![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 77 for PAX5 and STAT3. (0.03 seconds) |
Oligo GEArray® Human Hematopoietic Stem Cells and Hematopoiesis Microarray
S Conditions - search.cosmobio.co.jp
... HOXB4, IFI16, IL31RA, IRF4, IRF8, KLF6, LEF1, MAFB, MYC, NCOA6, NFYA, NOTCH1, NOTCH2,
NOTCH4, PAX5, RBPSUH, RHOH, RUNX1, SCAND1, STAT1, STAT3, STAT4, TAL1, VAV1 ...
View as HTML - Web Search
Transcriptional regulatory cascades controlling plasma cell differentiation - Full text - MIT Libraries
KI Lin, C Tunyaplin, K Calame - Immunological Reviews, 2003 - blackwell-synergy.com
... At present, two transcription factors, BCL-6 and Pax5, have been shown to play a
role in ... (21) also presented data suggesting that STAT3 could overcome BCL-6 ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
REGULATORY MECHANISMS THAT DETERMINE THE DEVELOPMENT AND FUNCTION OF PLASMA CELLS - Full text - MIT Libraries
KL Calame, KI Lin, C Tunyaplin - Annual Review of Immunology, 2003 - immunol.annualreviews.org
... Indeed, enforced expression of Bcl-6 inhibits plasma cell differentiation,
possibly by inhibiting the activity of STAT3 (109). Pax5. ...
Cited by 38 - Web Search - phyto.annualreviews.org - nutr.annualreviews.org - ncbi.nlm.nih.gov - all 6 versions »
Kuo-I Lin Chainarong Tunyaplin Kathryn Calame - Full text - MIT Libraries
KI Lin - Immunological Reviews, 2003 - ingentaconnect.com
... At present, two transcription factors, BCL-6 and Pax5, have been shown to play a
role in ... (21) also presented data suggesting that STAT3 could overcome BCL-6 ...
Web Search
Role of Id proteins in B lymphocyte activation: new insights from knockout mouse studies - Full text - MIT Libraries
M Sugai, H Gonda, Y Nambu, Y Yokota, A Shimizu - Journal of Molecular Medicine, 2004 - springerlink.com
... tered patterning of the posterior midbrain in mice lacking Pax5/ BSAP ... differentiation
and sustains embryonic stem cell self-renewal in collaboration with STAT3. ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
MOUSE EMBRYONIC STEM CELLS
S CELLS - stemcells.nih.gov
... Gab ERK 1/2 Blocks Self-Renewal Self-Renewal STAT3 STAT3 STAT3 gp130 © 2001 T e
rese Winslow , L ydia Kibiuk Page 4. ... For example, the genes Pax2, Pax5, Wnt1, ...
View as HTML - Web Search - stemcells.nih.gov
Signal Transducer and Activator of Transcription-3 Activation Contributes to High Tissue Inhibitor … - Full text - MIT Libraries
R Lai, GZ Rassidakis, LJ Medeiros, L Ramdas, AH … - American Journal of Pathology, 2004 - ajp.amjpathol.org
... and demonstrate that TIMP1 expression correlates with high level of STAT3 activation
in ... uni- formly positive for CD30, negative for CD20 and PAX5, and were of ...
Cited by 3 - Web Search - ajp.amjpathol.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Identification of novel proteins associated with hepatocellular carcinomas using protein microarrays - Full text - MIT Libraries
A Tannapfel, K Anhalt, P Haeusermann, F Sommerer, … - The Journal of Pathology, 2003 - doi.wiley.com
... pan-ras Boehringer Mouse PAX5 Acris Mouse PDGF DAKO Mouse ... SOCS4 Acris
Mouse β-Catenin Transduktion Laboratorien Mouse STAT3 Acris Mouse ...
Cited by 14 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Abnormal PcG protein expression in Hodgkin's lymphoma. Relation with E 2 F 6 and NFκB transcription … - Full text - MIT Libraries
M Sanchez-Beato, E Sanchez, JF Garcia, A Perez- … - The Journal of Pathology, 2004 - doi.wiley.com
... 534 M Sanchez-Beato et al OCT1, MUM1, PAX5, BOB1, STAT1, STAT3, LMP, and EBER. Due
to its putative relation with PcG proteins, E2F6 was included in this study. ...
Cited by 5 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Regulation of B Cell Differentiation and Plasma Cell Generation by IL-21, a Novel Inducer of Blimp-1 … - Full text - MIT Libraries
K Ozaki, R Spolski, R Ettinger, HP Kim, G Wang, CF … - The Journal of Immunology, 2004 - jimmunol.org
... induces Blimp-1 (i) and Bcl-6 (ii), but decreases expression of Pax5 (iii) mRNA ... complex
formed with the Bcl-6-binding probe, whereas an Ab to Stat3, which can ...
Cited by 3 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Building an Outcome Predictor Model for Diffuse Large B-Cell Lymphoma
AI Saez, AJ Saez, M Artiga, A Perez-Rosado, FI … - J Pathol, 2004 - ajp.amjpathol.org
... PU1 11/194 5.67 Pax-5 209/215 97.21 MUM-1 113/206 54.85 STAT3 23/224 ... increase in
bcl-x L and NF-kB), and B-cell differentiation (increase in Pax5, CD10, and ...
Cited by 10 - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
STAT5 activation underlies IL7 receptor-dependent B cell development - Full text - MIT Libraries
CA Goetz, IR Harmon, JJ O’Neil, MA Burchill, MA … - J. Immunol, 2004 - jimmunol.org
... involving 1) PI3K/Akt, 2) Ras/Raf, and 3) Jak/STAT (STAT5, STAT3). ... One particularly
attractive candidate is pax5, a transcription factor that is also required ...
Cited by 4 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular biology
N User - Neuron, 1995 - nature.com
... 3 . Here we report that an aberrant hypermutation activity targets multiple loci,
including the proto-oncogenes PIM1, MYC, RhoH/TTF (ARHH) and PAX5, in more ...
Web Search - nature.com - Get it from MIT Libraries
BMP-6 inhibits growth of mature human B cells; induction of Smad phosphorylation and upregulation of … - Full text - MIT Libraries
C Kersten, EA Sivertsen, ME Hystad, L Forfang, EB … - BMC Immunology, 2005 - biomedcentral.com
... to detect BMP-6-induced changes in the phosphorylation status of STAT3 or p38 ... proteins
act as dominant-negative inhibitors of E-proteins and Pax5 function by ...
Cached - Web Search - dx.doi.org - pubmedcentral.nih.gov - citebase.eprints.org - all 6 versions »
EGL-38 Pax regulates the ovo-related gene lin-48 during Caenorhabditis elegans organ development - Full text - MIT Libraries
AD Johnson, D Fitzsimmons, J Hagman, HM Chamberlin - Development, 2001 - dev.biologists.org
... lysate proteins were prepared as described previously for Pax5 (Wheat et ... lre2), and
5'TCGAGATCCTTCTGGGAATTCCTAGATC and 5'TCGA-GATCTAGGAATTCCCAGAAGGATC (STAT3). ...
Cited by 12 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
WORKSHOP ABSTRACTS
G Enblad, K Jchrens, I Anagnostopoulos, H Stein, K … - blackwell-synergy.com
... Conclusion: Our study demonstrates that CD43 and PAX5 are able to distinguish between ...
data) were subsequently subjected to FICTION using the REL, STAT3/5a and ...
Web Search - ingentaconnect.com
Regulation of plasma-cell development - Full text - MIT Libraries
M Shapiro-Shelef, K Calame - Nature Reviews Immunology, 2005 - nature.com
... B-cell factor,PU.1,E2A and paired box protein 5 (PAX5) 1 . Successful ... haveconstitutively
activated STAT3 (signal transducer and activator of transcription 3) ...
Cited by 1 - Web Search - immuneweb.xxmc.edu.cn - ncbi.nlm.nih.gov
Derivation of 2 categories of plasmacytoid dendritic cells in murine bone marrow - Full text - MIT Libraries
R Pelayo, J Hirose, J Huang, KP Garrett, A Delogu, … - Blood, 2005 - bloodjournal.org
... Transcripts for Pax5, Bcl11a, EBF, and mb1/Ig were exclusively present in pDC1s. ...
22,56,57 and signal transducer and activator of transcription 3 (STAT3) is the ...
Cited by 1 - Web Search - bloodjournal.org
p 38 Mitogen-activated Protein Kinase Regulates Interleukin-4-induced Gene Expression by Stimulating … - Full text - MIT Libraries
M Pesu, S Aittomaeki, K Takaluoma, A Lagerstedt, O … - Journal of Biological Chemistry - jbc.org
... interferon regulatory factor-4, and B cell-specific activator protein (Pax5) (6,
7 ... STAT1, STAT3, STAT4, STAT5, and STAT6 have been shown to be phosphorylated on ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cloning and Characterization of the Novel Chimeric Gene TEL/PTPRR in Acute Myelogenous Leukemia with … - Full text - MIT Libraries
F Nakamura, Y Nakamura, K Maki, Y Sato, K Mitani - Cancer Research, 2005 - cancerres.aacrjournals.org
... Loss of tumor suppressive function of wild-type TEL and maintenance of STAT3-mediated
signal could at least partly contribute ... 32), PAX5 in t(9;12)(q11;p13) (ref ...
Web Search - cancerres.aacrjournals.org
Stat5a/b contribute to interleukin 7-induced B-cell precursor expansion, but abl-and bcr/abl-induced … - Full text - MIT Libraries
V Sexl, R Piekorz, R Moriggl, J Rohrer, MP Brown, … - Blood, 2000 - bloodjournal.org
... the absence of Stat5a/b. However, activation of Stat1 or Stat3 was not ... An
interleukin-2 signal relieves BSAP (Pax5)-mediated repression of the immunoglobulin ...
Cited by 81 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
Restricted STAT5 Activation Dictates Appropriate Thymic B versus T Cell Lineage Commitment - Full text - MIT Libraries
CA Goetz, IR Harmon, JJ O’Neil, MA Burchill, TM … - The Journal of Immunology, 2005 - jimmunol.org
... number of downstream signaling pathways, including those for PI3K, STAT3, STAT5,
and ... Specifically, STAT5 activation results in the induction of pax5 and bcl-x ...
Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Cutting Edge: IL-12 and IL-18 Differentially Regulate the Transcriptional Activity of the Human IFN- … - Full text - MIT Libraries
K Barbulescu, C Becker, JF Schlaak, E Schmitt, KHM … - The Journal of Immunology, 1998 - jimmunol.org
... Previous studies have shown that IL-12 induces STAT3/4 tyrosine ... Pax5 (BSAP) regulates
the murine immunoglobulin 3' enhancer by affecting binding of NF- P, a ...
Cited by 141 - Web Search - jimmunol.org - jimmunol.org - jimmunol.org
BMC Immunology - Full text - MIT Libraries
C Kersten, EA Sivertsen, ME Hystad, L Forfang, EB … - BMC Immunology, 2005 - biomedcentral.com
... to detect BMP-6-induced changes in the phosphorylation status of STAT3 or p38 ... proteins
act as dominant-negative inhibitors of E-proteins and Pax5 function by ...
View as HTML - Web Search - bmc.ub.uni-potsdam.de
The origin of hematopoietic cell type diversity - Full text - MIT Libraries
T Hoang - Oncogene, 2004 - nature.com
... E2A E2A, Pax5 ... self-renewal and differentiation in ES cells appears to depend on the
balance between the BMP-Smad (acting via Id) and the LIF-STAT3 path- ways ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
The growth-regulatory role of B-cell-specific activator protein in NZB malignant B-1 cells - Full text - MIT Libraries
SY Chong, M Zhang, YC Lin, F Coffman, Z Garcia, N … - Cancer Immunology Immunotherapy, 2001 - springerlink.com
... R, Dalla-Favera R (1999) Chromosomal rearrangement of the PAX5 locus in ... TL (1997)
Signal transducer and activator of transcription-3 (STAT3) is constitutively ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
Conditional alleles in mice: Practical considerations for tissue-specific knockouts - Full text - MIT Libraries
KM Kwan - genesis, 2002 - doi.wiley.com
... Pax5 4 (20.7) F Horcher et al., 2001 Pax6 ... Stat3 11 (60.5) F Takeda et al., 1998;
Chapman et al., 1999; Sano et al., 1999; Takeda et al., 1999 ...
Cited by 27 - Web Search - tagc.univ-mrs.fr - biochem.wisc.edu - ncbi.nlm.nih.gov - all 6 versions »
Analysis of the interaction of TIP60β and PIN1 with the ets family transcription factor ETV6
CD Zhang - edoc.ub.uni-muenchen.de
... HLXB9, MN1 or PAX5, to genes of various or unknown functions, such as STL, BTL,
ARNT, MDS2, TTL, ACS2. ... TIP60 interacts with STAT3 and represses STAT3-mediated ...
View as HTML - Web Search
TRANSCRIPTION FACTORS
OFB CELLS - doi.wiley.com
... 201 Sridhar Rao and M. Celeste Simon 14 The Role of Pax5 (BSAP) in Early and Late
B-Cell Development 217 Markus Horcher, Dirk Eberhard, and Meinrad Busslinger ...
Web Search
Pluripotent cells (stem cells) and their determination and differentiation in early vertebrate … - Full text - MIT Libraries
H Tiedemann, M Asashima, H Grunz, W Knochel - Dev. Growth Differ, 2001 - blackwell-synergy.com
... Cell type-specific interpretation of STAT3 activation may explain its diverse
developmental ... En genes show overlapping expression with the Pax2, Pax5 and Pax9 ...
Cited by 13 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Inactivation of Myc in Murine Two-Hit B lymphomas Causes Dormancy with Elevated Levels of … - Full text - MIT Libraries
D Yu, M Dews, A Park, JW Tobias, A Thomas- … - Cancer Research, 2005 - cancerres.aacrjournals.org
... hematopoietic tumors following spontaneous silencing/reactivation of the EBF/Pax5
pathway. ... Inactivation of Stat3 in tumor cells: Releasing a brake on immune ...
Web Search - mail.vet.upenn.edu - cancerres.aacrjournals.org - ncbi.nlm.nih.gov
BMC Genomics - Full text - MIT Libraries
JJ Hutton, AG Jegga, S Kong, A Gupta, C Ebert, S … - BMC Genomics, 2004 - biomedcentral.com
... Examples include PU.1/Ets, Ikaros, E2A, EBF, PAX5, GATA3, NFAT, cMYB, and OCT-2 ... both
signal transducers and activators of transcription (Stat1, Stat3, and Stat4 ...
Cited by 1 - View as HTML - Web Search - dx.doi.org - pubmedcentral.nih.gov - bmc.ub.uni-potsdam.de - all 8 versions »
TRANSCRIPTIONAL REGULATION DURING B CELL DEVELOPMENT - Full text - MIT Libraries
A Henderson, K Calame - Annual Review of Immunology, 1998 - dx.doi.org
... Therefore, it appears that EBF is a critical factor for the progression
of pro-B cells to the pre-B cell stage. BSAP (PAX5). BSAP ...
Cited by 65 - Web Search - immunol.annualreviews.org - immunol.annualreviews.org - ncbi.nlm.nih.gov
Constitutive activation of STAT5A promotes human hematopoietic stem cell self-renewal and erythroid … - Full text - MIT Libraries
JJ Schuringa, KY Chung, G Morrone, MAS Moore - J Exp Med, 2004 - jem.org
... EBF-regulating Pax5 transcription is enhanced by STAT5 in the early stage of ...
Constitutive activation of STAT3 and STAT5 is induced by leukemic fusion proteins ...
Cited by 4 - Web Search - jem.org - jcb.org - ncbi.nlm.nih.gov
HLXB9 activates IL6 in Hodgkin lymphoma cell lines and is regulated by PI3K signalling involving E2F …
S Nagel, M Scherr, H Quentmeier, M Kaufmann, M … - Leukemia, 2005 - nature.com
... to the attenuation therein of the B-cell commitment program orchestrated by PAX5. ...
Table 2). However, L-540 exhibits very strong constitutive STAT3 activity, 12 ...
Web Search - nature.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification of Neuronal Enhancers of the Proopiomelanocortin Gene by Transgenic Mouse Analysis … - Full text - MIT Libraries
FSJ de Souza, AM Santangelo, V Bumaschny, ME Avale … - Mol Cell Biol, 2005 - mcb.asm.org
... a sequence present at the 3' end of nPE1 highly matched a consensus binding site
for signal transducer and activator of transcription 3 (STAT3), a downstream ...
Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Highly conserved amino acids in Pax and Ets proteins are required for DNA binding and ternary … - Full text - MIT Libraries
D Fitzsimmons, R Lutz, W Wheat, HM Chamberlin, J … - Nucleic Acids Research, 2001 - nar.oupjournals.org
... Competition was not observed when STAT3 binding sites were added at 3000 ... Heavey,B.
and Busslinger,M. (2000) Transcriptional repression by Pax5 (BSAP) through ...
Cited by 12 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Analyse moleculaire du myelome: vers de nouvelles perspectives therapeutiques
UDEFET DE RECHERCHE, DE MEDECINE - tel.ccsd.cnrs.fr
... Ag antigène BSAP B-cell-specific activator protein (Pax5) ... lymphopoïèse B : EBF (early
B-cell factor), E2A et Pax5/BSAP (B-cell-specific activator protein). ...
View as HTML - Web Search - telint.ccsd.cnrs.fr
The Androgen Receptor Gene is Preferentially Hypermethylated in Follicular Non-Hodgkin’s Lymphomas - Full text - MIT Libraries
H Yang, CM Chen, P Yan, TH Huang, H Shi, M Burger, … - Clin Cancer Res, 2003 - 140.120.130.112
... Furthermore, it has been shown that Pax5, a gene expressed in normal B cells until
plasmacytic differentiation, is under control of DNA methylation (32). ...
Cited by 3 - View as HTML - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The‘definitive’(and‘primitive’) guide to zebrafish hematopoiesis - Full text - MIT Libraries
AJ Davidson, LI Zon - Oncogene, 2004 - nature.com
... (1998) lmo2 LIM domain — Thompson et al. (1998) pax5 Paired domain, homeobox —
Pfeffer et al. (1998) ... (1998) stat3 STAT — Oates et al. (1999) ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
STAT 5 regulates the self-renewal capacity and differentiation of human memory B cells and controls … - Full text - MIT Libraries
FA Scheeren, M Naspetti, S Diehl, R Schotte, M … - Nature Immunology, 2005 - nature.com
... IL-4 activates STAT6 and STAT5 (refs. 14,15), whereas IL-2 and IL-10 activate
STAT3 and STAT5 (ref. 16). STAT6 promotes the choice ...
Web Search - nature.com - hawaii.edu - ncbi.nlm.nih.gov
AML1 interconnected pathways of leukemogenesis
J Michaud, HS Scott, R Escher - Cancer Invest, 2003 - taylorandfrancis.metapress.com
... B-lymphocyte specific tyro- sine kinase B cells Experimental [44] Pax5 [44 ... Transcription
activators STAT3 d Signal transducer and acti- vator of transcription 3 ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Comparative genomics provides evidence for an ancient genome duplication event in sh
JS Taylor, Y Van de Peer, I Braasch, A Meyer - Phil. Trans. R. Soc. Lond. B, 2001 - journals.royalsoc.ac.uk
Page 1. Comparative genomics provides evidence for an ancient genome duplication
event in sh John S. Taylor, Yves Van de Peer, Ingo Braasch and Axel Meyer * ...
Cited by 102 - Web Search - evolutionsbiologie.uni-konstanz.de - mit.edu - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Hyper immunoglobulin M syndrome due to CD 40 deficiency: clinical, molecular, and immunological … - Full text - MIT Libraries
V Lougaris, R Badolato, S Ferrari, A Plebani - Immunological Reviews, 2005 - blackwell-synergy.com
... activator of transcription 6 (STAT6) (87) and the Janus kinase 3/STAT3 pathway in ...
to the nucleus, where it modulates the DNA-binding activity of Pax5 and early ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Mitchell S. Cairo, MD,* Elizabeth Raetz, MD, 2 Megan S. Lim, MD, PhD, 3 Virginia Davenport, RN, and …
PB Cancer - doi.wiley.com
... of several proto-oncogenes, including PIM1, MYC, RhoH/TTF, and PAX5, occurs in more ...
3 and signal transducer, and activator of transcription 3 (Stat3), as well ...
Web Search
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
Page 1. BioSystems xxx (2005) xxx–xxx A statistical analysis of the TRANSFAC database
Gary B. Fogel a , Dana G. Weekes a , Gabor Varga b , Ernst R. Dow b , ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Production of high-titer helper-free retroviruses by transient transfection - Full text - MIT Libraries
WS PEAR, GP NOLAN, ML SCOTT, D BALTIMORE - Proc. Nat. Acad. Sci, 1993 - pnas.org
PDF Version of this Article. Similar articles found in: PNAS Online PubMed. PubMed
Citation. This Article has been cited by: other online articles. ...
Cited by 1223 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - adsabs.harvard.edu - all 5 versions »
The link between chromatin structure, protein acetylation and cellular differentiation
V Sartorelli, PL Puri - Front. Biosci, 2001 - xylian.igh.cnrs.fr
... to sequester the CBP-Smad1 complex away from STAT1 and STAT3, two critical ... and EBF
gene products activate expression of the downstream target Pax5 (195), which ...
Cited by 8 - Cached - Web Search - bioscience.org - bioscience.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
PU. 1 is required for transcriptional activation of the Stat6 response element in the Ig 6 promoter
M Pesu, S Aittomaeki, T Vaelineva, O Silvennoinen - doi.wiley.com
... factors such as CCAAT/ enhancer binding protein g (C/EBP g ), NF- ‹ B, PU.1 (Spi-
1), B cell specific activator protein (BSAP/Pax5) and interferon regulatory ...
Web Search
Gene Targeting and Transgenic Strategies for the Analysis of Hematopoietic Development in the Mouse
HKA Mikkola, SH Orkin - Methods Mol Med, 2005 - neurosci.humanapress.com
Page 1. Page 2. Genetic Manipulation in the Mouse 3 3 From: Methods in Molecular
Medicine, Vol. 105: Developmental Hematopoiesis: Methods and Protocols. ...
Web Search - journals.humanapress.com - biomed.humanapress.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
| |
©2005 Google