![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 95 for PAX2 and SRY. (0.19 seconds) |
Female pseudohermaphroditism with multiple caudal anomalies: absence of Y-specific DNA sequences as …
LH Seaver, J Grimes, RP Erickson - Am J Med Genet, 1994 - ncbi.nlm.nih.gov
... Chromosome. Gene Symbols: PAX2; SRY. Substances: DNA Primers. Grant Support:
HD 20670/HD/NICHD. PMID: 7913293 [PubMed - indexed for MEDLINE]
Cited by 3 - Web Search - Get it from MIT Libraries
Mutations in SRY and WT1 genes required for gonadal development are not responsible for XY partial … - Full text - MIT Libraries
EB Tagliarini, JG Assumpcao, MR Scolfaro, MP de … - Braz J Med Biol Res, 2005 - scielo.br
... These findings suggest that, although rare, SRY mutations should be screened in ... the
mature glomerulus function, by repressing or activating PAX2 expression (37 ...
Cited by 1 - Cached - Web Search - scielo.br - ncbi.nlm.nih.gov
Mutations in SRY and WT1 genes required for gonadal development are not responsible for XY partial … - Full text - MIT Libraries
JG Assumpcao, MR Scolfaro, MP de Mello, AT Maciel- … - Braz J Med Biol Res, 2005 - scielo.br
... cells (podocytes) of the ma- ture glomerulus function, by repressing or activating
PAX2 expression (37,38 ... SRY and WT1 genes in XY partial gonadal dysgenesis ...
View as HTML - Web Search - scielo.br
PAX genes in development and disease: The role of PAX2 in urogenital tract development
MR Eccles, S He, M Legge, R Kumar, J Fox, C Zhou, … - Int J Dev Biol, 2002 - ijdb.ehu.es
Page 1. PAX genes in development and disease: the role of PAX2 ... In the developing
metaneph- ros, the expression of Pax2 and the related Pax gene, Pax8, Page 3. ...
Cited by 5 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - ijdb.ehu.es - Get it from MIT Libraries
Molecular bases of human kidney malformations - Full text - MIT Libraries
AS Woolf - Pediatric Nephrology, 1997 - springerlink.com
... Interestingly, in the above study, we found that PAX2 protein expression was
upregulated ... dys- plasia are caused by mutations in and around the SRY-related gene ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... PAX2 USF 23.6 AP1 PBX1 359.6 RSRFC4 TATA 95.2 ATF TCF11 42.3 E47 TAL1BETAE47 23.5
CEBPA Oct-1 356.2 CREB XBP1 95.0 CDPCR3 ETS2 40.2 AP1 CREB 23.2 FREAC2 SRY ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
Development of the Mammalian Female Reproductive Tract - Full text - MIT Libraries
Y Yin, L Ma - Journal of Biochemistry, 2005 - jb.oxfordjournals.org
... I., Meisler, MH, and Busslinger, M. (1997) Cooperation of Pax2 and Pax5 in ... Badge,
R. (1991) Male development of chromosomally female mice transgenic for Sry. ...
Web Search - jb.oxfordjournals.org
Zebrafish sox 9 b is an early neural crest marker - Full text - MIT Libraries
M Li, C Zhao, Y Wang, Z Zhao, A Meng - Development Genes and Evolution, 2002 - springerlink.com
... Sox9 is a member of the SRY-like HMG box (SOX)-con- taining gene family. ... 3- and
10-somite embryos simultaneously labeled with sox9b (blue) and pax2 (red) probes ...
Cited by 15 - Web Search - ncbi.nlm.nih.gov
Anatomy of human nephrogenesis
AS WOOLF - adc.bmjjournals.com
... Mutations of the PAX2 gene in a family with optic nerve colobomas, renal ... and campomelic
dysplasia are caused by mutations in and around the SRY-related gene ...
Web Search - adc.bmjjournals.com
Anatomy of human nephrogenesis
AD Child - archdischild.com
... Mutations of the PAX2 gene in a family with optic nerve colobomas, renal ... and campomelic
dysplasia are caused by mutations in and around the SRY-related gene ...
Cached - Web Search
Establishment and characterization of conditionally immortalized cells from the mouse urogenital … - Full text - MIT Libraries
B Capel, JR Hawkins, E Hirst, D Kioussis, R Lovell … - J Cell Sci, 1996 - jcs.biologists.org
... markers: clonal lines 7c3 and 15bN1 show clear differences in the expression of
Pax2 and Wt1 (Fig. 7). However, no clonal line tested so far expresses Sry. ...
Cited by 13 - Web Search - jcs.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to … - Full text - MIT Libraries
S Grimmond, N Van Hateren, P Siggers, R Arkell, R … - Human Molecular Genetics, 2000 - hmg.oxfordjournals.org
... A panel of 12 control genes (Sry, Sox9, Wnt4, Dhh, Oct4, Gata4, Pax2, Pax8, Dax1,
Amh, 17 -hydroxylase, 3ß-HSD) was also collected for inclusion on the ...
Cited by 38 - Web Search - hmg.oupjournals.org - hmg.oupjournals.org - ncbi.nlm.nih.gov - all 6 versions »
Sex determination and differentiation - Full text - MIT Libraries
DT MacLaughlin, PK Donahoe - N Engl J Med, 2004 - nejm.org
... important for limb development; Lhx9 a lim homeobox family member; PAX2 paired box
homeotic gene; SF-1 the gene for steroidogenic factor 1; SRY sex-determining ...
Cited by 15 - View as HTML - Web Search - uni-marburg.de - fiu.edu - ncbi.nlm.nih.gov - all 7 versions »
Getting your Pax straight: Pax proteins in development and disease
N Chi, JA Epstein - Trends Genet, 2002 - instruct.uwo.ca
... PAX2 X X X CNS, kidney 10q25 Renal-coloboma syndrome ... of the high mobility group
(HMG) of transcription factors that includes sex-determining-region-y (Sry). ...
Cited by 54 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
GATA TRANSCRIPTION FACTORS IN THE DEVELOPMENT AND TUMORS OF THE ADRENAL CORTEX
S Kiiveri, B Helsinki - ethesis.helsinki.fi
... explained in the text are as follows: MC2R, ACTH receptor; SRY, testis-determining
factor encoded on the Y chromosome; SOX9, SRY- box gene; PAX2, paired-box ...
View as HTML - Web Search - ethesis.helsinki.fi
[CITATION] Sex Determination and Differentiation
G Cells
... important for limb development; Lhx9 a lim homeobox family member; PAX2 paired box
homeotic gene; SF-1 the gene for steroidogenic factor 1; SRY sex-determining ...
Web Search - nejm.org - nejm.org - click.nejm.org - all 4 versions »
Requirement of Lim 1 for female reproductive tract development - Full text - MIT Libraries
A Kobayashi, W Shawlot, A Kania, RR Behringer - Development, 2004 - dev.biologists.org
... The Sry and control bands are 230 bp and 590 bp, respectively. For Pax2 mice:
mPax2-Fw1, CCCACCGTCCCTTCCTTTTCTCCTCA; mPax2-Rv2, GAAAGGCCAGTGTGGCCTCTAGGGTG; PGK ...
Cited by 5 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genetic Control of Sexual Differentiation in Humans
VB Chernykh, LF Kurilo - RUSSIAN JOURNAL OF GENETICS, 2001 - springerlink.com
... These are genes GATA4, LIM1, SF1 and WT1 (Fig. 1). Testis-determining genes, SRY
and SOX9, comprise the second group. ... 1 SRY (Sex-Determining Region Y) ...
Web Search - kluweronline.com - ingentaconnect.com
Intrarenal cells, not bone marrow–derived cells, are the major source for regeneration in … - Full text - MIT Libraries
F Lin, A Moran, P Igarashi - J. Clin. Invest, 2005 - jci.org
... Lycopersicon esculentum lectin; LTA, Lotus tetragonolobus agglutinin; Pax2, paired
box gene 2; PCNA, proliferating cell nuclear antigen; Sry, sex determining ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - jci.org
Mammalian sex determination: a molecular drama - Full text - MIT Libraries
A Swain, R Lovell-Badge - Development, 1999 - genesdev.org
... of these genes are involved in upstream events, such as Sry regulation, whether ...
contribute to the cells of the early gonad, although the Pax2 mutant phenotype ...
Cited by 134 - Web Search - mcb.berkeley.edu - mne.uni-karlsruhe.de - npb.ucdavis.edu - all 7 versions »
Invertebrates may not be so different after all
D Zarkower - Novartis Found Symp, 2002 - doi.wiley.com
... In contrast, in Xenopus the onset of Pax2 and Pax8 expression is swapped. ... to your
hypothesis about Dmrt1 being a genital ridge- speci¢c activator for Sry. ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
MENDELIAN AND NON-MENDELIAN GENETICS
XL INHERITANCE, XL RECESSIVE - bol.ucla.edu
... mut absence of the iris (aniridia) c. COLOBOMA-RENAL SYNDROME – PAX2 2. SONIC ... subsequent
to gonadal development The Y chromosome has an SRY (sex determining ...
View as HTML - Web Search
Developmental genetics of the female reproductive tract in mammals - Full text - MIT Libraries
A Kobayashi, RR Behringer - Nature Reviews Genetics, 2003 - nature.com
... Neubuser, A. & Busslinger, M. Nephric lineage specification by Pax2 and Pax8 ... Direct
interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates ...
Cited by 8 - Web Search - nature.com - ncbi.nlm.nih.gov
Clinical Report Early Renal Insufficiency in a Neonate With De Novo Partial Trisomy of Chromosome 10 … - Full text - MIT Libraries
NM Varda, NK Vokac, Z Kanic, K Bracic, A Erjavec, … - American Journal of Medical Genetics, 2003 - doi.wiley.com
... gamma-complex associated protein 3), IRS2 (insulin receptor substrate 2), SOX1
(SRY-like HMG ... more than 30 genes are located, among them FGFR2 gene and PAX2 gene ...
Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The battle of the sexes - Full text - MIT Libraries
B Capel - Mech Dev, 2000 - note.cellbio.duke.edu
... Sry expression peaks at 11.5 dpc in XY gonadal cells, inducing growth of the ... tubules,
and surrounding mesenchyme, including Wt1, Pax2, and several Wnt genes. ...
Cited by 75 - View as HTML - Web Search - frontiers-in-genetics.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Transcription factors in dysmorphology - Full text - MIT Libraries
D Lacombe - Clinical Genetics, 1999 - blackwell-synergy.com
... Mutation of the PAX2 gene in a family with optic nerve colobomas, renal ... dysplasia
and autosomal sex reversal caused by mutations in an SRY-related gene. ...
Web Search - ncbi.nlm.nih.gov
Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain … - Full text - MIT Libraries
M Rhinn, A Dierich, W Shawlot, RR Behringer, M Le … - Development, 1998 - dev.biologists.org
... Other genes such as Six3 (Oliver et al., 1995), a homologue of sine oculis, Pax2
(Rowitch and McMahon, 1995), a homologue of paired, and En1 and En2 (Davis and ...
Cited by 127 - Web Search - dev.biologists.org - wwwlib.bionet.nsc.ru - ncbi.nlm.nih.gov
A human homologue of the Drosophila eyes absent gene underlies Branchio-Oto-Renal(BOR) syndrome and …
S Abdelhak, V Kalatzis, R Heilig, S Compain, D … - Nature Genetics, 1997 - nature.com
... and campomelic dysplasia are caused by mutations in and around the SRY-Related Gene
SOX9 ... Mutation of the PAX2 gene in a family with optic nerve colobomas, renal ...
Cited by 144 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
[BOOK] Essentials of Paediatric Urology
D Thomas, AMK Rickwood, PG Duffy - 2002 - print.google.com
... tract, eg autosomal dominant polvcvs- tic kidney disease, X-linked Kallmann's syndrome
and renal coloborna syndrome (mutation of the PAX2 gene encoding for a ...
Cited by 2 - Web Search - Get it from MIT Libraries - Library Search
Pax3 is required for enteric ganglia formation and functions with Sox10 to modulate expression of c- … - Full text - MIT Libraries
D Lang, F Chen, R Milewski, J Li, MM Lu, JA … - J. Clin. Invest, 2000 - jci.org
... group (HMG) of nuclear factors related to the sex-determining factor Sry (26). ...
ß-galactosidase, and variable amounts of pCMV-Pax3 (42), pCMV-Pax2 (provided by ...
Cited by 29 - Web Search - jci.org - pubmedcentral.nih.gov - uphs.upenn.edu - all 7 versions »
Emx2 developmental expression in the primordia of the reproductive and excretory systems - Full text - MIT Libraries
F Lucchini, M Fumi, A Forabosco - Anat Embryol, 1997 - springerlink.com
... 1183 Dressler GR, Deutsch U, Chowdhury K, Nornes HO, Gruss P (1990) Pax2, a new ...
dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov
Status of the Human Malformation Map: 2002
JC CAREY, DH VISKOCHIL - American Journal of Medical Genetics (Semin. Med. Genet.), 2002 - doi.wiley.com
... Bruck syndrome 259458 259450 17p12 BRKS Telopeptide lysyl hydroxylase, bone-specific
Campomelic dysplasia 114290 114290 17q24.3-q25.1 SOX9 SRY-box 9 ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The malformed kidney: disruption of glomerular and tubular development - Full text - MIT Libraries
TD Piscione, ND Rosenblum - Clinical Genetics, 1999 - blackwell-synergy.com
... 2A,E). Putative gene targets for WT1 have been identified in vitro and
include Pax2 and Igf2 [19,22]. ... The Pax2 homeodomain gene ...
Cited by 7 - Web Search - ncbi.nlm.nih.gov
Sertoli Cells of the Mouse Testis Originate from the Coelomic Epithelium - Full text - MIT Libraries
J Karl, B Capel - Developmental Biology, 1998 - note.cellbio.duke.edu
... the male at approximately 12.5 dpc, about 48 h after Sry expression begins. ... Second,
in Pax2 null mutants, mesonephric tubules never develop into mature tubules ...
Cited by 63 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
MAMMALIAN KIDNEY DEVELOPMENT: MOLECULES TO TREATMENT
SE QUAGGIN - Fetal and Maternal Medicine Review, 2003 - journals.cambridge.org
... mesonephric cells into the mammalian gonad depends on Sry. Mech Dev 1999; 84:
127–31. 7 Dressler GR, Deutsch U, Chowdhury K, Nornes HO, Gruss P. Pax2, a new ...
Web Search - dx.doi.org - journals.cambridge.org
Expression of Sox3 throughout the developing central nervous system is dependent on the combined … - Full text - MIT Libraries
S Brunelli, ES Casey, D Bell, R Harland, R Lovell- … - Genesis, 2003 - doi.wiley.com
... similar to that of the mammalian testis determining factor SRY (Gubbay et al ... WNT1,
FGF8) and transcription factors (OTX2, GBX2, EN1, EN2, PAX2, PAX5) (Simeone ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
P. 246 Sex Differentiation, Miniposter Chromosomal Localization of a Gene (s) for Urogenital …
MRA Action, AR Syndromes - content.karger.com
... suggest that the putative gene(s) for urogenital development, other than PAX2 and
EXM2 ... The caryotype was 46 XY, SRY large deletion was excluded on the basis of ...
Web Search - content.karger.com
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... PAX4 04 Pax-4 binding sites PAX6 01 Pax-6 PU1 B Pu.1 (Pu120) Ets-like transcription
factor identified in lymphoid B-cells S8 01 S8 SOX9 B1 SOX (SRY-related HMG ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Evolution of neural crest and placodes: amphioxus as a model for the ancestral vertebrate? - Full text - MIT Libraries
LZ HOLLAND, ND HOLLAND - Journal of Anatomy, 2001 - journals.cambridge.org
... Nevertheless, the ex- pression of the ascidian homologues of Pax2\5\8 in the ascidian
atrial primordia has been taken in support of their homology with the ...
Cited by 33 - Web Search - journals.cambridge.org - blackwell-synergy.com - ncbi.nlm.nih.gov
F rontiers in Fetal Health
HG Mutations, P Developmental - sickkids.on.ca
... aplasia secondary to failure of ureteric bud outgrowth 46 (Figure 2A,E). Putative
gene targets for WT1 have been identified in vitro and include Pax2 and Igf2. ...
View as HTML - Web Search
Partial Monosomy of Distal 10q: Three New Cases and - Full text - MIT Libraries
DJ Waggoner, CK Chow, SB Dowton, MS Watson - American Journal of Medical Genetics, 1999 - doi.wiley.com
... the down- stream regulatory cascade from the testis-determining gene (SRY) as suggested ...
The PAX2 gene associated with optic nerve colo- boma-renal disease was ...
Cited by 7 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Changes of gene expression profiles during neuronal differentiation of central nervous system … - Full text - MIT Libraries
DH Yu, KH Lee, JY Lee, S Kim, DM Shin, JH Kim, YS … - Journal of Neuroscience Research, 2004 - doi.wiley.com
... forkhead box J1, ferritin heavy polypeptide 1, and benzodiazepine receptor (peripheral),
whereas the down-regulated genes included SRY-box- containing gene 11 ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Expression of POU, Sox, and Pax Genes in the Brain Ganglia of the Tropical Abalone Haliotis asinina - Full text - MIT Libraries
EK O'Brien, BM Degnan - Marine Biotechnology, 2000 - springerlink.com
... Mouse Pax2 and Pax5 genes are also expressed in adult reproductive organs (Strachan
and ... A comparison of the properties of Sox-3 with Sry and two related genes ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Distinct cis-essential modules direct the time-space pattern of the Pax6 gene activity - Full text - MIT Libraries
B Kammandel, K Chowdhury, A Stoykova, S Aparicio, … - Dev. Biol, 1999 - fbmc.fcen.uba.ar
Page 1. Distinct cis-Essential Modules Direct the Time– Space Pattern of
the Pax6 Gene Activity Birgitta Kammandel, Kamal Chowdhury ...
Cited by 66 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
INVITED EDITORIAL Phenotypes of Patients with “Simple” Mendelian Disorders Are Complex Traits: … - Full text - MIT Libraries
KM Dipple, ERB McCabe - Am. J. Hum. Genet, 2000 - genetics.ucla.edu
... environmental factors or genes that are inherited independently of PAX2 are influencing ...
Mutations in SRY, the gene encoding the testis-determining factor, are ...
Cited by 2 - View as HTML - Web Search - med.umich.edu - genetics.ucla.edu
Exploring the etiology of haploinsufficiency - Full text - MIT Libraries
RA Veitia - BioEssays, 2002 - doi.wiley.com
... (5) Simple HI of SOX10, an SRY-related factor ... It has beenproposed that the same
phenomenon could underlie HI of other PAX genes like PAX1, PAX2, PAX3, PAX6 and ...
Cited by 31 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Onset of Tlx-3 expression in the chick cerebellar cortex correlates with the morphological … - Full text - MIT Libraries
C LOGAN, C MILLAR, V BHARADIA, K ROULEAU - THE JOURNAL OF COMPARATIVE NEUROLOGY, 2002 - doi.wiley.com
... sag- ittal section through the same cerebellum processed in parallel for in situ
hybridization using a probe for the transcription factor, Sox11 (SRY-like HMG ...
Web Search - ncbi.nlm.nih.gov
Evolving eyes.
RD FERNALD - Int. J. Dev. Biol, 2004 - stanford.edu
... receptor, optix-homeodomain/six domain, OTX1-orthodenticle homologue 1, PAX2-paired
box ... fold homeobox, so-sine oculus homeodomain/six domain, SOX2-SRY-box with ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Phenotypes of Patients with" Simple" Mendelian Disorders Are - Full text - MIT Libraries
G Disease - Am. J. Hum. Genet, 2000 - journals.uchicago.edu
... environmental factors or genes that are inherited independently of PAX2 are influencing ...
Mutations in SRY, the gene encoding the testis-determining factor, are ...
Web Search
Eyes: Variety, Development and Evolution - Full text - MIT Libraries
F Alert, RG Northcutt, C San Diego, MS Northcutt, … - Brain, Behavior and Evolution, 2004 - content.karger.com
... optix, homeodomain/six domain; OTX1, orthodenticle homologue 1; PAX2, paired box ...
fold homeobox; so, sine oculus homeodomain/six domain; SOX2, SRY, box with ...
Web Search - dx.doi.org - content.karger.com - karger.com
|
©2005 Google