression of Klf4, an epithelial-specific
transcription factor, which in turn is induced by APC. 26,27 More- ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Postnatal Gene Expression in the Normal Mouse Cornea by SAGE - Full text - MIT Libraries
B Norman, J Davis, J Piatigorsky - Investigative Ophthalmology & Visual Science, 2004 - intl.iovs.org
... Table 3) . The six most abundant transcriptional regulators at PN9 included myocyte
enhancer factor 2 (MEF2; n = 38), kruppel-like factor 4 (KLF4; n = 33), Pax ...
Cited by 7 - Web Search - dx.doi.org - iovs.org - ncbi.nlm.nih.gov - all 6 versions »
Target genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal … - Full text - MIT Libraries
B Mann, M Gelos, A Siedow, ML Hanski, A Gratchev, … - Clin. Cancer Res, 2005 - dx.doi.org
... S. Jamaluddin, and DD Boyd The Kruppel-like KLF4 Transcription Factor, a Novel
Regulator of Urokinase Receptor Expression, Drives Synthesis of This Binding ...
Cited by 232 - Web Search - pnas.org - pubmedcentral.nih.gov - all 7 versions »
Gene expression profile analysis of mouse colon embryonic development - Full text - MIT Libraries
YK Park, JL Franklin, SH Settle, SE Levy, E Chung, … - genesis, 2005 - doi.wiley.com
... 1 (Mm.3126); N-myc down stream regulated 1 (Mm.4063); N-myc downstream regulated ...
and goblet cells in the small intes- tine (Ng et al., 2002), and Klf4 (a Group ...
Web Search - ncbi.nlm.nih.gov
| |
©2005 Google