![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 65 for NFATC2 and MYC. (0.10 seconds) |
Tumor necrosis factor receptor-associated factor (TRAF) 2 represses the T helper cell type 2 … - Full text - MIT Libraries
R Lieberson, KA Mowen, KD McBride, V Leautaud, X … - J. Exp. Med, 2001 - intl.jem.org
... TRAF2 significantly and specifically inhibits the very potent NIP45/NFATc2/c-maf ...
Lysates prepared from M12 cells transiently transfected with myc-tagged NIP45 ...
Cited by 11 - Web Search - jem.org - ncbi.nlm.nih.gov
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Elk1, Elk3, Fkbp1b, Fos, Fosb, Fosl1, Fosl2, Gata3, Gata4, Icos, Irf1, Jun, Junb,
Jund1, Maf, Max, Mef2b, Mef2d, Myc, Nfat5, Nfatc1, Nfatc2, Nfatc2ip, Nfatc3 ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... NIP45), FOS, FOSL1, FOSL2, FOXP3, GATA3, GATA4, GRLF1, ICOS, IRF1, JUN, JUNB, JUND,
MAF, MAX, MEF2A, MEF2B, MEF2D, MYC, NFAT5, NFATC1, NFATC2, NFATC3, NFATC4 ...
View as HTML - Web Search - eurogentec.com
Multiple Domains of MCIP 1 Contribute to Inhibition of Calcineurin Activity - Full text - MIT Libraries
RB Vega, J Yang, BA Rothermel, R Bassel-Duby, RS … - J Biol Chem, 2002 - jbc.org
... the first 306 amino acid residues of the human NFATc2 protein in the ... was probed with
monoclonal antibodies recognizing GFP (CLONTECH) or c-Myc (Roche Molecular ...
Cited by 26 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov
A constitutively active NFATc1 mutant induces a transformed phenotype in 3T3-L1 fibroblasts - Full text - MIT Libraries
JW Neal, NA Clipstone - J Biol Chem, 2003 - jbc.org
... factors is composed of four calcium-responsive family members (NFATc1 (NFAT2/NFATc),
NFATc2 (NFAT1/NFATp ... EBP (H-7), C/EBP (C-22), cyclin D (H-295), c-Myc (N-262 ...
Cited by 14 - Web Search - southalabama.edu - jbc.org - ncbi.nlm.nih.gov
Dual Role of Sumoylation in the Nuclear Localization and Transcriptional Activation of NFAT 1 - Full text - MIT Libraries
Y Terui, N Saad, S Jia, F McKeon, J Yuan - J Biol Chem, 2004 - jbc.org
... Four canonical members of NFAT family are known: NFAT1 (NFATp/NFATc2) (2), NFAT2 ...
Myc-tagged NFAT1 expression vector was made by cloning mouse NFAT1 cDNA into ...
Cited by 4 - Web Search - jbc.org - ncbi.nlm.nih.gov
Arginine methylation of NIP45 modulates cytokine gene expression in effector T lymphocytes - Full text - MIT Libraries
KA Mowen, BT Schurter, JW Fathman, M David, LH … - Mol. Cell, 2004 - www-biology.ucsd.edu
... transfected with HA-NFATc2 and NIP45-MycHis expression vectors and left untreated
or treated with MTA. Lysates were immunoprecipitated with anti-Myc agarose or ...
Cited by 10 - View as HTML - Web Search - ncbi.nlm.nih.gov
[CITATION] Bio/Pharma Quarterly Journal: Volume 9, Issue 1 March, 2003
C Editors, P Executives
Web Search
Mechanisms of B cell receptor induced apoptosis
J Eeva, J Pelkonen - APOPTOSIS, 2004 - kluweronline.com
... 11,15,16 NFATc2 activation ... arrest and apoptosis. 25 These events are mediated by
in- creased p27kip activity and suppression of c-myc activity. ...
Web Search - springerlink.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The NFATc 1 transcription factor is widely expressed in white cells and translocates from the … - Full text - MIT Libraries
T Marafiot, M Pozzobon, ML Hansmann, R Ventura, SA … - British Journal of Haematology, 2005 - ingentaconnect.com
... between the presence of a translocation involving the MYC locus and NFATc1 ... factors
comprises five distinct isoforms NFATc1 (NFATc, NFAT2), NFATc2 (NFATp, NFAT1 ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Cutting edge: Transcriptional activity of NFATc1 is enhanced by the Pim-1 kinase - Full text - MIT Libraries
EM Rainio, J Sandholm, PJ Koskinen - J. Immunol, 2002 - jimmunol.org
... 2, 3, 4). When overexpressed, pim genes can efficiently cooperate with myc or bcl ...
Furthermore, a detailed analysis of NFATc2 has revealed that in addition to 13 ...
Cited by 17 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Plasma cells: finding new light at the end of B cell development - Full text - MIT Libraries
KL Calame - Nat Immunol, 2001 - nature.com
... Wen, X. et al. Identification of c-myc promoter-binding protein and X-box binding
protein 1 as interleukin-6 target genes in human multiple myeloma cells. Int. ...
Cited by 72 - Web Search - cumicro2.cpmc.columbia.edu - hora.cpmc.columbia.edu - ncbi.nlm.nih.gov - all 7 versions »
Research Paper The NFATc1 transcription factor is widely expressed in white cells and translocates … - Full text - MIT Libraries
T Marafiot, M Pozzobon, ML Hansmann, R Ventura, SA … - British Journal of Haematology, 2005 - blackwell-synergy.com
... between the presence of a translocation involving the MYC locus and NFATc1 ... factors
comprises five distinct isoforms NFATc1 (NFATc, NFAT2), NFATc2 (NFATp, NFAT1 ...
Web Search
Two Functional Epitopes of Pigment Epithelial–Derived Factor Block Angiogenesis and Induce … - Full text - MIT Libraries
S Filleur, K Volz, T Nelius, Y Mirochnik, H Huang, … - Cancer Research, 2005 - cancerres.aacrjournals.org
... The 34-mer causes JNK-dependent endothelial cell apoptosis due to NFATc2 deactivation
and c-FLIP ... and NT-r. PCR products were cloned in pcDNA 4/TO/myc-His, (AgeI ...
Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
c-Jun N-terminal kinases(JNK) antagonize cardiac growth through cross-talk with calcineurin-NFAT … - Full text - MIT Libraries
Q Liang, OF Bueno, BJ Wilkins, CY Kuan, Y Xia, JD … - The EMBO Journal, 2003 - embojournal.npgjournals.com
... and cellular proliferation through phosphorylation of AP-1, p53, c-Myc and Bcl ... activated
resulting in the direct dephosphorylation of NFATc1, NFATc2, NFATc3 and ...
Cited by 12 - Web Search - nature.com - emboj.org - medicine.uiowa.edu - all 7 versions »
GEArray S Series Human Immunology Signaling Pathways Gene Array: AR-SAHS-605
FG Grouping, A Molecules, I ICAM, CS Molecules, C … - eurogentec.com
... NFAT Family Members: NFATC1, NFATC2, NFATC3, NFATC4, NFAT5. ... MADH4, MAPKAPK2, MAPKAPK3,
MAX, MEF2A, MEF2B, MEF2C, MEF2D, MHC2TA, MKNK1, MLLT7, MYC, MYF5, NFKB2 ...
View as HTML - Web Search - eurogentec.be
Solution structure of the core NFATC1/DNA complex - Full text - MIT Libraries
P Zhou, LJ Sun, V Dotsch, G Wagner, GL Verdine - Cell, 1998 - zhoulab.biochem.duke.edu
... type specificity. NFATC1 and NFATC2 appear to be the ... terleukin-2 promoter. The structure
reveals that DNA NFATC2 (also known as NFATp) predominating in rest- ...
Cited by 44 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Nuclear factor of activated T cells balances angiogenesis activation and inhibition - Full text - MIT Libraries
TA Zaichuk, EH Shroff, R Emmanuel, S Filleur, T … - Journal of Experimental Medicine, 2004 - jem.org
... revealed a critical JNK role in phosphorylation of AP-1, p53, c-Myc, Bcl-2 ... functions
diverge; whereas both JNK-1 and -2 are important for NFATc2 nuclear export ...
Cited by 5 - Web Search - jem.org - ncbi.nlm.nih.gov
Modulation of T Cell Cytokine Production by Interferon Regulatory Factor-4 - Full text - MIT Libraries
CM Hu, SY Jang, JC Fanzo, AB Pernis - J Biol Chem, 2002 - jbc.org
... 3-5). This family is comprised of four calcium-regulated members, NFAT1 (NFATc2,
NFATp), NFAT2 ... pIRES2-EGFP) or an IRF-4 expression vector (pIRES2-EGFP-myc-IRF-4 ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Transcriptional regulatory cascades controlling plasma cell differentiation - Full text - MIT Libraries
KI Lin, C Tunyaplin, K Calame - Immunological Reviews, 2003 - blackwell-synergy.com
... Blimp-1 represses a gene expression program associated with cell proliferation and
growth (66), including the previously identified direct target c-myc and c ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The X-box binding protein-1 transcription factor is required for plasma cell differentiation and the … - Full text - MIT Libraries
NN Iwakoshi, AH Lee, LH Glimcher - Immunological Reviews, 2003 - blackwell-synergy.com
... specific example of this regulation is the repression of c-myc, thereby allowing ...
In contrast, mice lacking Bcl-6, Ets-1, and NFATc1/NFATc2 have overproduction ...
Cited by 14 - Web Search - ncbi.nlm.nih.gov
In vivo expression of myosin essential light chain using plasmid expression vectors in regenerating …
DA Robinson, SN Bremner, K Sethi, SB Shah, SR … - Gene Therapy, 2005 - nature.com
... sion vector consisted of a strong cytomegalovirus (CMV) enhancer/promoter with a
3 0 -SV40 enhancer driving the expression of MLC1 f , with a c-myc epitope tag ...
Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
NFAT is a nerve activity sensor in skeletal muscle and controls activity-dependent myosin switching
KJA McCullagh, E Calabria, G Pallafacchina, S … - Proceedings of the National Academy of Sciences - pnas.org
... Mice lacking NFATc2 or -c3 exhibit reduced muscle fiber size or number, respectively,
but ... as control, and the cain inhibitory domain fused to a myc epitope (23 ...
Cited by 7 - Web Search - pubmedcentral.nih.gov - gims.tcu.edu.tw - dx.doi.org - all 6 versions » - Get it from MIT Libraries
The B lymphocyte adaptor molecule of 32 kD (Bam32) regulates B cell antigen receptor signaling and … - Full text - MIT Libraries
H Niiro, A Maeda, T Kurosaki, EA Clark - J. Exp. Med, 2002 - intl.jem.org
... 12.5% SDS-PAGE gel, and analyzed by Western blotting with anti-Myc mAb (0.5 ... NFATc1
and NFATc2 together control both T and B cell activation and differentiation ...
Cited by 21 - Web Search - dx.doi.org - intl.jem.org - ncbi.nlm.nih.gov - all 5 versions »
Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation - Full text - MIT Libraries
B Li, C Tournier, RJ Davis, RA Flavell - The EMBO Journal, 1999 - embojournal.npgjournals.com
... pSH210 (expression vector for human NFATc2/NFATp) was kindly provided by Dr G.Crabtree. ...
et al., 1994 ), GST-ATF2 (Gupta et al., 1995 ) and GST-Myc (Alvarez et ...
Cited by 110 - Web Search - nature.com - emboj.org - ncbi.nlm.nih.gov - all 7 versions »
NFAT Is Involved in the Depolarization-Induced Activation of Growth Hormone Releasing Hormone Gene …
M ASAI, Y IWASAKI, M YOSHIDA, N MUTSUGA-NAKAYAMA, … - mend.endojournals.org
... CA) or monoclonal mouse antibodies to c-Myc (sc-40, dilution 1:1000; Santa Cruz),
the blot ... NFATp (NFATc2) is a repressor of chondrogenesis. J Exp Med 191:9-21 ...
Web Search - dx.doi.org - mend.endojournals.org
FAS ligand gene transfer for cancer therapy
JF Modiano, AR Lamerato-Kozicki, CM Jubala, D … - cancer-therapy.org
... LKLF is sufficient to program T cell quiescence via a c-Myc- -dependent pathway ... Coons
T, Bellgrau D and Modiano JF (2004) Nicotine activates NFATc2 and prevents ...
View as HTML - Web Search - modianolab.org
NFAT transcription factors: from cell cycle to tumor development - Full text - MIT Libraries
JPB Viola, LDS Carvalho, BPF Fonseca, LK Teixeira, … - Braz J Med Biol Res, 2005 - scielo.br
... calcium/calcineurin signaling pathway, known as NFAT1 (also called NFATp, NFATc2),
NFAT2 (NFATc ... genes, such as cyclin D1, cyclin D2, pRB, and c-Myc (6). Finally ...
Cached - Web Search - scielo.br - ncbi.nlm.nih.gov
Nuclear Factor of Activated T Cells (NFAT) Is Involved in the Depolarization-Induced Activation of … - Full text - MIT Libraries
M Asai, Y Iwasaki, M Yoshida, N Mutsuga-Nakayama, … - Molecular Endocrinology - mend.endojournals.org
... Cruz Biotechnology, Santa Cruz, CA) or monoclonal mouse antibodies to c-Myc
(sc-40 ... factor of activated T cells (NFAT) transcription factor NFATp (NFATc2) is ...
Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Endothelin-1–Dependent Nuclear Factor of Activated T Lymphocyte Signaling Associates With … - Full text - MIT Libraries
T Kawamura, K Ono, T Morimoto, M Akao, E Iwai- … - Circulation Research, 2004 - circresaha.org
... It was reported that the NH 2 -terminal region of NFATc2 directly interacts with
the ... Y. Endothelin-1 is a potent survival factor for c-Myc-dependent apoptosis. ...
Cached - Web Search - circres.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 9 versions »
Critical roles of c-Jun signaling in regulation of NFAT family and RANKL-regulated osteoclast … - Full text - MIT Libraries
F Ikeda, R Nishimura, T Matsubara, S Tanaka, J … - J Clin Invest, 2004 - jci.org
... with undifferentiated RAW264 cells (Figure 4A). Moreover, NFAT1 (NFATc2/NFATp) was ...
then subcloned into pcDNA3 (Invitrogen Corp.) tagged with a Myc epitope in ...
Cited by 7 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
[CITATION] Identification of a KRAB-containing zinc finger protein, ZNF304, by AU-motif-directed display method … - Full text - MIT Libraries
L Sabater, Y Ashhab, P Caro, EC Kolkowski, R Pujol … - Biochemical and Biophysical Research Communications, 2002 - Academic Press
... factor LKLF is sufficient to program T cell quiescence via a c-Myc-dependent pathway,
Nat. ... [24] JG van Rietschoten et al., Silencer activity of NFATc2 in the ...
Cited by 1 - Web Search - lirad.org - ingentaconnect.com - all 4 versions »
REGULATORY MECHANISMS THAT DETERMINE THE DEVELOPMENT AND FUNCTION OF PLASMA CELLS - Full text - MIT Libraries
KL Calame, KI Lin, C Tunyaplin - Annual Review of Immunology, 2003 - immunol.annualreviews.org
... In the mouse lymphoma cell line BCL1, where treatment with cytokines induces
plasmacytic differentiation, ectopic expression of either c-Myc or cyclin E to ...
Cited by 38 - Web Search - phyto.annualreviews.org - nutr.annualreviews.org - ncbi.nlm.nih.gov - all 6 versions »
Kuo-I Lin Chainarong Tunyaplin Kathryn Calame - Full text - MIT Libraries
KI Lin - Immunological Reviews, 2003 - ingentaconnect.com
... Blimp-1 represses a gene expression program associated with cell proliferation and
growth (66), including the pre- viously identified direct target c-myc and c ...
Web Search
From signatures to models: understanding cancer using microarrays - Full text - MIT Libraries
E Segal, N Friedman, N Kaminski, A Regev, D Koller - Nature Genetics, 2005 - cgr.harvard.edu
Page 1. S38 VOLUME 37 | JUNE 2005 | NATURE GENETICS SUPPLEMENT PERSPECTIVE
Genomics has the potential to revolutionize the diagnosis ...
Cited by 3 - Web Search - ai.stanford.edu - nature.com - ncbi.nlm.nih.gov - all 5 versions »
Neal N. Iwakoshi Ann-Hwee Lee Laurie H. Glimcher - Full text - MIT Libraries
NN Iwakoshi, AH Lee - Immunological Reviews, 2003 - ingentaconnect.com
... A specific example of this regulation is the repression of c-myc, thereby allowing
the B cell to exit the cell cycle and ... Ets-1 Bcl-6 BSAP/Pax-5 NFATc1 NFATc2 ...
Web Search
Alteration in temporal kinetics of Ca 2 signaling and control of growth and proliferation - Full text - MIT Libraries
L Lipskaia, AM Lompre - Biology of the Cell, 2004 - biolcell.org
Page 1. Review Alteration in temporal kinetics of Ca 2+ signaling and control
of growth and proliferation Larissa Lipskaia *,Anne-Marie Lompré ...
Cited by 6 - View as HTML - Web Search - ncbi.nlm.nih.gov
Recombinant p21 Protein Inhibits Lymphocyte Proliferation and Transcription Factors - Full text - MIT Libraries
AK Khanna, M Plummer, V Nilakantan, GM Pieper - The Journal of Immunology, 2005 - jimmunol.org
... NFATC2 transcription factor regulates cell cycle progression during lymphocyte
activation: evidence ... growth factor , cyclin inhibitor p21, and c-myc on smooth ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Polycystin-1 Activates the Calcineurin/NFAT(Nuclear Factor of Activated T-cells) Signaling Pathway - Full text - MIT Libraries
S Puri, BS Magenheimer, RL Maser, EM Ryan, CA Zien … - J Biol Chem, 2004 - jbc.org
... HA-tagged and Myc-tagged PC2 constructs (59) were obtained from Dr. L ... 5'-
CCTTCGGAAGGGTGCCTTTT-3' and 5'-AGGCGTGGGGCCTCAGCAGG-3'); NFATc2 (5'- ...
Cited by 1 - Web Search - jbc.org - ncbi.nlm.nih.gov
Transcriptional activation of human TR3/nur77 gene expression by human T-lymphotropic virus type I … - Full text - MIT Libraries
X Liu, X Chen, V Zachar, C Chang, P Ebbesen - J. Gen. Virol, 1999 - vir.sgmjournals.org
... infected cells, such as IL-2R , IL-1 , GM-CSF, c-myc and vimentin ... antibody (clone
K-18, Santa Cruz Biotechnology) that can recognize NFATc1, NFATc2, NFATc3 and ...
Cited by 10 - Web Search - jgv.sgmjournals.org - jgv.sgmjournals.org - ncbi.nlm.nih.gov - all 5 versions »
Combined Deficiency of p50 and cRel in CD4 T Cells Reveals an Essential Requirement for Nuclear …
Y Zheng, M Vig, J Lyons, L Van Parijs, AA Beg - columbia.edu
... The primers used in the experiments were: IL-2: 5 primer AACAGCGCA- CCCACTTCAA,
3 primer TTGAGATGATGCTTTGACA; c-Myc: 5 primer CGACGATGCCCCTCAACGTG, 3 primer ...
View as HTML - Web Search
Tumor Necrosis Factor alpha and Interleukin 1 Stimulate the Human Immunodeficiency Virus Enhancer by … - Full text - MIT Libraries
L Osborn, S Kunkel, GJ Nabel - Blood, 2005 - pnas.org
... Willard-Gallo Identification of Three NFAT Binding Motifs in the 5'-Upstream Region
of the Human CD3gamma Gene That Differentially Bind NFATc1, NFATc2, and NF ...
Cited by 321 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[CITATION] The Yins of T Cell Activation
JO Liu
... LKLF is sufficient to program T cell quiescence via a c-Myc–dependent pathway. ... SL
Peng, AJ Gerth, AM Ranger, LH Glimcher, NFATc1 and NFATc2 together control ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Workshop J Signal Transduction and Gene Regulation
T Brdicka, N Brdickova, M Imrich, B Schraven, V … - ingentaconnect.com
Page 1. 1 Institute of Molecular Genetics, Academy of Sciences of the Czech
Republic, Prague, Czech Republic and 2 Institute of Immunology ...
Web Search
Regulation of plasma-cell development - Full text - MIT Libraries
M Shapiro-Shelef, K Calame - Nature Reviews Immunology, 2005 - nature.com
... T cells (NFAT)-dependent enhancer,and development of B1a cells in both the peritoneal
cavityand the spleen requires NFATc1 but is independent of NFATc2 ...
Cited by 1 - Web Search - immuneweb.xxmc.edu.cn - ncbi.nlm.nih.gov
New perceptions of transcription factor properties from NMR - Full text - MIT Libraries
S Bagby, CH Arrowsmith, M Ikura - Biochem. Cell Biol, 1998 - article.pubs.nrc-cnrc.gc.ca
... direction that the NFATC1 DBD and AP-1 domains must move to adopt the positions
observed in the X-ray crystallographic structure of the ternary NFATC2–AP-1 ...
Cited by 1 - Web Search - article.pubs.nrc-cnrc.gc.ca - nmr.uhnres.utoronto.ca - ncbi.nlm.nih.gov - all 5 versions »
Cardiovascular Toxicology
F Myocardium, BCD Alive, C Death, D Cardiomyopathy … - Cardiovascular Toxicology, 2003 - neurosci.humanapress.com
... interact with NF-κB include AP-1, CREB, NF-IL, myc, Stat1, IRF ... family of transcription
factors consists of five family members (NFATc1, NFATc2, NFATc3, NFATc4 ...
Web Search - biomed.humanapress.com - journals.humanapress.com - ingentaconnect.com - all 10 versions »
NFAT transcription factors: from cell cycle to tumor development - Full text - MIT Libraries
D de Biologia Celular, IN de Cancer, R de Janeiro, … - Brazilian Journal of Medical and Biological Research, 2005 - scielo.br
... calcium/ calcineurin signaling pathway, known as NFAT1 (also called NFATp, NFATc2),
NFAT2 (NFATc ... genes, such as cyclin D1, cyclin D2, pRB, and c-Myc (6). Finally ...
View as HTML - Web Search - scielo.br
c-Maf and JunB Mediation of Th2 Differentiation Induced by the Type 2 G Protein-Coupled Receptor ( … - Full text - MIT Libraries
J Voice, S Donnelly, G Dorsam, G Dolganov, S Paul, … - The Journal of Immunology, 2004 - jimmunol.org
... c-Maf, a member of the basic leucine zipper factor AP-1 family, cooperates with
NFAT1, NFATc2, and NIP-45, and synergizes with JunB and IFN regulatory factor 4 ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
SIGNALING PATHWAYS IN MYOCYTE HYPERTROPHY
B Oulu - herkules.oulu.fi
... The first genetic response to increased load is activation of a pattern of early
response, or immediate early genes: c- fos, c-myc and c-jun (Yamazaki et al. ...
View as HTML - Web Search
| |
©2005 Google