![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 3 of 3 for PAX5 and E2F2. (0.02 seconds) |
A Novel Gene, MDS2, Is Fused to ETV6/TEL in a t (1; 12)(p36. 1; p13) in a Patient With …
MD Odero, JL Vizmanos, JP Roman, I Lahortiga, C … - Genes Chromosomes Cancer, 2002 - doi.wiley.com
... ASC2 (5q13), PDGFRB (5q33), STL (6q23), MNX1 (7q36), PAX5 (9p13), JAK2 ... X69111-F ID3
CCCCGGTATCAGCGCTTCCTCATT X69111-R ID3 CGCCTTCATGCTGGGGAGTGAGT E2F2-F E2F2 ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
HLXB9 activates IL6 in Hodgkin lymphoma cell lines and is regulated by PI3K signalling involving E2F …
S Nagel, M Scherr, H Quentmeier, M Kaufmann, M … - Leukemia, 2005 - nature.com
... to the attenuation therein of the B-cell commitment program orchestrated by PAX5.
24. ... 35 Analysis of SP-1, E2F1, E2F2, and E2F3 (Figure 1, Supplementary Table 2 ...
Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Comparative genomics provides evidence for an ancient genome duplication event in sh
JS Taylor, Y Van de Peer, I Braasch, A Meyer - Phil. Trans. R. Soc. Lond. B, 2001 - journals.royalsoc.ac.uk
... TCF4/E2b 4507399 ö 7305551 ö ö TCF12/E2c 4507391 ö 346644 416847 ö E2F2 4758226
ö ö ö ö E2F3 4503433 ö 3122045 ö ö EGF 4503491 ö 6753732 ö ö ...
Cited by 102 - Web Search - evolutionsbiologie.uni-konstanz.de - mit.edu - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
|
©2005 Google