![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 63 for PAX5 and PAX4. (0.03 seconds) |
Ganglioside GD3 promotes cell growth and invasion through p130Cas and paxillin in malignant melanoma …
K Hamamura, K Furukawa, T Hayashi, T Hattori, J … - pnas.org
... Because the knock-down of paxillin was not enough, repeated treatments of cells
with Pax5 or combined use of Pax5 and Pax4 were examined, resulting in better ...
Web Search - pubmedcentral.nih.gov - pnas.org
Identification of a portable repression domain and an E1A-responsive activation domain in Pax4: a … - Full text - MIT Libraries
Y Fujitani, Y Kajimoto, T Yasuda, TA Matsuoka, H … - Mol Cell Biol, 1999 - mcb.asm.org
... The C-terminal region of Pax5 with which they evaluated the portability of the
transrepression activity corresponded to aa 314 to 349 in Pax4 and was shorter ...
Cited by 16 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Paired-homeodomain transcription factor PAX4 acts as a transcriptional repressor in early pancreatic … - Full text - MIT Libraries
SB Smith, HC Ee, JR Conners, MS German - Mol. Cell. Biol, 1999 - mcb.asm.org
... constructs mapped this repressor function predominantly to the region of PAX4 C
terminal ... is not unique within the PAX family, having been shown with PAX5 (5, 41 ...
Cited by 34 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Exclusion of a disease relevant role of PAX4 in the aetiology of Silver-Russell syndrome: screening …
JM Genet - dx.doi.org
... 8 9. PAX4 is a member of a highly conserved gene family, 10 and has been ... optic nerve
coloboma; PAX3, Waardenburg syndrome types I and III; PAX5, small lymphotic ...
Web Search - jmedgenet.com - jmg.bmjjournals.com
Expression of Alcaligenes eutrophus flavohemoprotein and engineered Vitreoscilla hemoglobin- … - Full text - MIT Libraries
AD Frey, JE Bailey, PT Kallio - Applied and Environmental Microbiology, 2000 - aem.asm.org
... Thus, E. coli MG1655 cells expressing VHb (pPPC1), FHPg (pAX1), or separate
globin-reductase fusions (pAX5, pAX6, pAX4, pAX9, pAX12, and pAX14) were cultivated ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - csa.com - all 5 versions »
Getting your Pax straight: Pax proteins in development and disease
N Chi, JA Epstein - Trends Genet, 2002 - instruct.uwo.ca
... activity. In addition, Pax2, Pax3, Pax4, Pax5 and Pax6 can repress transcription
of some reporter constructs. Transcriptional function ...
Cited by 54 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The diabetes-linked transcription factor PAX4 promotes ß-cell proliferation and survival in rat and … - Full text - MIT Libraries
T Brun, I Franklin, L St-Onge, A Biason-Lauber, EJ … - The Journal of Cell Biology - jcb.org
... Consistent with the putative proliferative role of Pax4, other members of the Pax ...
Interestingly, Pax5 was identified as a key factor for the maintenance of the ...
Cited by 1 - Web Search - jcb.org - jem.org - ncbi.nlm.nih.gov
Dissection of central carbon metabolism of hemoglobin-expressing Escherichia coli by 13 C nuclear … - Full text - MIT Libraries
AD Frey, J Fiaux, T Szyperski, K Wuthrich, JE … - Appl Environ Microbiol, 2001 - aem.asm.org
... The E. coli strains MG1655:pPPC1, MG1655:pAX1, MG1655:pAX4, and MG1655:pAX5 displayed
CO-binding activities that are indicative of the expression of ...
Cited by 14 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - csa.com - all 5 versions »
Deregulation of PAX-5 by translocation of the Eµ enhancer of the IgH locus adjacent to two … - Full text - MIT Libraries
M Busslinger, N Klix, P Pfeffer, PG Graninger, Z … - Cancer Res, 2003 - dx.doi.org
... M Busslinger Functional equivalence of the transcription factors Pax2 and Pax5 in
mouse ... and T. EGGERMANN Exclusion of a disease relevant role of PAX4 in the ...
Cited by 46 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
Les genes Pax et la specification cellulaire
M Bouchard - erudit.org
... directe que l’expression de ces protéines Pax4, 6, 7 soit suffisante pour la spécifi ...
action est similaire à celui de Pax2/8 dans le rein ou de Pax5 dans le ...
View as HTML - Web Search - ist.inserm.fr - erudit.org
Pax genes and eye organogenesis
F Pichaud, C Desplan - Curr. Opin. Genet. Dev, 2002 - wwworm.biology.uh.edu
... 8]. The nine human Pax genes can be placed into five phylogenetic groups [9]: (1)
Pax1 and Pax9; (2) Pax3 and Pax7; (3) Pax4 and Pax6; (4) Pax2, Pax5 and Pax8 ...
Cited by 20 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Ce sont la des questions cruciales qui vont necessiter un effort considerable. Heureusement, … - Full text - MIT Libraries
BM Functional, M Schebesta, M Busslinger, K … - Development, 1995 - ist.inserm.fr
... 9. Sosa-Pineda B, Chowdhury K, Torres M, Oliver G, Gruss P. The Pax4 gene is ... M.
Commitment to the B- lymphoid lineage depends on the transcription factor Pax5. ...
View as HTML - Web Search
Embryonic development of heads, skeletons and amphioxus: Edwin S. Goodrich revisited
PWH Holland - Int. J. Dev. Biol, 2000 - ijdb.ehu.es
... genes; the nine mouse Pax genes are divisible into four subfamilies each with two
or three genes (Pax1/Pax9; Pax3/Pax7; Pax2/Pax5/Pax8; possibly Pax4 with Pax6 ...
Cited by 18 - View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification of DNA recognition sequences for the Pax3 paired domain - Full text - MIT Libraries
G Chalepakis, P Gruss - Gene, 1995 - ncbi.nlm.nih.gov
... Pax1 and Pax9 constitute one subfamily, Pax2, Pax5 and Pax8 another, Pax3
and Pax7 another one and Pax4 and Pax6 the fourth subfamily. ...
Cited by 19 - Web Search
Crystal structure of the human Pax6 paired domain-DNA complex reveals specific roles for the linker … - Full text - MIT Libraries
HE Xu, MA Rould, W Xu, JA Epstein, RL Maas, CO … - Genes Dev, 1999 - genesdev.org
... The four groups include Pax1 and Pax9; Pax2, Pax5, and Pax8; Pax3 and Pax7;
and Pax4 and Pax6 (for review, see Stuart et al. 1994 ). ...
Cited by 61 - Web Search - uphs.upenn.edu - 128.95.44.130 - pubmedcentral.nih.gov - all 8 versions »
Pax2 mutant mice display increased number and size of islets of Langerhans but no change in insulin … - Full text - MIT Libraries
M Zaiko, A Estreicher, B Ritz-Laser, P Herrera, J … - European Journal of Endocrinology, 2004 - eje.org
... GCGGTCATAGGCAGC-3 0 (reverse, exon 11) and their specificity for Pax2 was tested
in control amplifications using cDNAs from Pax4, Pax5, Pax6 and Pax8 (data not ...
View as HTML - Web Search - eje-online.org - eje.org - ncbi.nlm.nih.gov - all 5 versions »
Genetic and biochemical diversity in the Pax gene family - Full text - MIT Libraries
DA Underhill - Biochem Cell Biol, 2000 - article.pubs.nrc-cnrc.gc.ca
... in primary structure have led to the classification of Pax genes into subgroups
that comprise Pax1/Pax9, Pax2/Pax5/Pax8, Pax3/Pax7, and Pax4/Pax6 (summarized ...
Cited by 11 - Web Search - dx.doi.org - pubs.nrc-cnrc.gc.ca - ncbi.nlm.nih.gov - all 6 versions »
Pax 6
B Complex - ai.mit.edu
... Homo, Mus Amphioxus Phallusia Paracentrotus Loligo Lineus Drosophila EY Drosophila
TOY Caenorhabditis Dugesia Hydra (B) Pax4 Pax2 Pax5 Pax8 ...
View as HTML - Web Search - chalk.salk.edu - mcb.uct.ac.za - med.nyu.edu - all 7 versions »
A More Complete TLA.
S Merz - World Congress on Formal Methods, 1999 - springerlink.com
... (ax4) 2 [P ⇒ Q] v ⇒ ( 2 [P] v ⇒ 2 [Q] v ) (pax4) |∼ 2 [P] v ≡ [P] v ∧
d 2 [P] v (ax5) 2 [v ≡ v] v (pax5) |∼ d 2 F ⇒ 2 [ d F] v ...
Cited by 5 - Web Search - webloria.loria.fr - dc.exa.unrc.edu.ar - pst.informatik.uni-muenchen.de - all 8 versions »
The role of PAX 2 in normal and abnormal development of the urinary tract - Full text - MIT Libraries
MR Eccles - Pediatric Nephrology, 1998 - springerlink.com
... Group I consists of PAX1 and PAX9, whereas group II consists of PAX2, PAX5, and
PAX8. PAX3 and PAX7 are in group III, with PAX4 and PAX6 in group IV [8]. All ...
Cited by 13 - Web Search - ncbi.nlm.nih.gov
Transcriptional regulation of the human PAX 6 gene promoter. - Full text - MIT Libraries
ZP Xu, GF Saunders - J Biol Chem, 1997 - jbc.org
... paired box that can be present alone (as in Pax1 and Pax9) or with a full-length
(as in Pax3, Pax4, Pax6, and Pax7) or truncated (as in Pax2, Pax5, and Pax8 ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov
Neurogenin3 activates the islet differentiation program while repressing its own expression - Full text - MIT Libraries
SB Smith, H Watada, MS German - Mol Endocrinol, 2004 - mend.endojournals.org
... using isolated E boxes from the NEUROG3, nkx2.2, PAX5 and rat insulin I gene ... element,
the rat Insulin I E2 element, and the PAX4 E box (strongest). ...
Cited by 7 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Progressive loss of PAX 9 expression correlates with increasing malignancy of dysplastic and … - Full text - MIT Libraries
JK Gerber, T Richter, E Kremmer, J Adamski, H … - The Journal of Pathology, 2002 - doi.wiley.com
... that the oncogenic potential of PAX9 is less strong than that of PAX genes that
contain a full (PAX3, PAX4, PAX6, PAX7) or a partial (PAX2, PAX5, PAX8) homeo ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
[PS] Logic-based analysis of reactive systems: hiding, composition and abstraction
S Merz - loria.fr
Page 1. Logic-Based Analysis of Reactive Systems: Hiding, Composition, and
Abstraction Stephan Merz Institut fur Informatik, Ludwig ...
Cited by 2 - View as HTML - Web Search
The Trichoplax PaxB Gene: a Putative Proto-PaxA/B/C Gene Predating the Origin of Nerve and Sensory … - Full text - MIT Libraries
T Hadrys, R DeSalle, S Sagasser, N Fischer, B … - Molecular Biology and Evolution, 2005 - mbe.oupjournals.org
... are related to triploblast Pax2/5/8 genes, PaxC genes to Pax4-6, and ... In higher
vertebrates Pax2, Pax5, and Pax8 genes are present in multiple paralogs (likely ...
Web Search - mbe.oxfordjournals.org - mbe.oxfordjournals.org - ncbi.nlm.nih.gov
Noriko Osumi Department of Developmental Neurobiology, Tohoku University Graduate School of Medicine …
TM Lectureat73 … - journal.med.tohoku.ac.jp
... Pax2 19 10q25 Pax2 1Neu Yes Renalcoloboma Pax5 2 2q12-q14 Pax8 4 9p13 Yes Pax3 1
2q35 Splotch Waadenburg syndromeI,III Pax7 4 1p36.2 Yes Pax4 6 7q32 Yes ...
Web Search
259. Panstrosid (Substanz Nr. 762)')
V Diss, JP Rosselet - doi.wiley.com
... 0,05 %) gewonnen. Besonders reich an diesem Stoff (ca. O,9Y0) waren die Samen von
8. intermedius Pax5) und S. amboensis (Schinx) Engl. et Pax4). ...
Web Search
A genomewide survey of developmentally relevant genes in Ciona intestinalis - Full text - MIT Libraries
S Wada, M Tokuoka, E Shoguchi, K Kobayashi, A Di … - Dev Genes Evol, 2003 - springerlink.com
... 93% $ Pax3/7 Pax3/7 genewise.209.17.1 36362 Q96H85 Pax-3 99% $ Pax4/6 Pax6
genewise.337.13.1 32251 P26367 Pax-6 98% $ orphan Pax3 ...
Cited by 22 - Web Search - ncbi.nlm.nih.gov
Isolation and expression analysis of a Pax group III gene from the crustacean Cherax destructor - Full text - MIT Libraries
RBWTM Lamey, M Ziman, A Koenders - Dev Genes Evol, 2005 - springerlink.com
... accession numbers) used for phylogenetic analysis include: Mus musculus Pax1 (M69222),
Pax2 (NM011037), Pax3 (X59358), Pax4 (P321 15), Pax5 (Q02650), Pax6 ...
Web Search - ncbi.nlm.nih.gov
Pax3 and the splotch mutations: structure, function, and relationship to teratogenesis, including …
AF Machado, LJ Martin, MD Collins - Curr. Pharm. Design, 2001 - ingentaconnect.com
... Pax2 1Nen[78] , Krd [145] Pax2 knockout [244] Pax5 knockout [253] ... Aniridia [243] ,
Peter's anomaly [111] , Isolated foveal hypoplasia [7] Pax4 knockout [225] ...
Cited by 7 - Web Search - bentham.org - bentham.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Testing for genetic associations with the PAX gene family in a spina bifida population - Full text - MIT Libraries
KA Volcik, SH Blanton, MC Kruzel, IT Townsend, GH … - Am J Med Genet, 2002 - doi.wiley.com
... PAX4 and PAX9 were not analyzed due to their lack of expression during the formation
of the ... CATCCAGGTTGCTGTGAAT PAX5 D9S265 TGGTGAAGCCTATTCTTGGT 84–94 52 ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Nephric lineage specification by Pax 2 and Pax 8 - Full text - MIT Libraries
M Bouchard, A Souabni, M Mandler, A Neubuser, M … - Genes & Development, 2002 - genesdev.org
... For instance, Pax5 is essential for the formation of B-lymphocytes within ... 1998 ),
Pax4 for insulin-producing -cells, and somatostatin-expressing -cells in the ...
Cited by 32 - Web Search - 136.165.37.172 - dx.doi.org - ncbi.nlm.nih.gov - all 9 versions »
PAX genes in development and disease: The role of PAX2 in urogenital tract development
MR Eccles, S He, M Legge, R Kumar, J Fox, C Zhou, … - Int J Dev Biol, 2002 - ijdb.ehu.es
... hypopigmentation PAX4 - - Pax4 knockout (+/-) No abnormalities Pax4 knockout (-/-)
Absence of alpha cells of the pancreas PAX5 - - Pax5 knockout (+/-) No ...
Cited by 5 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - ijdb.ehu.es - Get it from MIT Libraries
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... 01 N-Myc OCT1 02 Octamer factor 1 OCT1 03 Octamer factor 1 OCT1 04 Octamer factor
1 OCT1 Q6 Octamer factor 1 P300 01 p300 PAX3 B Pax3 binding sites PAX4 01 Pax ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Eyg and Ey Pax proteins act by distinct transcriptional mechanisms in Drosophila development - Full text - MIT Libraries
JG Yao, YH Sun - The EMBO Journal, 2005 - embojournal.npgjournals.com
... Pax2, Pax3, Pax4, Pax5, and Pax8 can also function as repressors, in addition
to being activators (reviewed in Underhill, 2000). ...
Web Search - pubmedcentral.nih.gov - embojournal.npgjournals.com - ncbi.nlm.nih.gov
Zebrafish Pax 9 encodes two proteins with distinct C-terminal transactivating domains of different … - Full text - MIT Libraries
S Nornes, I Mikkola, S Krauss, M Delghandi, M … - J Biol Chem, 1996 - jbc.org
... Except for Pax4, which may be a pseudogene, all of the murine Pax genes have ... Pax2,
Pax5, and Pax8 encode an amino acid stretch related to the first predicted ...
Cited by 27 - Web Search - cmbn.no - jbc.org - ncbi.nlm.nih.gov - all 5 versions »
Developmental expression of Pax1/9 genes in urochordate and hemichordate gills: insight into … - Full text - MIT Libraries
M Ogasawara, H Wada, H Peters, N Satoh - Development, 1999 - dev.biologists.org
... However, Group II (Pax2, Pax5 and Pax8), Group III (Pax3 and Pax7) and Group
IV (Pax4 and Pax6) encode the paired domain and homeodomain. ...
Cited by 29 - Web Search - staff.washington.edu - dev.biologists.org - ncbi.nlm.nih.gov
pax2. 1 is required for the development of thyroid follicles in zebrafish - Full text - MIT Libraries
T Wendl, K Lun, M Mione, J Favor, M Brand, SW … - Development, 2002 - dev.biologists.org
... development. Pax2, Pax5 and Pax8 form a paralogue group of genes, like
Pax1/9, Pax4/6 and Pax3/7 (reviewed by Dahl et al., 1997 ). ...
Cited by 7 - Web Search - ucl.ac.uk - dev.biologists.org - ncbi.nlm.nih.gov
Institut fuer Experimentelle Genetik GSF-Forschungszentrum fuer Umwelt und Gesundheit, Neuherberg
DBR Breitling - tumb1.biblio.tu-muenchen.de
Page 1. Institut für Experimentelle Genetik GSF-Forschungszentrum für Umwelt und
Gesundheit, Neuherberg Phylogenetische und bioinformatische Untersuchung der ...
View as HTML - Web Search - deposit.ddb.de
Genetic analysis of genes found on the 4th chromosome of Drosophila-emphasizing the developmental …
J Kronhamn - publications.uu.se
... Miller also place the nine human Pax genes in four phylogenetic groups: (1) Pax1
and Pax9; (2) Pax3 and Pax7; (3) Pax4 and Pax6; (4) Pax2, Pax5 and Pax8. ...
Web Search
Genetic engineering, DNA analytic
N Tautz, G Kaluza, F Laue, B Frey, G Schmitz, M … - Fresenius Journal of Analytical Chemistry, 1990 - springerlink.com
Page 1. 110 Genetic engineering, DNA analytic Fresenius J Anal Chem (1990)
337:110 - © Springer-Verlag 1990 50 SgrAI, a unique restriction ...
Web Search - Get it from MIT Libraries
Pax-2 activates the proglucagon gene promoter but is not essential for proglucagon gene expression … - Full text - MIT Libraries
G Flock, DJ Drucker - Mol Endocrinol, 2002 - mend.endojournals.org
... B, Chowdhury K, Torres M, Oliver G, Gruss P 1997 The Pax4 gene is ... Busslinger M 2000
Functional equivalence of the transcription factors Pax2 and Pax5 in mouse ...
Cited by 8 - Web Search - mend.endojournals.org - glucagon.com - ncbi.nlm.nih.gov - all 5 versions »
ON THE EVOLUTION OF CNIDARIAN EYES
M Stierwald - unibas.ch
Page 1. ON THE EVOLUTION OF CNIDARIAN EYES Inauguraldissertation zur Erlangung
der Würde eines Doktors der Philosophie vorgelegt der ...
View as HTML - Web Search - pages.unibas.ch
Highly conserved amino acids in Pax and Ets proteins are required for DNA binding and ternary … - Full text - MIT Libraries
D Fitzsimmons, R Lutz, W Wheat, HM Chamberlin, J … - Nucleic Acids Research, 2001 - nar.oupjournals.org
... Chowdury,K., Torres,M., Oliver,G. and Gruss,P. (1997) The Pax4 gene is ... M. (1999)
Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. ...
Cited by 12 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
[PS] Specifying Communication Protocols with Temporal Logic
M Jmaiel, U und Programmiersprachen - uebb.cs.tu-berlin.de
Page 1. Specifying Communication Protocols with Temporal Logic Mohamed Jmaiel
Technische Universitat Berlin, Fachbereich Informatik ...
Cited by 1 - View as HTML - Web Search - cs.tu-berlin.de - uebb.cs.tu-berlin.de - cs.tu-berlin.de
Identification and expression of the lamprey Pax6 gene: evolutionary origin of the segmented brain … - Full text - MIT Libraries
Y Murakami, M Ogasawara, F Sugahara, S Hirano, N … - Development, 2001 - dev.biologists.org
... Of those, duplication of Pax4 and Pax6 appears to date back to the origin of ... Pax5
is expressed at the midbrain-hindbrain boundary during mouse development. ...
Cited by 21 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Mutational analysis of PAX 6: 16 novel mutations including 5 missense mutations with a mild aniridia …
K Groenskov, T Rosenberg, A Sand, K Broendum- … - European Journal of Human Genetics, 1999 - nature.com
... However, in a comparison of the paired domains from 14 representative Pax genes
(PAX1, PAX2, PAX3, Pax-4, PAX5, PAX6, PAX7, PAX8, PAX9, prd, Gsbn, Gsb, Poxmeso ...
Cited by 18 - Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Dissection of the Transactivation Function of the Transcription Factor Encoded by the Eye … - Full text - MIT Libraries
HK Tang, S Singh, GF Saunders - J Biol Chem, 1998 - jbc.org
... produced by other Pax genes with dual DNA-binding domains (Pax3, Pax4, and Pax7). ...
in contrast to those found in the C-terminal region of PAX2, PAX5, and PAX8 ...
Cited by 24 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Direct autoregulation and gene dosage compensation by POU-domain transcription factor Brn 3 a - Full text - MIT Libraries
M Trieu, A Ma, SR Eng, N Fedtsova, EE Turner - Development, 2003 - dev.biologists.org
... Pax4 regulatory elements mediate beta cell specific expression in the pancreas.
Mech. ... Independent regulation of the two Pax5 alleles during B-cell development. ...
Cited by 8 - Web Search - ericonic.tripod.com - dev.biologists.org - ncbi.nlm.nih.gov - all 5 versions »
TranSignal TM Protein/DNA Arrays
CS Version - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays (Column Separation Version) Cat. #
MA1210, MA1211, MA1212l, MA1213 & MA1214, MA1215 Product ...
View as HTML - Web Search
| |
©2005 Google