![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 22 of 22 for PAX5 and EGR1. (0.02 seconds) |
Oligo GEArray® Human Hematopoietic Stem Cells and Hematopoiesis Microarray
S Conditions - search.cosmobio.co.jp
... and Regulators: ASH2L, BCL11A, CBFB, CD80, CD86, CEBPE, CEBPG, EGR1, ETS1, ETV6 ... KLF6,
LEF1, MAFB, MYC, NCOA6, NFYA, NOTCH1, NOTCH2, NOTCH4, PAX5, RBPSUH, RHOH ...
View as HTML - Web Search
THE FUNCTION OF E- AND ID PROTEINS IN LYMPHOCYTE DEVELOPMENT - Full text - MIT Libraries
I Engel, C Murre - Nature Reviews Immunology, 2001 - nature.com
... Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. ... pathway
by TCR crosslinking leads to expression of the Egr1 transcription factor ...
Cited by 41 - Web Search - nature.com - ncbi.nlm.nih.gov
Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and … - Full text - MIT Libraries
H Suh, PJ Gage, J Drouin, SA Camper - Development, 2002 - dev.biologists.org
... we report the dependence of the gonadotrope transcription factors SF1 and EGR1 on
Pitx2 ... Independent regulation of the two Pax5 alleles during B-cell development ...
Cited by 26 - Web Search - ircm.qc.ca - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
Expression profiles frame the promoter specificity dilemma of the ETS family of transcription … - Full text - MIT Libraries
PC Hollenhorst, DA Jones, BJ Graves - Nucleic Acids Research, 2004 - nar.oupjournals.org
... ETS proteins (ELK1, SAP1, and NET) (1), and PAX5 with five ... albumin 5'
ggtatgcctggcccaagtactc; 3' gatccctgtcccacatgtacaaagc; 5' EGR1 cttatttgggcagcaccttatttgg; ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - hci.utah.edu - ingentaconnect.com - all 6 versions »
Thrombin Modulates the Expression of a Set of Genes Including Thrombospondin-1 in Human … - Full text - MIT Libraries
S Data - J. Biol. Chem, 2005 - jbc.org
... 3'; EGR1 sense, 5'-AGG ACA GGA GGA GGA GAT GG-3', and EGR1 antisense, 5 ... performed
for the genes of Cluster-3 identifying 11 models; EBOX, EGRF, PAX5, and AP2F ...
Web Search - jbc.org - ncbi.nlm.nih.gov
Phylogenetic analyses alone are insufficient to determine whether genome duplication (s) occurred … - Full text - MIT Libraries
AC Horton, NR Mahadevan, I Ruvinsky, JJ Gibson- … - Journal of Experimental Zoology (Molecular and Developmental …, 2003 - doi.wiley.com
... ISL2 NP___665804 Krox AAL83211 EGR1 NP___001955 3 EGR2 NP___000390 EGR3 NP___058782 ...
Pax2 AAC12734 PAX2 NP___003981 3 PAX5 NP___057953 PAX8 Q06710 ...
Cited by 7 - Web Search - zoo.ufl.edu - ncbi.nlm.nih.gov
The transcription factor early growth response 1 (Egr-1) advances differentiation of pre-B and … - Full text - MIT Libraries
A Dinkel, K Warnatz, B Ledermann, A Rolink, PF … - J Exp Med, 1998 - jem.org
... Essential functions of Pax5 (BSAP) in pro-B cell development: difference between ...
activation in mice lacking the zinc finger transcription factor NGFI-A (EGR1). ...
Cited by 19 - Web Search - dx.doi.org - jem.org - ncbi.nlm.nih.gov
Origins of anteroposterior patterning and Hox gene regulation during chordate evolution - Full text - MIT Libraries
TF Schilling, RD Knight - Philos Trans R Soc Lond B Biol Sci, 2001 - journals.royalsoc.ac.uk
... complicated by the presence of multiple family members expressed in the MHB, including
two di¡erent Fgf genes, Fgf8 and Fgf18, and two Pax genes, Pax2 and Pax5 ...
Cited by 18 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Chromatin Architecture near a Potential 3'End of the Igh Locus Involves Modular Regulation of … - Full text - MIT Libraries
FE Garrett, AV Emelyanov, MA Sepulveda, P Flanagan … - Mol. Cell. Biol, 2005 - mcb.asm.org
... and the 44-mer double-stranded FpV oligonucleotide containing overlapping
Sp1/Egr1-binding sites ... between Vh and 3' RR sequences (6). The finding that Pax5 ...
Cited by 1 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Comparative genomics provides evidence for an ancient genome duplication event in sh
JS Taylor, Y Van de Peer, I Braasch, A Meyer - Phil. Trans. R. Soc. Lond. B, 2001 - journals.royalsoc.ac.uk
... ERBB3 4503597 ö ö ö ö ERBB4 4885215 ö ö 4884676 ö EGR1 4503493 1352361
6681285 ö 7673684 EGR2 4557549 462005 2507546 ö 1169500 ...
Cited by 102 - Web Search - evolutionsbiologie.uni-konstanz.de - mit.edu - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Cloning and characterization of a promoter flanking the early B cell factor (EBF) gene indicates … - Full text - MIT Libraries
EM Smith, R Gisler, M Sigvardsson - J. Immunol, 2002 - jimmunol.org
... commercially available Abs against BSAP, ets1 and 2, Pu.1, Egr1, 2 and 3 ... Essential
functions of Pax5 (BSAP) in pro-B cell development: difference between fetal ...
Cited by 12 - Web Search - jimmunol.org - lu-research.lub.lu.se - ncbi.nlm.nih.gov - all 7 versions »
Progress in the molecular biology of Ewing tumors
H KOVAR - Sarcoma, 1998 - dx.doi.org
... family gene and a transcription factor gene . ETS1, GABP a , and FLI1 have recently
been demonstrated to bind to the transcription factor PAX5 in vitro. ...
Cited by 25 - Web Search - taylorandfrancis.metapress.com - ingentaconnect.com
Cytogenetic and FISH Studies in Myelodysplasia, Acute Myeloid Leukemia, Chronic Lymphocytic Leukemia …
II Supplement - Genetic Testing - ishapd.org
... AML, MDS del(5)(q13q33) CEN5, EGR1 >7% ND ... AF6, MLL IRF4, IgH HOXA9, NUP98 FGFR1,
ZNF198 c-MYC, IgH c-MYC, TCRad ETO, AML1 c-MYC, Ig1 AF9, MLL PAX5, IgH ABL ...
View as HTML - Web Search - haem.nus.edu.sg
MatInspector and beyond: promoter analysis based on transcription factor binding sites - Full text - MIT Libraries
K Cartharius, K Frech, K Grote, B Klocke, M … - Bioinformatics, 2005 - bioinformatics.oxfordjournals.org
... For example, the zinc finger proteins EGR1, EGR2, EGR3, EGR4 and WT1 are ... denote
different transcription factor families (turquoise, SRF; pink, PAX5; blue, TATA ...
Web Search - bioinformatics.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Concurrent opposite effects of an inhibitor of histone deacetylases, Trichostatin-A, on the …
FJ Davis, JB Pillai, M Gupta, MP Gupta - ajpheart.physiology.org
... DNA probe. The probe α-MHC gene EGR1 binding site sense-strand is, 5’GTG GGG
GTG 3’ (13). ... EGR1 binding sites, but not the mutant sites. ...
Web Search
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
Page 1. BioSystems xxx (2005) xxx–xxx A statistical analysis of the TRANSFAC database
Gary B. Fogel a , Dana G. Weekes a , Gabor Varga b , Ernst R. Dow b , ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The use of genetic microarray analysis to classify and predict prognosis in haematological … - Full text - MIT Libraries
AP Levene, GJ Morgan, FE Davies - Clinical and Laboratory Haematology, 2003 - blackwell-synergy.com
... was correlated with a decreased expression of IL-1 , IL-8 and EGR1, whereas no ... essential
B cell transcription factors including c-MYC, CIITA, Id3 PAX5 and Spi-B ...
Cited by 2 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Persistent Prop 1 expression delays gonadotrope differentiation and enhances pituitary tumor … - Full text - MIT Libraries
LJ Cushman, DE Watkins-Chow, ML Brinkmeier, LT … - Human Molecular Genetics, 2001 - hmg.oupjournals.org
... Sf1 and Egr1 are important for Lhb and Fshb expression, although these genes do
not appear to be required for the development of gonadotrope cell precursors. ...
Cited by 19 - Web Search - hmg.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
The Ewing family of tumors and the search for the Achilles’ heel
H Kovar, D Aryee, A Zoubek - Curr Opin Oncol, 1999 - co-oncology.com
... ERG interact with other specific transcription factors, such as PAX5, AP1, and ... function
as ternary and quaternary complex factors on the Egr1 promoter serum ...
Cited by 13 - Web Search - co-oncology.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
TranSignal TM Protein/DNA Arrays
PU Manual, MA MA1014 - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays Cat. # MA1010, MA1011, MA1012 Product User
Manual, MA1013 & MA1014, MA1015 Released 09/28/04 Panomics, Inc. ...
View as HTML - Web Search - biocat.de
TranSignal TM Protein/DNA Arrays
CS Version - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays (Column Separation Version) Cat. #
MA1210, MA1211, MA1212l, MA1213 & MA1214, MA1215 Product ...
View as HTML - Web Search
Transcription factors, normal myeloid development, and leukemia - Full text - MIT Libraries
DG Tenen, R Hromas, JD Licht, DE Zhang - Blood, 1997 - bloodjournal.org
PDF Version of this Article. Citation Map. Email this article to a friend. Similar
articles found in: Blood Online PubMed. PubMed Citation. ...
Cited by 353 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
|
©2005 Google