![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 54 for NF1 and AHR. (0.18 seconds) |
… Fluorescent Protein (GFP) as a Marker of Aryl Hydrocarbon Receptor (AhR) Function in Developing … - Full text - MIT Libraries
GFP AhR-regulated, D Homogenizer, F Scientific - Environmental Health Perspectives, 2001 - ehp.niehs.nih.gov
... a portion of the 5 regulatory region (–1612/+292) of the AhR- regulated gene ... The
5 CYP1A1 promoter region includes a TATA box, Sp1, NF1 binding sites, and ...
Cited by 10 - View as HTML - Web Search - ehpnet1.niehs.nih.gov - ehis.niehs.nih.gov - csa.com - all 5 versions »
Transactivation Domains Facilitate Promoter Occupancy for the Dioxin-Inducible CYP1A1 Gene In Vivo
HP KO, ST OKINO, Q MA, JP WHITLOCK JR - Plasmid - mcb.asm.org
... 740 , and AhR 494/740-805 ) produce weak footprints at the TATA box and NF1 binding
site; and (iii) mutants which strongly induce P4501A1 mRNA (AhR 583 , AhR ...
Cited by 25 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
A novel computational approach for the prediction of networked transcription factors of Ah-receptor … - Full text - MIT Libraries
A Kel, S Reymann, V Matys, P Nettesheim, E … - Molecular Pharmacology, 2004 - molpharm.aspetjournals.org
... transcription factor AhR (aryl hydrocarbon receptor) that mediates responses to
a variety of ... of the transcriptional network of AhR target genes are needed. ...
Cited by 3 - Web Search - molpharm.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Dioxin-induced CYP1A1 transcription in vivo: the aromatic hydrocarbon receptor mediates … - Full text - MIT Libraries
HP Ko, ST Okino, Q Ma, JP Whitlock Jr - Mol Cell Biol, 1996 - mcb.asm.org
... In cells reconstituted with AhR C, use of the LMPCR technique reveals that TCDD
fails to induce protein binding at the NF1 site and TATA box (Fig. ...
Cited by 58 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Mechanism of dioxin action: Ah receptor-mediated increase in promoter accessibility in vivo - Full text - MIT Libraries
L Wu, JP Whitlock Jr - Proc. Natl. Acad. Sci. USA, 1992 - pnas.org
... vitro reveals that the proteins that bind to the TATA box, the NF1 site, and the
guanine-rich region (G box) are present ... The boxes designated "AhR" represent ...
Cited by 26 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Dioxin induces localized, graded changes in chromatin structure: implications for Cyp1A1 gene … - Full text - MIT Libraries
ST Okino, JP Whitlock Jr - Mol. Cell. Biol, 1995 - mcb.asm.org
... TATAAA sequence, at a recognition motif for the transcrip- tion factor NF1, and
at ... Thus, our findings indicate that the binding of AhR/Arnt to the enhancer is ...
Cited by 40 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Genomic organization and expression of parkin in Drosophila melanogaster - Full text - MIT Libraries
YJ Bae, KS Park, SJ Kang - Exp Mol Med, 2003 - e-emm.org
... aaaaattgttttcaattgtg cgctttctgcgtgtccacgttttcctccgaatggctgccagctggt
gtttggcaacgcgtaagtaaacaacgattggcaacactgaagcatat AhR-Arnt GATA NF1 NF1 NF1 ...
Cited by 2 - View as HTML - Web Search - e-emm.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Carolyn J. Mattingly, John A. McLachlan, and William A. Toscano, Jr.
BEHP Publications, VS Cart, C Opportunities, REHP … - Environmental Health Perspectives, 2001 - ehp.niehs.nih.gov
... a portion of the 5´ regulatory region (-1612/+292) of the AhR-regulated gene ... The
5´ CYP1A1 promoter region includes a TATA box, Sp1, NF1 binding sites, and ...
Cached - Web Search - ehis.niehs.nih.gov - ehpnet1.niehs.nih.gov - ehp.niehs.nih.gov - all 6 versions » - Get it from MIT Libraries
Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms - Full text - MIT Libraries
ME Massari, C Murre, R Articles - Mol. Cell. Biol, 2000 - dx.doi.org
... Furthermore, both AHR activator chimeras were shown to facilitate nucleosome disruption
and allow occupancy of the TATA box and NF1 site at the CYP1A1 promoter ...
Cited by 292 - Web Search - mcb.asm.org - www-biology.ucsd.edu - sig.biostr.washington.edu - all 9 versions »
Disruption of dioxin-inducible phase I and phase II gene expression patterns by cadmium, chromium, … - Full text - MIT Libraries
A Maier, TP Dalton, A Puga, O Cincinnati - Molecular Carcinogenesis, 2000 - doi.wiley.com
... Recent work suggesting that cellular oxidative stress exerts an inhibitory effect
on aromatic hydrocarbon receptor (AHR)±dependent gene expression led us to ...
Cited by 20 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - csa.com
Regulation of Pulmonary and Hepatic Cytochrome P4501A Expression in the Rat by Hyperoxia: … - Full text - MIT Libraries
XI Couroucli, SE Welty, RS Geske, B Moorthy - Regulation, 2002 - molpharm.aspetjournals.org
... ROS, reactive oxygen species; P450, cytochrome P450; AHR, aryl hydrocarbon receptor ...
ANOVA, analyses of variance; MC, 3-methylcholanthrene; NF1, nuclear factor 1 ...
Cited by 5 - Web Search - molpharm.aspetjournals.org - ncbi.nlm.nih.gov
Characterization of Adjacent E-Box and Nuclear Factor 1-Like DNA Binding Sequence in the Human CYP1A …
MJ Narvaez, GR Anderson, GV Pickwell, LC … - doi.wiley.com
... the aryl hy- drocarbon receptor (AhR) as demonstrated by stud- ies using AhR null
mice [7 ... of CYP1A2, including mem- bers of the nuclear factor 1 (NF1) family of ...
Web Search
An SP 1-like 5'-GACCACGCC-3' sequence is critical for activity of the inflammatory phospholipase A 2 …
M Paradon, C Salvat, Q Fan, G Bereziat, JL Olivier - European Journal of Biochemistry, 1998 - blackwell-synergy.com
... proxi- mal regions of promoters binding both the Sp1 and CTF/NF1 factors [28 ... which
binds a heterodimer composed of the aryl hydrocarbon receptor (Ahr) and the ...
Cited by 2 - Web Search - content.febsjournal.org - ejbiochem.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
GEArray Q series Mouse cAMP/Ca2+ PathwayFinder Gene Array: AR-SAMM-028
FG Grouping - eurogentec.com
... Cables, Ccna1 (CyclinA), Ccnd1 (CyclinD1), Cdk5, Cdkn2b (p15IND4b), Gem, Nf1, Pcna,
Pmaip1 (NoxA ... Metabolic: Ahr, Amd1, Eno2, Hk2, Ldh1, Odc, Pck2-Rik, Pcx, Sod2 ...
View as HTML - Web Search - eurogentec.be
GEArray Q series Human cAMP/Ca2+ PathwayFinder Gene Array: AR-SAHS-028
FG Grouping - eurogentec.com
... BCL2, BRCA1, CCNA1 (CyclinA), CCND1 (CyclinD1), CDK5, CDKN2B (p15IND4b), GEM, NF1,
PCNA, PMAIP1 ... Metabolic: AHR, AMD1, ENO2, HK2, LDHA, ODC1, PC, PCK2, SOD2 ...
View as HTML - Web Search - eurogentec.be
Estrogen receptor reduces CYP1A1 induction in cultured human endometrial cells - Full text - MIT Libraries
MS Ricci, DG Toscano, CJ Mattingly, WA Toscano Jr - J Biol Chem, 1999 - jbc.org
... The AhR-responsive fragment was removed by digestion with SacI and XhoI and ... for
NF-1 under transcriptional control of the cytomegalovirus promoter (pCMV-NF1). ...
Cited by 27 - Web Search - jbc.org - ncbi.nlm.nih.gov
Transcriptional regulation of cytochrome p450 2B genes by nuclear receptors
H Wang, M Negishi - Curr Drug Metab, 2003 - ingentaconnect.com
... Although the NF1 site is not essential for conferring PB responsiveness to the ... target
genes; CAR specific target genes including: CYP1A, SULT1A1, AhR, and FMOC5 ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Some aspects of interindividual variations in the metabolism of xenobiotics - Full text - MIT Libraries
V Tamasi, L Vereczkey, A Falus, K Monostory - Inflammation Research, 2003 - springerlink.com
... aromatic hydrocarbon receptor; Hsp90: heat shock protein; Arnt: AhR nuclear
translocator ... an enhancer sequence called PBRU, which con- tains a NF1 binding site ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - csa.com
Disruption of the Ah Receptor Gene Alters the Susceptibility of Mice to Oxygen-Mediated Regulation … - Full text - MIT Libraries
W Jiang, SE Welty, XI Couroucli, R Barrios, SR … - J. Pharmacol. Exp. Ther, 2004 - jpet.aspetjournals.org
... ABBREVIATIONS: ROS, reactive oxygen species; P450, cytochrome P450; AHR, Ah receptor;
PAH ... loop controlling CYP1A1 gene expression: role of H 2 O 2 and NF1. ...
Cited by 1 - Web Search - jpet.aspetjournals.org - ncbi.nlm.nih.gov
Global nature of dynamic protein-chromatin interactions in vivo: three-dimensional genome scanning … - Full text - MIT Libraries
RD Phair, P Scaffidi, C Elbi, J Vecerova, A Dey, K … - Mol. Cell. Biol, 2004 - pubmedcentral.nih.gov
... supplemented with 7% fetal bovine serum (HyClone Labs) to prevent nuclear translocation
of AhR. ... cited in Table 1. Myc, Mad, Max, BRG, PCAF, and NF1 were in the ...
Cited by 23 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Xenobiotic induction of cytochrome P450 2B1 (CYP2B1) is mediated by the orphan nuclear receptor … - Full text - MIT Libraries
R Muangmoonchai, D Smirlis, SC Wong, M Edwards, IR … - Biochem J, 2001 - biochemj.org
... BTE, basal transcription element; CAR, constitutive androstane receptor; CYP,
cytochrome P450; DRn, direct repeat with n bp spacing; NF1, nuclear factor 1; NR1 ...
Cited by 22 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Identification and Functional Characterization of a Conserved, Nuclear Factor 1-like Element in the … - Full text - MIT Libraries
J Zhang, QY Zhang, J Guo, Y Zhou, X Ding - J Biol Chem, 2000 - jbc.org
... all of which were supershifted in the presence of an anti-NF1 antibody. ... CYP1A2 is
inducible by a number of xenobiotic compounds through AhR-mediated pathways (4 ...
Cited by 12 - Web Search - jbc.org - ncbi.nlm.nih.gov
The Aryl Hydrocarbon Receptor Complex
O Hankinson - Annual Review of Pharmacology and Toxicology, 1995 - pharmtox.annualreviews.org
... Proteins capable of binding the BTE (proximal NF1 site) and G box are ... for a
transcriptional activa- tion domain is the carboxy-terminal region of AHR, which ...
Cited by 376 - Web Search - pharmtox.annualreviews.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Effect of hypoxia on cytochrome P450 activity and expression.
C Fradette, P Du Souich - Curr Drug Metab, 2004 - ingentaconnect.com
... by several mechanisms: 1) by diminishing potentiation factors or by inducing repressor
elements, 2) by reducing the aryl hydrocarbon receptor (AhR), 3) by ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
[BOOK] Goethe's Vaterhaus: Ein Beitrag Zu Des Dickters Entwicklungsgeschichte
GHO Volger - 1863 - print.google.com
... tnnett fVen. ef•tf te ‘bO ire4cn tb:t . .taii $ n.rt- mnb _ 4 Urn' 8!nf1
II!b ni f cr 4 oett e' 6. DI4ten UtV in er1kr t fnf1 tc uf ...
Web Search - Get it from MIT Libraries - Library Search
Helix-loop-helix proteins in mammary gland development and breast cancer
PY Desprez, T Sumida, JP Coppe - J. Mammary Gland Biol. Neoplasia, 2003 - kluweronline.com
... 49 Class VII AHR, ARNT, Sim HIF Biological ... 91). This element contains recognition
sites for SP-1 and NF1 transcrip- tion factors. Data ...
Cited by 6 - Web Search - springerlink.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Induction of cytochromes P450
M Dickins - Curr Top Med Chem, 2004 - ingentaconnect.com
... (1). Transcription factors involved in CYP induction AhR = arylhydrocarbon receptor ...
receptor (NR) sites which sandwich a nuclear factor 1 (NF1) binding site but ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Ah receptor signaling pathways - Full text - MIT Libraries
JV Schmidt, CA Bradfield - Annual Review of Cell and Developmental Biology, 1996 - arjournals.annualreviews.org
... DREs) that were required for induc- tion and were bound by the AHR in response ... a
G-box element, and two binding sites for the transcription factor NF1 (Jones & ...
Cited by 242 - Web Search - mcardle.oncology.wisc.edu - ncbi.nlm.nih.gov - csa.com - all 7 versions »
Characterization of the human renal Na-sulphate cotransporter gene (NAS1) promoter
ALD Markovich - springerlink.com
... 3-Methylcholanthrene . Na + -sulphate cotransporter . Renal proximal tubule . Sulphate
homeostasis Abbreviations AHR: aryl hydrocarbon receptor . AP-1, - ...
Web Search - uq.edu.au
Phenobarbital-mediated changes in gene expression in the liver
UA Meyer, K Hoffmann - Drug Metabolism Reviews, 1999 - taylorandfrancis.metapress.com
... putative glucocorticoid response element as well as a nuclear factor 1 (NF1) site,
and ... In analogy to the AhR/Arnt model of dioxin induction, PB may affect the ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov - csa.com - Get it from MIT Libraries
Identification of hypoxically inducible mRNAs in HeLa cells using differential display PCR
JF O’Rourke, CW Pugh, SM Bartlett, PJ Ratcliffe - Eur. J. Biochem, 1996 - blackwell-synergy.com
... Abbreviations. AHH, arylhydrocarbon hydroxylase ; AHR, arylhy- drocarbon
receptor; AK-3, adenylate kinase-3 ; ARNT, aryl hydrocarbon ...
Cited by 29 - Web Search - content.febsjournal.org - ejbiochem.org - ingentaconnect.com - all 6 versions » - Get it from MIT Libraries
The Negative Regulation of the Rat Aldehyde Dehydrogenase 3 Gene by Glucocorticoids: Involvement of … - Full text - MIT Libraries
KC Falkner, GH Xiao, JA Pinaire, ML Pendleton, R … - Mol. Pharmacol, 1999 - molpharm.org
... between the various transcription factors, including the GR and AhR, regulates the ...
or 3' of the pGRE, including putative cAMP responsive element and NF1 sites. ...
Cited by 5 - Web Search - intl-molpharm.aspetjournals.org - molpharm.org - ncbi.nlm.nih.gov - all 6 versions »
Characterization of the survival motor neuron (SMN) promoter provides evidence for complex … - Full text - MIT Libraries
R Rouget, F Vigneault, C Codio, C Rochette, I … - Biochem. J, 2005 - biochemj.org
... 5A). This result argues against possible binding of Sp1 or AhR family members within
this interval in vivo. ... and recognizes nuclear factor-1 (NF1) [34]. ...
Cited by 1 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
Reactive oxygen species and regulation of gene expression - Full text - MIT Libraries
KT Turpaev - Biochemistry, 2002 - springerlink.com
Page 1. In cells of aerobic organisms not less than 95% of the oxygen consumed
is reduced by mitochondrial cytochrome oxidase, whereas ...
Cited by 26 - Web Search - kluweronline.com - ncbi.nlm.nih.gov - maik.ru
Induction of phase I, II and III drug metabolism/transport by xenobiotics.
C Xu, CY Li, AN Kong - Arch Pharm Res, 2005 - apr.psk.or.kr
... The ex- pression of CYP1 genes induced by the AhR, in response to PAHs or ... receptor
binding sites (NR1 and NR2) as well as a nuclear factor 1 (NF1) binding site ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular pathogenesis of astrocytoma and glioblastoma multiforme
E Van de Kelft - Acta Neurochir (Wien), 1997 - springerlink.com
... prevalence in the Li-Fraumeni syndrome (LFS) (familial syn- drome of breast cancer,
sarcomas and other neo- plasms, dominantly inherited), NF1, NF2, tuberous ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Nuclear Factor I/CCAAT Box Transcription Factor trans-Activating Domain Is a Negative Sensor of … - Full text - MIT Libraries
Y Morel, X Coumoul, A Nalpas, R Barouki - Mol. Pharmacol, 2000 - molpharm.org
... The aryl hydrocarbon receptor (AhR) activates several cytochrome P450 genes, as
well as other xenobiotic-metabolizing enzymes and stress-response genes (Nebert ...
Cited by 2 - Cached - Web Search - intl-molpharm.aspetjournals.org - molpharm.aspetjournals.org - ncbi.nlm.nih.gov - all 6 versions »
In vitro, in vivo, and in silico analyses of the antitumor activity of 2-(4-amino-3-methylphenyl)-5- … - Full text - MIT Libraries
CO Leong, M Suggitt, DJ Swaine, MC Bibby, MFG … - Mol Cancer Ther, 2004 - mct.aacrjournals.org
... The AhR mediates sensitivity of MCF-7 breast cancer cells to the antitumour agent
2-(4 ... binding protein genes DDB1 and DDB 2 by Spl, E2F, N-myc and NF1 elements. ...
Web Search - mct.aacrjournals.org - ncbi.nlm.nih.gov
Functional analysis of the von Hippel-Lindau tumour suppressor and its role in tumourigenesis
RE Barry - unibas.ch
Page 1. Functional analysis of the von Hippel-Lindau tumour suppressor and its
role in tumourigenesis Inauguraldissertation zur Erlangung ...
View as HTML - Web Search - pages.unibas.ch - pages.unibas.ch - unibas.ch
Chemical and Physiological Influences on Xenobiotic Metabolism
RL ROSE, E HODGSON - doi.wiley.com
Page 1. CHAPTER 9 Chemical and Physiological Influences on Xenobiotic
Metabolism RANDY L. ROSE and ERNEST HODGSON 9.1 INTRODUCTION ...
Web Search
MECHANISMS OF ARSENITE-MEDIATED DECREASES IN BENZO [K] FLUORANTHENE-INDUCED HUMAN CYTOCHROME P4501A1 … - Full text - MIT Libraries
EE Bessette, MJ Fasco, BT Pentecost, LS Kaminsky - Drug Metab Dispos, 2005 - dmd.aspetjournals.org
... that arsenite's effects are not occurring directly through the AhR pathway, which
is ... BAP, benzo[a]pyrene; NRE, negative regulatory element; NF1, nuclear factor ...
Cited by 2 - Web Search - dmd.aspetjournals.org - ncbi.nlm.nih.gov - csa.com
Large-scale collection and characterization of promoters of human and mouse genes - Full text - MIT Libraries
Y Suzuki, R Yamashita, M Shirota, Y Sakakibara, J … - Silico Biol, 2004 - iospress.metapress.com
... V$AFP1 Q6 AFP1 1 0.947 35 25 0 V$AHR 01 AhR 1 0.958 2 0 0 V$AMEF2 Q6 aMEF-2 1 0.928
44 36 0 ... V$MYOD 01 MyoD 1 0.979 163 107 12 V$NF1 Q6 NF-1 1 0.986 483 468 32 ...
Cited by 2 - Web Search - bioinfo.de - bioinfo.de - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... MEF-2 MEF2 03 Myogenic MADS factor MEF-2 MEF2 04 Myogenic MADS factor MEF-2 MINI20
B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Regulation of ganglioside biosynthesis in the nervous system - Full text - MIT Libraries
RK Yu, E Bieberich, T Xia, G Zeng, RK Yu - The Journal of Lipid Research, 2004 - jlr.org
... In addition to these general transcription factor binding sites, the motifs for
AhR, NF- B ... a number of binding sites such as the ERE half-site, NF1-like, TGGCA ...
Cited by 5 - Web Search - jlr.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
Databases and tools for in silico analysis of regulation of gene expression
A Kel, O Kel-Margoulis, J Borlak, D Tchekmenev, E … - biobase.de
... database. As an example, a collection of binding sites for AhR factors are
shown in the Figure 1. The function of DNA binding sites ...
View as HTML - Web Search
The repression of nuclear factor I/CCAAT transcription factor (NFI/CTF) transactivating domain by … - Full text - MIT Libraries
Y Morel, R Barouki - Biochem. J, 2000 - biochemj.org
... mediated by the oestrogen receptor [25] and the aryl hydrocarbon receptor (AhR)
[10] pathways. ... J. and Friesen, JD (1994) The upstream activator CTF/NF1 and RNA ...
Cited by 9 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hepatitis B Virus X Protein: Structure, Function and Biology
S Murakami, S Murakami, FTC Alert - Intervirology, 1999 - content.karger.com
... TPA)- responsive element (TRE)-like sequence, aC stretch and an NF1-binding site ...
Other pX-binding proteins XAP2 AhR ligand-binding subunit ARA9 family of BREF ...
Cited by 42 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Topics in Xenobiochemistry Receptor-dependent transcriptional activation of cytochrome P4503A genes: …
xenobiotica, 2002 - dx.doi.org
Page 1. Topics in Xenobiochemistry Receptor-dependent transcriptional
activation of cytochrome P4503A genes: induction mechanisms ...
Cited by 37 - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - Get it from MIT Libraries
Wirkmechanismen von Inhalationsnoxen in Umwelt und Beruf - Full text - MIT Libraries
H Riechelmann - Laryngorhinootologie, 2004 - thieme-connect.com
... können die Zellmembran passieren und aktivieren direkt den Arylhydrokarbonrezeptor
(AhR), der gleichzeitig ... zählen zB das TATA-bindende Protein, SP1 und NF1. ...
Web Search
Analysis of Upstream Elements in the HuC Promoter Leads to the Establishment of Transgenic Zebrafish … - Full text - MIT Libraries
H Park, CH Kim, YK Bae, SY Yeo, SH Kim, SK Hong, J … - Developmental Biology, 2000 - gel.ym.edu.tw
Page 1. Analysis of Upstream Elements in the HuC Promoter Leads to the
Establishment of Transgenic Zebrafish with Fluorescent Neurons ...
Cited by 38 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions »
| |
©2005 Google