![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 13 of 13 for MYC and POU2F1. (0.06 seconds) |
A global transcriptional regulatory role for c-Myc in Burkitt's lymphoma cells - Full text - MIT Libraries
Z Li, S Van Calcar, C Qu, WK Cavenee, MQ Zhang, B … - Proceedings of the National Academy of Sciences, 2003 - pnas.org
... HCF-2, IRF3, LOC51042, LZTR1, MADH3, MAFF, MYCBP, NFAT5, NFKBIB, NR1D1, POU2F1,
PSMC5, RBBP1 ... Many of the genes we identified as c-Myc Max targets play key roles ...
Cited by 46 - Web Search - panomics.com - zlab.bu.edu - rulai.cshl.org - all 10 versions »
Technical Bulletin
H Protein, H ELISA - sigmaaldrich.com
... 6 Protocol for the Anti-c-Myc-Cy3 Binding Assay ..... ... Anti-c-Myc-Cy3 C6594 10 µL ...
View as HTML - Web Search - sigmaaldrich.com
Identification of genes responsible for osteoblast differentiation from human mesodermal progenitor … - Full text - MIT Libraries
H Qi, DJ Aguiar, SM Williams, A La Pean, W Pan, CM … - Proceedings of the National Academy of Sciences, 2003 - pnas.org
... 3'; PTHr1, 5'-catcttttggtccatctgtccatc-3', 5'-ctggagaccctcgagaccaca-3'; POU2F1,
5'-agtttgcggctggaggtgcctta-3 ... A good example is Myc mRNA, which was decreased on ...
Cited by 26 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
High-resolution comparative mapping of pig Chromosome 4, emphasizing the FAT 1 region - Full text - MIT Libraries
M Moller, F Berg, J Riquet, D Pomp, A Archibald, S … - Mammalian Genome, 2004 - springerlink.com
... Microsatellite 277 – 285 HSA1 166.3 322 This study CCATAGAAACCTCCTAGAGGCAA
POU2F1/S0762 ACGGCCGGGATCTCCAGTACA Microsatellite 145 – 149 HSA1 164.5 151 This ...
Web Search - ncbi.nlm.nih.gov
Transcriptional control during mammalian anterior pituitary development - Full text - MIT Libraries
JJ Savage, BC Yaden, P Kiratipranon, SJ Rhodes - Gene, 2003 - www-unix.oit.umass.edu
... OCT1 OTF1, POU2F1 POU-HD Involved in GH gene transcription ... PITX2 to activate
transcription from target genes such as cyclin D2 and c-Myc, thereby promoting ...
Cited by 7 - View as HTML - Web Search - ncbi.nlm.nih.gov
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
... Hs.7647 MAZ MYC-associated zinc finger protein (purine-binding transcription factor)
16p11 ... Hs.182237 POU2F1 POU domain, class 2, transcription factor 1 1q22-q23 ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Genomic and proteomic analysis of the myeloid differentiation program. II. Global analysis of gene … - Full text - MIT Libraries
Z Lian, Y Kluger, DS Greenbaum, D Tuck, M Gerstein … - Blood, 2004 - bloodjournal.org
... 233.22/P Cutl1 2 1 3 3 20/A 125.96/P Hipk3 5 5 3 3 26.97/A 41.14/P Maz 4 4 2 2
20/A 1674.86/P Mycbp 1 2 2 2 20/A 128.25/P Nmi 1 2 2 2 20/A 407.37/P pou2f1 3 2 ...
Web Search - bloodjournal.org
The VP16 paradox: herpes simplex virus VP16 contains a long-range activation domain but within the … - Full text - MIT Libraries
M Hagmann, O Georgiev, W Schaffner - J. Virol, 1997 - jvi.asm.org
... factor Oct-1 (also termed NF III, OBP100, OTF-1, or POU2F1 [17, 60, 68 ... protein
interactions have been reported for other activation domains, eg, c-myc (54), as ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Proteomics profiling of nuclear proteins for kidney fibroblasts suggests hypoxia, meiosis, and … - Full text - MIT Libraries
K Shakib, JT Norman, LG Fine, LR Brown, J Godovac- … - Proteomics, 2005 - doi.wiley.com
... 45000 5 Rat Pou2f1 POU domain, class 2, transcription factor 1 (OCT1D, OCT1)
347044 34880834 1 56193 32000 4 Rat. MS peptides, exons ...
Web Search - ncbi.nlm.nih.gov
Census of orthologous genes and self-organizing maps of biologically relevant transcriptional … - Full text - MIT Libraries
XL Wu, KB Griffin, MD Garcia, JJ Michal, Q Xiao, … - Gene, 2004 - ansci.wsu.edu
Page 1. Census of orthologous genes and self-organizing maps of biologically
relevant transcriptional patterns in chickens (Gallus gallus) ...
View as HTML - Web Search - ansci.wsu.edu - ncbi.nlm.nih.gov
Concurrent opposite effects of an inhibitor of histone deacetylases, Trichostatin-A, on the …
FJ Davis, JB Pillai, M Gupta, MP Gupta - ajpheart.physiology.org
Page 1. Concurrent opposite effects of an inhibitor of histone deacetylases,
Trichostatin-A, on the expression of α-myosin heavy ...
Web Search
Fourth International Workshop on Human Chromosome 1 Mapping 1998
S Gregory, M Vaudin, P White, J Vance - Cytogenet Cell Genet, 1998 - content.karger.com
Page 1. ABC © 1999 S. Karger AG, Basel 0301–0171/98/0834–0147$17.50/0
Accessible online at: http://BioMedNet.com/karger Accepted ...
Cited by 4 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Sixth International Workshop on Human Chromosome1 Mapping 2000
B Schutte, S Gregory, P White - Cytogenet Cell Genet, 2001 - content.karger.com
Page 1. Cytogenet Cell Genet 92:23–48 (2001) Held on 30 September to 3
October 2000 at the University of Iowa, Iowa City, IA, USA ...
Cited by 8 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
|
©2005 Google