![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 59 for MYC and PAX4. (0.10 seconds) |
The diabetes-linked transcription factor PAX4 promotes ß-cell proliferation and survival in rat and … - Full text - MIT Libraries
T Brun, I Franklin, L St-Onge, A Biason-Lauber, EJ … - The Journal of Cell Biology - jcb.org
... Thus, by modulating apoptosis through Bcl-xL expression and proliferation via
c-myc levels, Pax4 may regulate the total population of ß-cells and ultimately ...
Cited by 1 - Web Search - jcb.org - jem.org - ncbi.nlm.nih.gov
Association of childhood type 1 diabetes mellitus with a variant of PAX4: possible link to beta cell … - Full text - MIT Libraries
BR Gauthier, TBCB Wollheim, EJ Schoenle - Diabetologia, 2005 - springerlink.com
... that Pax4 operates as a key regulator of adult beta cell mass by converging the
replicating effect of several signal transduction pathways towards the Myc-Id2 ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
An International Journal Home Help [Feedback][For Subscribers][Archive][Search][Contents] - Full text - MIT Libraries
SB Smith, R Gasa, H Watada, J Wang, SC Griffen, MS … - J. Biol. Chem, 2003 - pnas.org
... Hepatic Nuclear Factor 1 Cooperate in Activating Pancreatic Expression of Pax4 J.
Biol ... Xu, S. Bonner-Weir, and GC Weir Induction of c-Myc Expression Suppresses ...
Web Search
A novel glucose-responsive element in the human insulin gene functions uniquely in primary cultured … - Full text - MIT Libraries
M Sander, SC Griffen, J Huang, MS German - Biochemistry, 1998 - dx.doi.org
... Hepatic Nuclear Factor 1 Cooperate in Activating Pancreatic Expression of Pax4 J.
Biol ... Xu, S. Bonner-Weir, and GC Weir Induction of c-Myc Expression Suppresses ...
Cited by 16 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Gene Expression Profiling to Identify Oncogenic Determinants of Autocrine Human Growth Hormone in … - Full text - MIT Libraries
XQ Xu, BS Emerald, ELK Goh, N Kannan, LD Miller, … - J. Biol. Chem, 2005 - jbc.org
... 5'-GGCATACTAGGAGCTTGACTG-3'; PAX4 (sense), 5'-CTGGCGCATCACCTGATTGG-3'; PAX4 (antisense),
5 ... TFF3 cDNA inserts were reamplified with primers TFF3 cDNA-myc Top (5 ...
Web Search - jbc.org - ncbi.nlm.nih.gov
In vivo proliferation of differentiated pancreatic islet beta cells in transgenic mice expressing … - Full text - MIT Libraries
S Hino, T Yamaoka, Y Yamashita, T Yamada, J Hata, … - Diabetologia, 2004 - springerlink.com
... Tu- mourigenesis of pancreatic islets was examined by insulin con- tent, expression
of GLUT1, GLUT2, Pax4, c-myc and amylin, with an SV-40-transformed ...
Web Search - ncbi.nlm.nih.gov
Pattern of genes influenced by conditional expression of the transcription factors HNF6, HNF4 alpha … - Full text - MIT Libraries
H Thomas, S Senkel, S Erdmann, T Arndt, G Turan, L … - Nucleic Acids Res, 2004 - pubmedcentral.nih.gov
... 9E10) and the anti-His tag antibody (27) was used for myc and histidine ... and TCF1
(HNF1α), whereas the genes encoding Foxa1 (HNF3α), Ngn3, Pax4, Ptf1a and ...
Cited by 1 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov
Neurogenin3 activates the islet differentiation program while repressing its own expression - Full text - MIT Libraries
SB Smith, H Watada, MS German - Mol Endocrinol, 2004 - mend.endojournals.org
... expression of Pax4. J Biol Chem 22. ... Biochem J 354:431-8 27. Swanson HI, Yang
JH 1999 Specificity of DNA binding of the c-Myc/Max and ...
Cited by 7 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
ASB TransScript
TF Antibodies, P Array, N Antibodies, N Antibodies - avivasysbio.com
... No. AVARP04004 ) 6 Anti-c-myc(Ab-2) Rabbit Polyclonal Cat No. ... ARP32062 Anti-PAWR
50 µg, 100 µg $180/$250 ARP32064 Anti-PAX4 50 µg, 100 µg $180/$250 ...
View as HTML - Web Search
Functional Modules in Ribosomal Protein L 5 for Ribonucleoprotein Complex Formation and … - Full text - MIT Libraries
M Claussen, F Rudt, T Pieler - J Biol Chem, 1999 - jbc.org
... vector (85). For in vitro expression of the fusion proteins, L5 was fused
to six N-terminal Myc epitopes in pCS2+MT (86). The control ...
Cited by 27 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Direct autoregulation and gene dosage compensation by POU-domain transcription factor Brn 3 a - Full text - MIT Libraries
M Trieu, A Ma, SR Eng, N Fedtsova, EE Turner - Development, 2003 - dev.biologists.org
... Brn3a-myc transgene, 5' GAAGAGGACTTGAGATCTATGAACAG; Brn3a common 3' oligonucleotide ...
in the mouse and human PAX6 (Kammandel et al., 1999 ), PAX4 (Brink et al ...
Cited by 8 - Web Search - ericonic.tripod.com - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
Fundamentals of Transcription Factors and Their Impact on Pancreatic Development and Cancer
JAKR Urrutia - Pancreatology, 2003 - content.karger.com
... 26, 27 Pax4 repressor beta and delta cell development 28, 29 Pax6 ... 52–55
c-myc activator cell proliferation, differentiation 56–58 c ...
Web Search - content.karger.com
Bio-engineering insulin-secreting cells from embryonic stem cells: a review of progress
E Roche, MP Sepulcre, R Ensenat-Waser, I Maestre, … - Med Biol Eng Comput, 2003 - iee.org
... or several endocrine pancreas precursor markers, such as the specific transcription
factors Neurogenin3, NeuroD=Beta2, Isl-1, Nkx2.2, Nkx6.1, Pax6, Pax4, Pdx-1 ...
Cited by 4 - View as HTML - Web Search - conferences.iee.org.uk - ncbi.nlm.nih.gov - link.aip.org - Get it from MIT Libraries
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... 01 N-Myc OCT1 02 Octamer factor 1 OCT1 03 Octamer factor 1 OCT1 04 Octamer factor
1 OCT1 Q6 Octamer factor 1 P300 01 p300 PAX3 B Pax3 binding sites PAX4 01 Pax ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Pattern of genes influenced by conditional expression of the transcription factors HNF6, HNF4 {alpha … - Full text - MIT Libraries
H Thomas, S Senkel, S Erdmann, T Arndt, G Turan, L … - Nucleic Acids Research, 2004 - nar.oupjournals.org
... 9E10) and the anti-His tag antibody (27) was used for myc and histidine ... IPF1) and
TCF1 (HNF1 ), whereas the genes encoding Foxa1 (HNF3 ), Ngn3, Pax4, Ptf1a and ...
Web Search - nar.oupjournals.org
Contrasting patterns of expression of transcription factors in pancreatic alpha and beta cells - Full text - MIT Libraries
J Wang, G Webb, Y Cao, DF Steiner - Proc. Natl. Acad. Sci. USA, 2003 - pnas.org
... Thus, the higher levels of Id1, Id2, Id3, N-myc, and Mxi1 in the cell type ... Pax4,
which is restricted to pancreatic progenitors and is very low in adult cells ...
Cited by 6 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
The t (9; 14)(p13; q32) Chromosomal Translocation Associated With Lymphoplasmacytoid Lymphoma …
V Dyomin, H Ohno, RSK Chaganti, R Dalla-Favera - bloodjournal.org
... l), and t(2;8)(p12;q24) lead to the deregulated expression of the c-MYC proto-onco ...
YACa L OR 8Y*b Fig 2. Mapping of three 9p13 breakpoints and PAX4 gene within ...
Web Search - gis.a-star.edu.sg
Phosphorylation of the Transactivation Domain of Pax 6 by Extracellular Signal-regulated Kinase and … - Full text - MIT Libraries
I Mikkola, JA Bruun, G Bjoerkoey, T Holm, T … - J Biol Chem, 1999 - jbc.org
... Pax6, like Pax3, Pax4, and Pax7, also harbors a second DNA-binding domain, the paired ...
Thus, c-Myc (36), Spi-B (37), BCL-6 (38), Microphthalmia (39), and several ...
Cited by 19 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
In vitro cultivation of human islets from expanded ductal tissue - Full text - MIT Libraries
S Bonner-Weir, M Taneja, GC Weir, K Tatarkiewicz, … - Stem Cells, 2004 - dx.doi.org
... Kania, M. Wagner, U. Roll, L. St-Onge, and AM Wobus Expression of Pax4 in embryonic ...
G. Xu, S. Bonner-Weir, and GC Weir Induction of c-Myc Expression Suppresses ...
Cited by 215 - Web Search - pnas.org - pubmedcentral.nih.gov - joplink.net - all 7 versions »
Model the Relationship Between Gene Expression and TFBSs Using a Simplified Neural Network with …
X Zhou, KY Liu, G Li, S Wong - springerlink.com
... Condition 1 Condition 2 Index Transcriptional-Factor Frequency Transcriptional-Factor
Frequency 1 NFKB 0.5421 Myc 0.6637 2 E2F1 0.4334 NFKB 0.5634 ...
Web Search
Quantitative Assessment of Gene Targeting in Vitro and in Vivo by the Pancreatic Transcription …
SK Chakrabarti, JC James, RG Mirmira - jbc.org
... Our results show that in all cells Pdx1 binds strongly to the insulin, islet amyloid
polypeptide, glucagon, Pdx1, and Pax4 promoters, whereas it does not bind ...
Web Search
The Pax 3-FKHR oncoprotein is unresponsive to the Pax 3-associated repressor hDaxx - Full text - MIT Libraries
AD Hollenbach, JE Sublett, CJ McPherson, G … - The EMBO Journal, 1999 - embojournal.npgjournals.com
... Pax4, which does not contain an octapeptide domain and is only 45% identical to
Pax3 ... of the co-repressors Sin3a and Sin3b on Ume6 and Myc respectively (Allend ...
Cited by 82 - Web Search - nature.com - emboj.org - ncbi.nlm.nih.gov - all 7 versions »
Quantitative Assessment of Gene Targeting in Vitro and in Vivo by the Pancreatic Transcription … - Full text - MIT Libraries
IOFCSIN DIRECTING, P BINDING - J. Biol. Chem, 2002 - jbc.org
... over controls) and moderately associates with the glucagon and Pax4 promoters (about ...
ChIP assay in studying the mammalian transcription factors c-Myc, p53, and ...
Web Search - jbc.org
Identification of A Pax Paired Domain Recognition Sequence and Evidence for DNA-dependent …
N Genet - uphs.upenn.edu
... CD spectra of the I'm-ti paired domain were identical when the protein was prepared
and analyzed in either buffer, and the Pax4 paired domain was able to hind ...
View as HTML - Web Search
Neuroendocrine differentiation factor, IA-1, is a transcriptional repressor and contains a specific … - Full text - MIT Libraries
MB Breslin, M Zhu, AL Notkins, MS Lan - Nucleic Acids Research, 2002 - nar.oupjournals.org
... Both Pax4 and Pax6 sequences are in the reverse orientation with respect to the
NeuroD ... and Weintraub,H. (1990) Sequence-specific DNA binding by the c-myc protein ...
Cited by 5 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
p48 subunit of mouse PTF1 binds to RBP-Jk/CBF-1, the intracellular mediator of Notch signalling, and … - Full text - MIT Libraries
J Obata, M Yano, H Mimura, T Goto, R Nakayama, Y … - Genes to Cells, 2001 - genestocellsonline.org
... Other homeodomain proteins, Pax4 and Pax6, are required for the normal differentiation
of insulin ... at the N-terminus and p48 was tagged with the c-myc epitope at ...
Cited by 11 - Web Search - blackwell-synergy.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Global expression analysis of gene regulatory pathways during endocrine pancreatic development - Full text - MIT Libraries
G Gu, JM Wells, D Dombkowski, F Preffer, B Aronow, … - Development, 2004 - dev.biologists.org
... for several transcription factors in the developing pancreas including, HNF1α (Tcf1α),
HNF1β (Tcf1β), HNF4α (Tcf4α), Pdx1, NeuroD1, Ngn3, Pax4, Pax6 and ...
Cited by 13 - Web Search - biology.missouri.edu - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Genes expressed in the developing endocrine pancreas and their importance for stem cell and diabetes …
JM Wells - Diabetes/Metabolism Research and Reviews, 2003 - doi.wiley.com
... transcription factor, LIM/homeodomain (AJ132765) Lmyc1 Lung carcinoma myc–related
oncogene ... 2 K2 transcription factor related, locus 2 (U31566) Pax4, 6 Paired ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The NeuroD1/BETA2 sequences essential for insulin gene transcription colocalize with those necessary … - Full text - MIT Libraries
A Sharma, M Moore, E Marcora, JE Lee, Y Qiu, S … - Mol Cell Biol, 1999 - mcb.asm.org
... cells on the injected side of the embryo expressed the myc-tagged BETA2 ... 1997. The
Pax4 gene is essential for differentiation of insulin-producing -cells in the ...
Cited by 21 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
PAX genes in development and disease: The role of PAX2 in urogenital tract development
MR Eccles, S He, M Legge, R Kumar, J Fox, C Zhou, … - Int J Dev Biol, 2002 - ijdb.ehu.es
... hypopigmentation PAX4 - - Pax4 knockout (+/-) No abnormalities Pax4 knockout (-/-)
Absence of ... three promoter-luciferase expression constructs, N-myc, p53, and ...
Cited by 5 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - ijdb.ehu.es - Get it from MIT Libraries
Genetic and biochemical diversity in the Pax gene family - Full text - MIT Libraries
DA Underhill - Biochem Cell Biol, 2000 - article.pubs.nrc-cnrc.gc.ca
... gene in α-cells (Hussain and Habener 1999), in contrast with Pax4, which represses ...
gain-of-function experi- ments also identified LEF-1 and N-myc as targets ...
Cited by 11 - Web Search - dx.doi.org - pubs.nrc-cnrc.gc.ca - ncbi.nlm.nih.gov - all 6 versions »
Diabetes and stem cells according to: Timothy J. Kieffer et al. Harnessing the gut to treat diabetes - Full text - MIT Libraries
Y Fujita, AT Cheung - Pediatric Diabetes, 2004 - blackwell-synergy.com
... Additional homeodomain transcription factors important for the development of
enteroendocrine and pancreatic endocrine cells are Nkx2.2, Pax4, and Pax6. ...
Cited by 1 - Web Search - ingentaconnect.com - surgery.ubc.ca - ncbi.nlm.nih.gov
Molecular Mechanisms of PDX-1 Regulation
US Jhala, S Sharma, S Dutta, M Montminy - content.karger.com
... In addition to PDX-1, other homeobox proteins including Isl-1, Pax4, Pax6, nkx6 ... 1
gene expression is not clear, other nuclear factors, most notably myc and Max ...
Web Search - content.karger.com
Transcriptional regulation of the human PAX 6 gene promoter. - Full text - MIT Libraries
ZP Xu, GF Saunders - J Biol Chem, 1997 - jbc.org
... as in Pax1 and Pax9) or with a full-length (as in Pax3, Pax4, Pax6, and ... including
single binding sites for Sp1 protein (at bases 395 to 387), Myc protein (at ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov
Genetic factors regulating experimental arthritis in mice and rats
RL Wilder, EF Remmers, Y Kawahito, PS Gulko, GW … - Current Directions in Autoimmunity, 1999 - content.karger.com
Page 1. Theofilopoulos AN (ed): Genes and Genetics of Autoimmunity. Curr
Dir Autoimmun. Basel, Karger, 1999, vol 1, pp 121–165 ..... ...
Cited by 10 - Web Search - content.karger.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Neogenesis y regeneracion de las celulas β pancreaticas
R de Haro-Hernandez, JD Mendez - Gac Med Mex, 2002 - medigraphic.com
Page 1. Otras secciones de este sitio: ...
Web Search - medigraphic.com - medigraphic.com - medigraphic.com - Get it from MIT Libraries
Direct transcriptional repression of the genes encoding the zinc-finger proteins Gfi 1 b and Gfi 1 … - Full text - MIT Libraries
L Vassen, K Fiolka, S Mahlmann, T Moeroey - Nucleic Acids Research, 2005 - nar.oupjournals.org
... Gel-shift analysis The Myc-tagged Gfi1 and Gfi1b proteins were produced with
the TNT(TM) Rabbit Reticulocyte Lysate System (Promega). ...
Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Twists and turns in the development and maintenance of the mammalian small intestine epithelium
AL Hauck, KS Swanson, PJA Kenis, DE Leckband, HR … - Birth Defects Research Part C Embryo Today Reviews, 2005 - doi.wiley.com
... expression and apoptosis, increased expression of math1, nkx2- 2, Pax4, Pax6, Delta1 ...
and crypts, lack of proliferation, nuclear -catenin, c-myc, Enc1; loss of ...
Web Search - scs.uiuc.edu - swinegenomics.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
cAMP Response Element-Binding Protein, Activating Transcription Factor-4, and Upstream Stimulatory … - Full text - MIT Libraries
JL Steiger, S Bandyopadhyay, DH Farb, SJ Russek - J Neurosci, 2004 - jneurosci.org
... factor-1; GKLF, gut-enriched Krueppel-like binding factor; MAZ, Myc-associated zinc ...
zinc finger protein; MZF1, myeloid zinc finger protein-1; PAX4, paired box ...
Cited by 2 - Web Search - dx.doi.org - jneurosci.org - ncbi.nlm.nih.gov
The Regulation of Amylin and Insulin Gene Expression and Secretion
ROFI SECRETION - Pancreas, 2005 - pancreasjournal.com
... through positive activity on PDX-1 and negative activity on c-Myc. ... Pax4, a highly
conserved transcription factor required for differentiation of β cells and ...
Web Search
TranSignal TM GR-TF Interaction Arrays
PU Manual - panomics.com
... SIE Stat5 Stat5 MRE MRE 12 CDP CDP FA S T -1 FA S T -1 Myc-Max Myc-Max
Pax-5 Pax-5 Smad SBE Smad SBE Stat6 Stat6 13 CDP CDP FA S
View as HTML - Web Search - biocat.de
Wnt signaling in the intestinal epithelium: from endoderm to cancer - Full text - MIT Libraries
A Gregorieff, H Clevers - Genes & Development, 2005 - genesdev.org
... 2003 ). Whether c-Myc performs similar functions in the intestine will need to be ...
For example, the activation of NGN3, BETA2, Pax4, and Pax6 is associated with ...
Web Search - dx.doi.org - genesdev.org - ncbi.nlm.nih.gov
Fluid shear stress induces endothelial KLF2 gene expression through a defined promoter region
JP Huddleson, S Srinivasan, N Ahmad, JB Lingrel - Biol. Chem, 2004 - degruyter.com
... These are loosely defined consensus sequences for Hand1/E47, Oct1, Pax4, and Pax6. ...
LKLF is sufficient to program T cell quiescence via a c-Myc-dependent pathway ...
Cited by 1 - Web Search - extenza-eps.com - degruyter.de - ijp-online.com - all 10 versions »
TranSignal TM Protein/DNA Arrays
CS Version - panomics.com
... CDP CDP FA S T -1 FA S T -1 Myc-Max Myc-Max Pax-5 Pax-5 Smad SBE Smad SBE
Stat6 Stat6 13 CDP CDP FA S T -1 FA S T -1 Myc-Max Myc ...
View as HTML - Web Search
The PAX6 gene is activated by the basic helix–loop–helix transcription factor NeuroD/BETA2 - Full text - MIT Libraries
E Marsich, A Vetere, M Di Piazza, G Tell, S … - Biochem J, 2003 - bj.portlandpress.com
... 4]. During embryogenesis, PAX genes exhibit highly restricted temporal and spatial
expression patterns [4]. Two members of the PAX gene family, PAX4 and PAX6 ...
Cited by 4 - View as HTML - Web Search - biochemj.org - biochemj.org - ncbi.nlm.nih.gov - all 5 versions »
Stem-cell-based approaches for regenerative medicine - Full text - MIT Libraries
S Kume - Development, Growth and Differentiation, 2005 - blackwell-synergy.com
... mice with overexpression of mitogenic oncogenes such as TGF- , c-Myc and SV40T ...
Expression of Pax4 in embryonic stem cells promotes differentiation of nestin ...
Web Search
Genome-wide prediction and analysis of function-specific transcription factor binding sites - Full text - MIT Libraries
F Long, H Liu, C Hahn, P Sumazin, MQ Zhang, A … - In Silico Biology, 2004 - iospress.metapress.com
... PAX4 02(M00377) 34.19% NAAWAATTANS ... This agrees with the evidence that ZF5 is a
transcription repressor of c-myc proto-oncogene exhibiting growth-suppressive ...
Cited by 1 - Web Search - bioinfo.de - bioinfo.de - ncbi.nlm.nih.gov
TranSignal TM Protein/DNA Arrays
PU Manual, MA MA1014 - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays Cat. # MA1010, MA1011, MA1012 Product User
Manual, MA1013 & MA1014, MA1015 Released 09/28/04 Panomics, Inc. ...
View as HTML - Web Search - biocat.de
Xenopus aristaless-related homeobox(xARX) gene product functions as both a transcriptional activator … - Full text - MIT Libraries
DW Seufert, NL Prescott, HM El-Hodiri - Developmental Dynamics, 2005 - doi.wiley.com
... xArx ASMO specifically inhibits translation of an xArx–green fluorescent protein
fusion (Arx- GFP) but not GFP lacking the xArx ASMO tar- get (myc-GFP) fusion ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Bibliography Current World Literature
E Tumors - Current Opinion in Oncology, 2005 - co-oncology.com
... MM, Pieters R, Voute PA, et al: The N-myc paradox: N-myc overexpression in ... Mansouri
A, HecksherSorensen J, et al: Opposing actions of Arx and Pax4 in endocrine ...
Web Search
| |
©2005 Google