![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 912 for NF1 and SP1. (0.18 seconds) |
Ubiquitous transcription factors NF1 and Sp1 are involved in the androgen activation of the mouse …
CH Darne, L Morel, F Claessens, M Manin, S Fabre, … - Mol Cell Endocrinol, 1997 - ingentaconnect.com
... Ubiquitous transcription factors NF1 and Sp1 are involved in the androgen
activation of the mouse vas deferens protein promoter. ...
Cited by 14 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
[CITATION] SF-1, C/EBPss and ubiquitous transcription factors NF1 and Sp1 are required for regulation of the … - Full text - MIT Libraries
C Aigueperse, P Val, C Pacot, C Darne, E Lalli, P … - Mol. Endocrinol, 2001
Cited by 3 - Web Search
Transcriptional regulation of murine beta 1, 4-galactosyltransferase in somatic cells. Analysis of a … - Full text - MIT Libraries
B Rajput, NL Shaper, JH Shaper - J Biol Chem, 1996 - ncbi.nlm.nih.gov
... to the 3.9-kb start site is bound by multiple proteins which include the
tissue-restricted factor AP2, a mammary gland-specific form of CTF/NF1, Sp1, as ...
Cited by 38 - Web Search - ncbi.nlm.nih.gov
A nuclear factor other than Sp1 binds the GC-rich promoter of the gene encoding rat poly (ADP-ribose …
MA Laniel, MJ Bergeron, GG Poirier, SL Guerin - Biochem. Cell Biol, 1997 - article.pubs.nrc-cnrc.gc.ca
... Key words: rPARP, NF1, Sp1, gene regulation. ... Mots clés : rPARP, NF1, Sp1, régulation
génique. Received March 17, 1997. Revised July 3, 1997. ...
Cited by 10 - Web Search - article.pubs.nrc-cnrc.gc.ca - pubs.nrc-cnrc.gc.ca - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of a GC-rich region containing Sp1 binding site (s) as a constitutive responsive … - Full text - MIT Libraries
T Tamaki, K Ohnishi, C Hartl, EC LeRoy, M … - J Biol Chem, 1995 - jbc.org
... In a different experimental system using mouse COL1A1 promoter, two sets of overlapping
binding sites for Sp1 and NF1 have been identified(22) . ...
Cited by 38 - Web Search - jbc.org
Sp 1-mediated Transcriptional Activation from the Dominant Promoter of the Rat alpha 1 B Adrenergic … - Full text - MIT Libraries
J Chen, MS Spector, G Kunos, B Gao - J Biol Chem, 1997 - jbc.org
... Here we show that, in DDT 1 MF-2 smooth muscle cells, the major protein bound to
footprint II is not NF1 but Sp1, which binds to the 5 -portion of the ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Characterization of the upstream sequence of the human CYP11A1 gene for cell type-specific … - Full text - MIT Libraries
SJ Chou, KN Lai, B Chung - J Biol Chem, 1996 - jbc.org
... Fig. 2. AdE elements bind many proteins including NF1 and Sp1 as shown by
electrophoretic mobility shift assays. A, sequence that contains AdE1 and AdE2. ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Effect of dietary protein restriction on liver transcription factors - Full text - MIT Libraries
NW Marten, FM Sladek, DS Straus - Biochem. J, 1996 - biochemj.org
... We also examined the effect of proteinrestriction ontheDNA-bindingactivityoftwo
ubiquitous transcription factors, NF1 and Sp1. The ...
Cited by 17 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
The mouse p44 mitogen-activated protein kinase (extracellular signal-regulated kinase 1) gene - Full text - MIT Libraries
G Pages, ER Stanley, M Le Gall, A Brunet, J … - J. Biol. Chem, 1995 - jbc.org
... Consensus sequences for DNA-binding proteins (TATA box; AP-2; AP-1; Myb; p53;
Ets-1; GAGA box; Malt box; NF-IL6; CTF-NF1; Sp1; GCF; serum-responsive element ...
Cited by 18 - Web Search - jbc.org - ncbi.nlm.nih.gov
Nuclear Factor 1 Interferes with Sp 1 Binding through a Composite Element on the Rat Poly (ADP- … - Full text - MIT Libraries
MA Laniel, GG Poirier, SL Guerin - J Biol Chem, 2001 - jbc.org
... preparation of NF1-L (CM-Sep), either alone or in the presence of a 500-fold molar
excess of unlabeled, double-stranded oligonucleotides (NF1, Sp1, or Inr). ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov
Study of 5'-flanking region of human Cu/Zn superoxide dismutase - Full text - MIT Libraries
HT Kim, YH Kim, JW Nam, HJ Lee, HM Rho, G Jung - Biochem Biophys Res Commun, 1994 - ncbi.nlm.nih.gov
... SOD1. The putative binding sites of transcriptional factors such as NF1,
Sp1, AP1, AP2, GRE, HSE and NF kappa B were found. The ...
Cited by 22 - Web Search
Transcriptional regulation of inflammatory secreted phospholipases A 2
M Andreani, JL Olivier, F Berenbaum, M Raymondjean … - Biochimica et Biophysica Acta (BBA)/Molecular and Cell …, 2000 - ingentaconnect.com
... activity. Other factors like CTF/NF1 and Sp1 might be involved in the
regulation of both the rat and human promoter. Peroxisome ...
Cited by 21 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification of a 42-kDa nuclear factor (NF1-MUC5B) from HT-29 MTX cells that binds to the 3' … - Full text - MIT Libraries
P Pigny, I Van Seuningen, JL Desseyn, S Nollet, N … - Biochem Biophys Res Commun, 1996 - ingentaconnect.com
... the interaction. The nuclear factor called NF1-MUC5B which binds to this
element has aM r of 42000 and is not Sp1. These results ...
Cited by 11 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Regulation of a hair follicle keratin intermediate filament gene promoter - Full text - MIT Libraries
SM Dunn, RA Keough, GE Rogers, BC Powell - J Cell Sci, 1998 - jcs.biologists.org
... Using in vitro techniques we show that transcription factors from the Sp1,
AP2 and NF1 families are capable of binding to this promoter. ...
Cited by 21 - Web Search - jcs.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
GATA-4 and GATA-6 modulate tissue-specific transcription of the human gene for P450c17 by direct … - Full text - MIT Libraries
CE Fluck, WL Miller - Mol Endocrinol, 2004 - ncbi.nlm.nih.gov
... Binding of Sp1, Sp3, and NF1-C (nuclear factor 1-C) to the first 227 bp of 5'flanking
DNA (-227/LUC) is crucial for basal transcription in human NCI-H295A ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
Nuclear factor 1 is a component of the nuclear matrix
JM Sun, HY Chen, JR Davie - J Cell Biochem, 1994 - ncbi.nlm.nih.gov
... We show that NF1, but not Sp1, GATA-1, or UPE-binding protein, is associated
with the internal nuclear matrices of these erythroid cells. ...
Cited by 14 - Web Search - Get it from MIT Libraries
Transcriptional activation of the minimal human pro α 1 (I) collagen promoter: obligatory … - Full text - MIT Libraries
HM POPPLETON, R RAGHOW - Biochem. J, 1997 - biochemj.org
... NF1 and Sp1 have both been shown to bind to two regions of the mouse Proα1(I) collagen
gene between k129 and k110 bp and between k105 and k78 bp; over ...
Cited by 5 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
Cyclic AMP inducibility of the myelin basic protein gene promoter requires the NF1 site
RE Clark, WK Miskimins, R Miskimins - International Journal of Developmental Neuroscience, 2002 - ingentaconnect.com
... flanking region. This region contains numerous transcription factor binding
sites, including sites for NF1, Sp1, and MEBA. In order ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Novel transcriptional regulation of the human CYP3A7 gene by Sp1 and Sp3 through nuclear factor … - Full text - MIT Libraries
T Saito, Y Takahashi, H Hashimoto, T Kamataki - J. Biol. Chem, 2001 - jbc.org
... 6B). HNF-3 , NF1, USF1, and Sp1/Sp3 as Proteins Binding to the Proximal Promoter
Region of the CYP3A7 Gene-- To identify the factors detected with the 136/ 99 ...
Cited by 24 - Web Search - jbc.org - ncbi.nlm.nih.gov
NF 1/X represses PDGF A-chain transcription by interacting with Sp 1 and antagonizing Sp 1 occupancy … - Full text - MIT Libraries
LA Rafty, FS Santiago, LM Khachigian - The EMBO Journal, 2002 - embojournal.npgjournals.com
... Chromatin cross-linked protein–DNA complexes were immunoprecipitated using antibodies
to NF1, Sp1 or no antibody and the PDGF-A promoter amplified by PCR. ...
Cited by 7 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 6 versions »
Transcriptional regulation of the mouse CSF-1 gene
M Harrington, BW Konicek, XL Xia, A Song - Molecular Reproduction and Development, 1997 - doi.wiley.com
... study suggest multiple trans-acting factors may regulate CSF-1 gene expres- sion;
some may be tissue specific, while others, such as AP1, CTF/NF1, Sp1, and Sp3 ...
Cited by 6 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Human casein kinase II. The subunit alpha protein activates transcription of the subunit beta gene - Full text - MIT Libraries
A Robitzki, L Bodenbach, H Voss, W Pyerin - J Biol Chem, 1993 - jbc.org
... gel shifts and footprints with affinity-purified proteins and cellular extracts
in combination with mutational analysis we find that aside NF1 and Sp1, two out ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in … - Full text - MIT Libraries
IG Sharina, E Martin, A Thomas, KL Uray, F Murad - Proc Natl Acad Sci USA, 2003 - intl.pnas.org
... It was demonstrated that competition between NF1 and Sp1 for binding to adjacent
sites represses Sp1 activation of the mouse 1(I) collagen promoter ...
Cited by 4 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Structural characterization of the bovine CYP17 (17 {alpha}-hydroxylase) gene
CR Bhasker, BS Adler, A Dee, ME John, M Kagimoto, … - Arch Biochem Biophys, 1989 - ncbi.nlm.nih.gov
... CYP17 for consensus sequences associated with binding of transcription factors
(ie, GR, PR, CREB/ATF, AP1, AP2, AP3, AP4, AP5, OTF, CTF/NF1, SP1) shows only ...
Cited by 8 - Web Search - Get it from MIT Libraries
Association of p107 with Sp1: genetically separable regions of p107 are involved in regulation of E2 … - Full text - MIT Libraries
PK Datta, P Raychaudhuri, S Bagchi - Mol. Cell. Biol, 1995 - mcb.asm.org
... Consensus oligonucleotides containing Sp1, AP2, and NF1 binding sites were
obtained from Promega. The plus-strand sequence for the ...
Cited by 67 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Nucleoprotein structure of immediate-early promoters Zp and Rp and of oriLyt of latent Epstein-Barr … - Full text - MIT Libraries
HH Niller, D Salamon, J Uhlig, S Ranf, M Granz, F … - J Virol, 2002 - jvi.asm.org
... not shown). Sequence-specific binding of NF1 and Sp1 proteins from Mutu
I cells to their respective binding sites is shown in Fig. ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Repression of histone H5 gene expression in chicken mature erythrocytes is correlated with reduced …
JM Sun, CG Penner, JR Davie - ncbi.nlm.nih.gov
... The histone H5 promoter has binding sites for Sp1 and UPE-binding protein. The 3'
histone H5 enhancer has binding sites for Sp1, GATA-1 and NF1. ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of the hepatitis B virus major surface antigen promoter hepatocyte nuclear factor 3 … - Full text - MIT Libraries
AK Raney, A McLachlan - J Gen Virol, 1997 - vir.sgmjournals.org
... N 189 and M 1 which govern the level of transcription from this promoter and appear
to bind only ubiquitous transcription factors including NF1, Sp1 and NF-Y ...
Cited by 7 - Web Search - jgv.sgmjournals.org - vir.sgmjournals.org - ncbi.nlm.nih.gov - all 5 versions »
The promoter of the long variant of collagen XVIII, the precursor of endostatin, contains liver- … - Full text - MIT Libraries
J LIETARD, N THERET, M REHN, O MUSSO, D DARGERE, T … - Hepatology, 2000 - ncbi.nlm.nih.gov
... HNF3alpha. Gel-shift analyses showed that HNF3, NF1/CTF, and Sp1-like sites
specifically recognized nuclear factors. Super-shift ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
INCREASED PHOSPHORYLATION OF TRANSCRIPTION FACTOR Sp1 IN SCLERODERMA FIBROBLASTS - Full text - MIT Libraries
S However - ARTHRITIS & RHEUMATISM, 2000 - doi.wiley.com
... Hitraya et al reported that Sp1/NF1 binding sites of the 1(I) collagen promoter
were implicated in the up- regulation of expression of the 1(I) collagen gene ...
Cited by 22 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Xenobiotic induction of cytochrome P450 2B1 (CYP2B1) is mediated by the orphan nuclear receptor … - Full text - MIT Libraries
R Muangmoonchai, D Smirlis, SC Wong, M Edwards, IR … - Biochem J, 2001 - biochemj.org
... 3h; NF1, 5h-TCGATTTTGGATTGAAGCCAATATGA- TA3h;CYP2B1(k88\k66),5h-TCGATAGCTAAAGCAGGA-
GGCGTGAAC-3h; CYP2B1 (k48\k26), 5h-TCGATGAGTG- GAGGGGCGGATTCAGCA-3h; Sp1, 5h ...
Cited by 22 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
[CITATION] Site specific DNA methylation in the neurofibromatosis (NF1) promoter interferes with binding of …
D Rodenhiser, DN Mancini, SM Singh, TK Archer - Am J Hum Genet Suppl, 1998
Cited by 1 - Web Search - Get it from MIT Libraries
Estrogen receptor diminishes DNA-binding activities of chicken GATA-1 and CACCC-binding proteins.
LT Holth, JM Sun, AS Coutts, LC Murphy, JR Davie - DNA Cell Biol, 1997 - ncbi.nlm.nih.gov
... the H5 promoter and enhancer. In contrast, the binding activities of NF1 and
Sp1 were not affected by ER. Binding of ER to an estrogen ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Unidirectional deletion and linker scan analysis of the late promoter of the human papovavirus BK
JA Cassill, KL Deyerle, S Subramani - Virology, 1989 - ncbi.nlm.nih.gov
... The most active ones correspond to previously defined binding sites for the
transcription factors NF1 and Sp1 and a GC-rich region known to be important for ...
Cited by 1 - Web Search - Get it from MIT Libraries
Activation of SV 40 DNA replication in vivo by amplification-promoting sequences of the mouse … - Full text - MIT Libraries
C Staib, M Wegner, F Grummt - Chromosoma, 1998 - springerlink.com
... APS1 and -2 contain for example, several AP1, NF1 and SP1 binding sites (Ta- ble
1). Another mechanism to facilitate initiation could be generated through the ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
The enhancer of human papillomavirus type 16: binding sites for the ubiquitous transcription factors … - Full text - MIT Libraries
T Chong, D Apt, B Gloss, M Isa, HU Bernard - J. Virol, 1991 - pubmedcentral.nih.gov
... Only NF1 showed some qualitative cell type-specific differences. ... type 16 is activated
in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. ...
Cited by 44 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Functional analysis of the mouse Fcgrt 5'proximal promoter.
B Tiwari, RP Junghans - ncbi.nlm.nih.gov
... Electrophoretic mobility shift analysis of the proximal upstream region identified
transcription factor (TF) binding to motifs for NF1, Sp1 (GT box) and Ets. ...
Web Search - Get it from MIT Libraries
Factors involved in the regulation of type I collagen gene expression: implication in fibrosis - Full text - MIT Libraries
AK Ghosh - Exp Biol Med, 2002 - ebmonline.org
... The -138 to -77-bp region of murine COL1A1 promoter contains overlapping
NF1 and Sp1 binding sites and acts as switch element. Both ...
Cited by 23 - Web Search - ebmonline.org - ncbi.nlm.nih.gov
Transcriptional Regulation of the Rat Poly (ADP-ribose) Polymerase Gene by Sp 1
MJ Bergeron, S Leclerc, MA Laniel, GG Poirier, SL … - European Journal of Biochemistry, 1997 - blackwell-synergy.com
... transcription factors NF1 and Sp1. The position of the well-known Sp1 doublet is
indicated (R1 and R2) as well as that of an additional complex ...
Cited by 10 - Web Search - ejbiochem.org - content.febsjournal.org - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Transcriptional regulation of the rat type IIA phospholipase A 2 gene by cAMP and interleukin-1β in … - Full text - MIT Libraries
M RAYMONDJEAN - Biochem. J, 2002 - biochemj.org
... GTTCGCCAACCGGAAGTTAGGATC NF-κB GGGACAGAGGGGACTTTCCGAGAGG NF1 GGATGGCCACGTGCGCCAAGGCG
NFY GGGGTAGGAACCAATGAAATGAAACGTTA Sp1 AGCTTCCGTTGGGGCGGGGCTTCACGTCC YY1 ...
Cited by 5 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Expression of the alpha 5 Integrin Subunit Gene Promoter Is Positively Regulated by the … - Full text - MIT Libraries
K Larouche, S Leclerc, C Salesse, SL Guerin - J Biol Chem, 2000 - jbc.org
... culture dishes in the presence of either 100- or 500-fold molar excess of various
unlabeled double-stranded oligonucleotide competitors (FRE, Sp1, NF1, and p12 ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Analysis of the human ornithine aminotransferase gene family.
CB Zintz, G Inana - Exp Eye Res, 1990 - ncbi.nlm.nih.gov
... the glucocorticoid responsive element (AGAACA), a cyclic AMP-responsive element
(TGACGTCG), and recognition motifs for transcription factors AP-2, NF1 and Sp1. ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
[CITATION] Transcription factors that regulate keratin gene expression.
IM Freedberg, V Milisavljevic, RG Vidal, M …
Web Search
Comparison between E1A gene from oncogenic and non-oncogenic adenoviruses in cellular transformation …
V Lecl6re - Arch Virol, 1993 - springerlink.com
... transcription is under the control of a very complex promoter harboring several
binding sites for defined nuclear factors as ATF, E2F, E4F1, NF1, SP1, and CTF ...
Web Search - Get it from MIT Libraries
GATA-4 and GATA-6 modulate tissue-specific transcription of the human gene for P450c17 by direct … - Full text - MIT Libraries
CE Flueck, WL Miller, PWL Miller - Mol. Endocrinol, 2004 - mend.endojournals.org
... GATA site, two NF1 sites, and an Sp1/Sp3 site; mutation of the two NF1 sites plus
the Sp1/Sp3 ... Figure 2 Sp1, not NF1-C, activates the –227/LUC construct. ...
Cited by 5 - Web Search - mend.endojournals.org
Role of zinc-coordination and of the glutathione redox couple in the redox susceptibility of human … - Full text - MIT Libraries
L Knoepfel, C Steinkuhler, MT Carri, G Rotilio - Biochem Biophys Res Commun, 1994 - ncbi.nlm.nih.gov
... these results with the redox behaviour of two other transcription factors, OTF-1
and NF1, which was found to be different in several aspects from that of Sp1. ...
Cited by 17 - Web Search
Contribution of NF-kappa B and Sp1 binding motifs to the replicative capacity of human … - Full text - MIT Libraries
EK Ross, AJ Buckler-White, AB Rabson, G Englund, … - J. Virol, 1991 - pubmedcentral.nih.gov
... in non-lymphoid cells and function synergistically with NF1 elements. ... Janson L,
Pettersson U. Cooperative interactions between transcription factors Sp1 and OTF ...
Cited by 47 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Cell type-specific Transcriptional Activation and Suppression of the alpha 1 B Adrenergic Receptor … - Full text - MIT Libraries
B Gao, G Kunos - J Biol Chem, 1998 - jbc.org
... Further data showed that NF1 and Sp1 are the major transcription factors involved
in controlling the P2 promoter in liver and in DDT 1 MF-2 smooth muscle cells ...
Cited by 22 - Web Search - jbc.org - ncbi.nlm.nih.gov
A 77-base pair LINE-like sequence elicits androgen-dependent mvdp/akr1–b7 expression in mouse vas … - Full text - MIT Libraries
P Val, A Martinez, I Sahut-Barnola, C Jean, G … - Endocrinology, 2002 - endo.endojournals.org
... NF1, C/EBP, and Sp1 binding sites of the rakr1-b7 5'-flanking regions are able to
bind their respective transcription factors In the mouse adrenal gland, mvdp ...
Cited by 4 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Poster Session DP5: Oligodendrocytes & Schwann Cells
A Liu, P Casaccia-Bonnefil, T Hadzic, H Wang, A … - blackwell-synergy.com
... The mbp promoter contains numerous binding sites to different transcription factors,
among them thethyroid hormone receptor and members of the NF1, Sp1 and JAK ...
Web Search - ingentaconnect.com
| |
©2005 Google