![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 14 of 14 for NF1 and EN1. (0.06 seconds) |
Characterization of several Psychrobacter strains isolated from Antarctic environments and … - Full text - MIT Libraries
N Bozal, J Montes, E Tudela, J Guinea - International Journal of Systematic and Evolutionary …, 2003 - ijs.sgmjournals.org
... and DNA–DNA hybridization The DNA G+C contents of the Antarctic isolates were 44
(NF23 T ), 45 (NF7, NF8, NF11 T , NF18 and NF19), 46 (NF1, EN1, EN2 and EN4 ...
Cited by 8 - Web Search - ijs.sgmjournals.org - ncbi.nlm.nih.gov - csa.com - all 5 versions »
Functional characterization and genomic organization of the human Na-sulfate cotransporter hNaS2 … - Full text - MIT Libraries
D Markovich, RR Regeer, K Kunzelmann, PA Dawson - Biochemical and Biophysical Research Communications, 2005 - uq.edu.au
... Sox-5 (at À325 nt), BARBIE (at À350 nt), HNF4 (at À459 nt), SMAD4 (at À529 nt),
NFKAPPAB50 (at À683 nt), NF1 (at À720 nt and À927 nt), EN1 (at À789 nt ...
Cited by 1 - View as HTML - Web Search - ncbi.nlm.nih.gov
Characterization of several Psychrobacter strains isolated from Antarctic environments and …
STA Biochemical - ijs.sgmjournals.org
... Sectors NF1, NF7, NF8, NF11, NF18, NF19, NF20, NF23, EN1, EN2, EN4, M. nonliquefaciens
CEC 465 T and M. bovis CECT 468 T contained mixtures of the auxotroph P ...
Web Search
Kaon zero-point fluctuations in neutron star matter - Full text - MIT Libraries
V Thorsson, PJ Ellis - Physical Review D, 1997 - link.aps.org
... 8! The Lagrangian becomes LK5 12 A]nf1]nf11 12 B]nf2]nf21C]nf1]nf2 1g1/2 ... in the process
and 5180 55VESTEINN THORSSON AND PAUL J. ELLIS n5212L2 12 EN1 (i ~di1 ...
Cited by 12 - Web Search - arxiv.org - adsabs.harvard.edu
Hormone-dependent Recruitment of NF-Y to the Uteroglobin Gene Enhancer Associated with Chromatin … - Full text - MIT Libraries
A Scholz, M Truss, M Beato - J Biol Chem, 1999 - jbc.org
... For the upper strand: En1, CTTTGCTTGATTGGCC; En2, CTTGATGTTCACTAAACAGGCACCTTGG;
En3, GCACCTTGGAACGAATCAGTGAACAGGCC ... has been described for binding of NF1 to the ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
Targeted insertion results in a rhombomere 2-specific Hoxa2 knockdown and ectopic activation of Hoxa … - Full text - MIT Libraries
SY Ren, PO Angrand, FM Rijli - Dev. Dyn, 2002 - doi.wiley.com
... the expression patterns of three homeobox-containing transcription factors, namely
Phox2b (Pattyn et al., 1997), Evx1 (Burrill et al., 1997) and En1 (Wurst et ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Superstring action in AdS(5) x S**5. Kappa symmetry light cone gauge
RR Metsaev, AA Tseytlin - Physical Review D, 2001 - link.aps.org
... x_ ! 1 12 ]mf]nf1 12 emA8enA8G. ~1.3! emA8 ... inEq. ~1.17! emm5diag~e2f,1!,
gmn52em0 en01em1 en1 , ~1.19! we can put Eq. ~1.18! in ...
Cited by 50 - Web Search - arxiv.org - esi.ac.at - adsabs.harvard.edu - all 6 versions » - Get it from MIT Libraries
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... MEF-2 MEF2 03 Myogenic MADS factor MEF-2 MEF2 04 Myogenic MADS factor MEF-2 MINI20
B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
QCD strings as a constrained Grassmannian σ model - Full text - MIT Libraries
KS Viswanathan, R Parthasarathy - Physical Review D, 1995 - link.aps.org
... Then, the partition function Z can be written as 51 5836 QCD STRINGS AS A CONSTRAINED
GRASSMANNIAN a MODEL z N+N2J N1 ZN EN (Ni!)2 (N2!)2 exp[-EN1 (al, b1 ...
Cited by 12 - Web Search - arxiv.org - adsabs.harvard.edu - ncbi.nlm.nih.gov - all 5 versions »
Simple but efficient correlation functional from a model pair-correlation function - Full text - MIT Libraries
EI Proynov, DR Salahub - Physical Review B, 1994 - link.aps.org
... the KS DFT scheme is 1 adiabatic connection formula:8 Ec[nf1 dXE[n]=Ec ... of the electronic
coordinates our correlation functional (31) transforms to EN1[n1, = y2 ...
Cited by 8 - Web Search - adsabs.harvard.edu - ncbi.nlm.nih.gov
Recent innovations in tissue-specific gene modifications in the mouse
Y Furuta, RR Behringer - Birth Defects Research Part C Embryo Today Reviews, 2005 - doi.wiley.com
Page 1. Recent Innovations in Tissue-Specific Gene Modifications in the Mouse
Yasuhide Furuta and Richard R. Behringer* INTRODUCTION ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
A brief history of human autosomes - Full text - MIT Libraries
D Haig - Philos Trans R Soc Lond B Biol Sci, 1999 - journals.royalsoc.ac.uk
Page 1. A brief history of human autosomes David Haig Department of Organismic
and Evolutionary Biology, Harvard University, 26 Oxford ...
Cited by 26 - Web Search - oeb.harvard.edu - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Muonium. II. Observation of the Muonium Hyperfine-Structure Interval - Full text - MIT Libraries
JM Bailey, WE Cleland, VW Hughes, R Prepost, K … - Physical Review A, 1971 - link.aps.org
... E- Av ' - as' 'SS TT I-% 1T T TT 'RS TT r%nQ Pr rv 7 A TTnN nF1 TT' M ... l., ,,,I, ,, ..
I _ I... I ...I. I .... I .... IT 881 3 7I at - 2 a c en1 I.... BAILEY ...
Cited by 6 - Web Search - adsabs.harvard.edu
Spectra of spontaneous frameshift mutations at the hisd 3052 allele of Salmonella typhimurium in … - Full text - MIT Libraries
DM DeMarini, ML Shelton, AA Shakra, A Szakmary, JG … - Genetics, 1998 - genetics.org
... In humans, it is present in the following genes: oncogenes (ABL, C-JUN, L-MYC,
R-RAS, RB); cell-cycle genes (CDC25, Cyclin D1); homeodomain genes (EN1, HOX2.2 ...
Cited by 8 - Web Search - genetics.org - ncbi.nlm.nih.gov - csa.com - all 6 versions »
|
©2005 Google