![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 27 of 27 for PAX6 and HOXA9. (0.07 seconds) |
Activation of Stem-Cell Specific Genes by HOXA9 and HOXA10 Homeodomain Proteins in CD34 Human Cord …
CM Ferrell, ST Dorsam, H Ohta, RK Humphries, MK … - stemcells.alphamedpress.org
... by the expression of HOXC13, HOXD3, the non-HOX HD proteins, PAX6, and the ... examined
the expression profile of the leukemogenic fusion gene, NUP98-HOXA9, in an ...
Web Search - dx.doi.org - stemcells.alphamedpress.org
human lung adenocarcinomas - Full text - MIT Libraries
M Shiraishi, A Sekiguchi, AJ Oates, MJ Terry, Y … - Oncogene, 2002 - nature.com
... However the CpG island that contains exon 1B of the PAX6 gene, which is 4 kb from ...
HOXA9 a AC004080 42 705 ± 43 419 42 612 ± 43 832 ACCCTACCTGCTGTGACCAG 94 ...
Cited by 7 - Web Search - nature.com - ncbi.nlm.nih.gov
A Set of Hox Proteins Interact with the Maf Oncoprotein to Inhibit Its DNA Binding, Transactivation, … - Full text - MIT Libraries
K Kataoka, K Yoshitomo-Nakagawa, S Shioda, M … - J Biol Chem, 2001 - jbc.org
... of pax6, to the fkhr gene have been found in human rhabdomyosarcomas (51, 52). It
is especially noteworthy that not only MHox/Pmx1 itself but also HoxA9 and ...
Cited by 22 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hematopoietic, angiogenic and eye defects in Meis 1 mutant animals - Full text - MIT Libraries
T Hisa, SE Spence, RA Rachel, M Fujita, T Nakamura … - The EMBO Journal, 2004 - embojournal.npgjournals.com
... shown that MEIS1 can also physically interact with HOX proteins (HOXA9) by forming ...
with a recent report suggesting that MEIS1 regulates Pax6 expression during ...
Cited by 9 - Web Search - nature.com - embojournal.npgjournals.com - ncbi.nlm.nih.gov
Hox regulation of normal and leukemic hematopoietic stem cells.
C Abramovich, RK Humphries - Current Opinion in Hematology, 2005 - co-hematology.com
... 77,78], and/or to protect from apoptic stimulus in conjunction with HOXA9 [79 ... reported
ability of Meis1 to bind and activate the promoter of Pax6 and platelet ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Human HOX gene mutations - Full text - MIT Libraries
FR Goodman, PJ Scambler - Clinical Genetics, 2001 - ingentaconnect.com
... Similar mutations in other homeodomain proteins, such as PAX6 (28), EMX2 (29), PITX2
(formerly RIEG) (30) and HLXB9 (31, 32), appear to act as null alleles ...
Cited by 31 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Full Article - Full text - MIT Libraries
FR Goodman, PJ Scambler - Clinical Genetics, 2001 - blackwell-synergy.com
... Similar mutations in other homeodomain proteins, such as PAX6 [28], EMX2 [29 ... Recurrent
chromosomal translocations producing NUP98/HOXA9 and NUP98/HOXD13 fusion ...
Web Search - blackwell-synergy.com
Alder J, Cho NK, Hatten ME. Embryonic precursor cells from the rhombic lip are specified to a … - Full text - MIT Libraries
S Alcantara, M Ruiz, F De Castro, E Soriano, C … - Neuron, 1996 - etd.adm.unipi.it
... Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control ...
D, Rashbass P, Seawright A, van Heyningen V. Role of Pax6 in development of ...
View as HTML - Web Search
GENE CO-OPTION IN PHYSIOLOGICAL AND MORPHOLOGICAL EVOLUTION - Full text - MIT Libraries
JR True, SB Carroll - Annual Review of Cell and Developmental Biology, 2002 - cellbio.annualreviews.org
... have revealed and characterized several such factors conserved throughout animals,
most notably the paired/homeobox transcription factor Pax6, which controls ...
Cited by 25 - Web Search - cephbase.com - cephbase.utmb.edu - cephbase.dal.ca - all 9 versions »
Hox Genes and Spinal Cord Development
D Neuroscience - Developmental Neuroscience, 2002 - content.karger.com
... Resources Chen F, Capecchi MR (1999): Paralogous mouse Hox genes Hoxa9, Hoxb9, and ...
A, van Heyningen V, Jessell TM, Briscoe J (1997): Pax6 controls progenitor ...
Web Search - dx.doi.org - karger.com - online.karger.com - all 5 versions »
The role of homeobox genes in hematopoiesis
MC Magli - Biotherapy, 1998 - ingentaconnect.com
... viral integration site 1), often in concomitance with Hoxa7 or Hoxa9 [65, 66 ... and
Aniridia can be correlated with molecular alterations of PAX2, PAX3 and PAX6. ...
Cited by 6 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcriptional Control of the Cell Cycle in Mammary Gland Development and Tumorigenesis
RD Coletta, P Jedlicka, A Gutierrez-Hartmann, HL … - Journal of Mammary Gland Biology and Neoplasia, 2004 - springerlink.com
... While the role of the HOXA9 paralog has been estab- lished in leukemias (35 ... and Six3
is able to rescue the small eye phenotype in Pax6 haploinsufficient mice ...
Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Disruption of the RanbBP17/Hox11L2 region by recombination with the TCRd locus in acute …
TE Hansen-Hagge, M Schaefer, H Kiyoi, SW Morris, … - Leukemia, 2002 - nature.com
Page 1. Leukemia (2002) 16, 2205–2212 2002 Nature Publishing Group All
rights reserved 0887-6924/02 $25.00 www.nature.com/leu ...
Cited by 9 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Sex determination and differentiation - Full text - MIT Libraries
DT MacLaughlin, PK Donahoe - N Engl J Med, 2004 - nejm.org
... Deficiency of WNT-4, HOXA9, 10, 11, 13 ... are thought to occur because of the proximity
of WT1 on chromosome 11p13 to the paired box homeotic (PAX6) gene and two ...
Cited by 15 - View as HTML - Web Search - uni-marburg.de - fiu.edu - ncbi.nlm.nih.gov - all 7 versions »
Text-Based Gene Profiling with Domain-Specific Views
P Glenisson, B Coessens, SV Vooren, Y Moreau, BD … - SWDB, 2003 - cs.uic.edu
... HOXA9 3205 NRF 55922 ... Mean Gene Variance cd44 0.446 myc 0.013 ube3a 0.429 pten 0.012
i 0.344 apc 0.01 wwox 0.28 tp53 0.01 sparc 0.27 dcc 0.009 pax6 0.234 msh2 ...
Cited by 1 - View as HTML - Web Search
Ethidium Bromide Provides a Simple Tool for Identifying Genuine DNA-Independent Associations - Full text - MIT Libraries
J Lai, W Herr - Proceedings of the National Academy of Sciences - pnas.org
... S. Rozenfeld, A. Kwong, LG Komuves, HJ Lawrence, and C. Largman HOXA9 Forms Triple ...
Y. Kamachi, M. Uchikawa, A. Tanouchi, R. Sekido, and H. Kondoh Pax6 and SOX2 ...
Web Search - adsabs.harvard.edu
The homeodomain Pbx2-Prep1 complex modulates hepatocyte nuclear factor 1 alpha-mediated activation … - Full text - MIT Libraries
PA Gregory, PI Mackenzie - Mol. Pharmacol, 2002 - intl-molpharm.aspetjournals.org
... pancreatic cells when promoter activity was activated by a combination of Pax6,
Ets-1 ... Kwong A, Kom ves LG, Lawrence HJ and Largman C (1999) HOXA9 forms triple ...
Cited by 4 - Web Search - molpharm.aspetjournals.org - ncbi.nlm.nih.gov
D ysmorphologie et genes du developpement
SLG References - medecine/sciences, 1996 - ist.inserm.fr
... leukaemia fuses the genes for nucleoporin NUP98 and class 1 homeopro- tein HOXA9. ...
Mutation of the PAX6 gene in patients with autosomal dominant keratitis. ...
View as HTML - Web Search
Identification of a Hoxd10-regulated transcriptional network and combinatorial interactions with … - Full text - MIT Libraries
E Hedlund, SL Karsten, L Kudo, DH Geschwind, EM … - Journal of Neuroscience Research, 2004 - doi.wiley.com
... Hoxa9 and Hoxc9 both repress the expression of osteopontin, a secreted glycoprotein
that regulates the adhesion, attachment, and spreading of osteoclasts ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hox Genes and Spinal Cord Development
EM Carpenter - Developmental Neuroscience, 2002 - content.karger.com
... ral phenotypes, but even in cases where multiple members of a paralogous family
have been inactivated (eg Hoxa7/ Hoxb7 [Chen et al., 1998], Hoxa9/Hoxb9 [Chen ...
Cited by 16 - Web Search - content.karger.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Meis family proteins are required for hindbrain development in the zebrafish - Full text - MIT Libraries
SK Choe, N Vlachakis, CG Sagerstrom - Development, 2002 - dev.biologists.org
... Black triangle in R indicates region of strong pax6 expression. ... 4Q). Expression
of pax6 reveals six boundaries in control embryos (Fig. ...
Cited by 12 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Deletions in HOXD13 segregate with an identical, novel foot malformation in two unrelated families - Full text - MIT Libraries
F Goodman, ML Giovannucci-Uzielli, C Hall, W … - Am J Hum Genet, 1998 - journals.uchicago.edu
... O, Araki M, Takagi K, Yamamura K (1998) Analysis of the murine Hoxa9 cDNA: an ... K,
Hodgson S, Zaletayev D, Fekete G, Van Heyningen V (1993) PAX6 mutations in ...
Cited by 29 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Homeodomain revisited: a lesson from disease-causing mutations - Full text - MIT Libraries
YI Chi - Human Genetics, 2005 - springerlink.com
... Coloboma of optic nerve PAX6 607108 Pairedbox-homeodomain (210–269) F258S PS ...
HOXa9 Mouse Homeodomain 1PUF N3 on A O2 on T O2 on C O4¢ on C ...
Web Search - ncbi.nlm.nih.gov
Embryology of the Upper Limb: The Molecular Orchestration of Morphogenesis Embryologie der oberen … - Full text - MIT Libraries
KC Oberg, LF Greer, T Naruse - Handchir Mikrochir plast Chir, 2004 - thieme-connect.com
... For example, if the mouse homolog for Pax6, a homeodomain-containing transcription
factor ... gradient, ie Hoxd9 - 13 [[26]], Hoxa5 - 7 [[39]] and Hoxa9 - 13 [[65 ...
Web Search - thieme-connect.com
Hox 11 paralogous genes are essential for metanephric kidney induction - Full text - MIT Libraries
DM Wellik, PJ Hawkes, MR Capecchi - Genes & Development, 2002 - genesdev.org
... Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control ...
Eya homologs of the Drosophila eyes absent gene require Pax6 for expression ...
Cited by 19 - Web Search - capecchi.genetics.utah.edu - pubmedcentral.nih.gov - dx.doi.org - all 8 versions »
Transcriptional profile analysis of in vivo adult subventricular zone (SVZ) neurogenesis
DA Lim, M Suarez-Farinas, F Naef, C Hacker, B Menn … - asterion.rockefeller.edu
... or St. Transcription factors Meis1, Mrg1/Meis2, Pbx1, Pbx3, Pax6, Madh1/Smad1,
Runx2, and Dlx5 were found in this group. These transcription ...
View as HTML - Web Search
Hox Genes and Their Candidate Downstream Targets in the Developing Central Nervous System
ZN Akin, AJ Nazarali - springerlink.com
Page 1. Cellular and Molecular Neurobiology, Vol. 25, Nos. 3/4, June 2005 (
C 2005) DOI: 10.1007/s10571-005-3971-9 Hox Genes and ...
Web Search
| |
©2005 Google