![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 36 of 36 for PAX6 and TP53. (0.08 seconds) |
Activation of the human PAX6 gene through the exon 1 enhancer by transcription factors SEF and Sp1 - Full text - MIT Libraries
JB Zheng, YH Zhou, T Maity, WS Liao, GF Saunders - Nucleic Acids Res, 2001 - nar.oupjournals.org
... Diserens,AC and Van Meir,EG (???? Frequent co-alterations of TP53, p16/CDKN2A ... and
Saunders,GF (1997) Transcriptional regulation of the human PAX6 gene promoter ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
human lung adenocarcinomas - Full text - MIT Libraries
M Shiraishi, A Sekiguchi, AJ Oates, MJ Terry, Y … - Oncogene, 2002 - nature.com
... PAX6 (exon 1B) Z95322 12 943 ± 13 614 11 532 ± 13 560 TCTTATCTCCCCTGGCTTCC 102 ... TP53
gene and the gene is inactivated by CpG island methylation (Raman et al ...
Cited by 7 - Web Search - nature.com - ncbi.nlm.nih.gov
Gene expression levels in different stages of progression in oral squamous cell carcinoma
WP Kuo, TK Jenssen, PJ Park, MW Lingen, R Hasina, … - Proc AMIA Symp, 2002 - pubgene.com
... AA888182 RPS4X AA863383 - AA400893 - AA873351 RPL35A H73914 - AA481543 PEPD R95962
PAX6 ... repair (DDB2 and DDB1); a tumor suppressor gene (TP53); and uteroglobin ...
Cited by 2 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
HmutDB Human Mutations Database
H Lehvaeslaiho - ebi.ac.uk
... P53, The IARC TP53 (p53) mutations database, 6612. P53B, Thierry Soussi's TP53
(p53) mutation database, 7434. ... PAX6, PAX6 mutation database, 94. ...
Cached - Web Search
Text-Based Gene Profiling with Domain-Specific Views
P Glenisson, B Coessens, SV Vooren, Y Moreau, BD … - SWDB, 2003 - cs.uic.edu
... Gene Mean Gene Variance cd44 0.446 myc 0.013 ube3a 0.429 pten 0.012 i 0.344 apc
0.01 wwox 0.28 tp53 0.01 sparc 0.27 dcc 0.009 pax6 0.234 msh2 0.005 wa 0.232 ...
Cited by 1 - View as HTML - Web Search
The role of apoptosis in cancer development and treatment response - Full text - MIT Libraries
JM Brown, LD Attardi - J. Natl Cancer Inst, 2002 - nature.com
... DAPK | MBD1 | MBD2 | MBD3 | MBD4 | MECP2 | MGMT | MLH1 | NEF3 | p41ARC | PAX6 |
RASSF1A | RB ... TP53 is the most commonly mutated gene in human cancer, a finding ...
Cited by 1 - Web Search - brownlab.info - ijp-online.com - ncbi.nlm.nih.gov - all 5 versions »
PAX 6 suppresses growth of human glioblastoma cells
YH Zhou, X Wu, F Tan, YX Shi, T Glass, TJ Liu, K … - Journal of Neuro-Oncology, 2005 - springerlink.com
... Estivill-Torrus G, Pearson H, van Heyningen V, et al.: Pax6 is required to regulate
the ... N, Maier D, Merlo A, et al.: Frequent co-alterations of TP53, p16/CDKN2A ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Molecular Biology Database Collection: 2003 update - Full text - MIT Libraries
AD Baxevanis, F Puehler, H Schwarz, B Waidner, J … - Nucleic Acids Research, 2003 - nar.oupjournals.org
... PAX6 gene Human Type I and III Collagen Mutation Database http://www.le.ac.uk/genetics/
collagen/ Human type I and type III collagen gene mutations iARC TP53 ...
Cited by 139 - Web Search - latech.edu - informatik.uni-leipzig.de - mayaweb.upr.clu.edu - all 41 versions »
Table 1. Molecular Biology Database Collection
C Genomics, G Expression, G Databases - nar.oupjournals.org
... PAX6 gene. Human Type I and III Collagen Mutation Database, http://www.le.ac.uk/
genetics/collagen/, Human type I and type III collagen gene mutations. iARC TP53 ...
Web Search
GEArray S Series Human Stem Cell Gene Array: AR-SAHS-601.2
FG Grouping, ECM Molecules - eurogentec.be
... NES, NGFR, NKX2-5, NKX2B, NPPA, NTF3, NUMB, OLIG1, OLIG2, PAX6, PDGFRA, PLP1 ... SOX13,
SOX15, SOX17, SOX18, SOX3, SOX4, SOX5, SOX6, TEP1, TERF1, TERT, TINF2, TP53. ...
View as HTML - Web Search - eurogentec.com
A comparative analysis of relative occurrence of transcription factor binding sites in vertebrate … - Full text - MIT Libraries
M Stepanova, T Tiazhelova, M Skoblov, A Baranova - Bioinformatics, 2005 - bioinformatics.oxfordjournals.org
... TFBS matches in sequence of study was underestimated previously, especially for
PAX6 and COMP1 ... Five TFs, namely TP53, NRSF, EVI1, SP1 and GC box element were ...
Web Search - bioinformatics.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
analysis in Drosophila melanogaster
G product Selected - www-biology.ucsd.edu
... Abd-B § Transcription Ffactor 6–10 Aniridia PAX6 ey § , toy § Transcription factor
11–14 ... Hepatocellular carcinoma TP53 hth § (e <10 –10 ) Cell cycle ...
Web Search - nature.com
Grundlagen der Tumoren des Kindesalters–das Beispiel Wilms-Tumor - Full text - MIT Libraries
G fuer die Entstehung - Der Onkologe, 2000 - springerlink.com
... der Bande 11p13 bei WAGR-Patienten waren der erste Hin- weis für eine Gen-Suche
und aus dieser Region wurden später das WT1- und das PAX6-Gen isoliert [5, 7 ...
Web Search
Table 1. Molecular Biology Database Collection
MS Repositories, C Genomics, G Expression, G … - nar.oupjournals.org
... Database, http://www.hgu.mrc.ac.uk/Softdata/PAX6/, Mutations in human PAX6 gene. ...
iARC p53 Database, http://www.iarc.fr/p53/, Compilation of TP53 gene mutations. ...
Web Search - nar.oupjournals.org
Global and gene-specific epigenetic patterns in human bladder cancer genomes are relatively stable … - Full text - MIT Libraries
ID Markl, J Cheng, G Liang, D Shibata, PW Laird, … - Cancer Res, 2001 - cancerres.aacrjournals.org
... 1998.[Abstract]; Markl ID, Jones PA Presence and location of TP53 mutation determines ...
Markl ID, Bender CM, Gonzales FA, Jones PA, Liang G. PAX6 methylation and ...
Cited by 19 - Web Search - cancerres.aacrjournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Gene Expression Profile Studies of Human Keratoconus Cornea for NEIBank: A Novel Cornea-Expressed … - Full text - MIT Libraries
YS Rabinowitz, L Dong, G Wistow - Investigative Ophthalmology & Visual Science, 2005 - iovs.org
... 30 Four of six apparently full-length PAX6 clones (of a total of 12 ... in this list
is PERP (also known under several aliases including TP53 apoptosis effector ...
Web Search - dx.doi.org - iovs.org - ncbi.nlm.nih.gov
BMC Bioinformatics - Full text - MIT Libraries
SD Mooney, TE Klein - BMC Bioinformatics, 2002 - biomedcentral.com
... CAV3 0.70 GP1BA 1.08 PAX3 0.86 TGFBI 0.55 CBS 0.57 GP9 0.66 PAX6 0.99 TH 0.84 ... CPT2
1.01 HK2 1.22 PKLR 0.63 TNNT2 0.74 CRB1 0.01 HPRT1 0.90 PLP1 0.82 TP53 0.28 ...
View as HTML - Web Search - bmc.ub.uni-potsdam.de - gdrs-intranet.ath.cx - smi-web.stanford.edu - all 6 versions »
List of genes screened entirely or partly by DHPLC (last updated August 20, 2002) Gene MIM# Disease …
SGT Center - parma.co.kr
... Eklund et al. [2000] PAX6 106210 Microphthalmia, anophthalmia, coloboma Morrison
et al. ... Ackerman et al. [2002] TP53 (p53) 191170 Various cancers Gross et al. ...
Web Search
Recent advances in Wilms tumor genetics
JS Dome, MJ Coppes - Curr Opin Pediatr, 2002 - co-pediatrics.com
... with WAGR syndrome revealed large deletions at chromosome 11p13, which was later
found to encompass a contiguous set of genes including PAX6, the gene ...
Cited by 26 - Web Search - co-pediatrics.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
The c-myc and PyMT oncogenes induce different tumor types in a somatic mouse model for pancreatic … - Full text - MIT Libraries
BC Lewis, DS Klimstra, HE Varmus - Genes & Development, 2003 - genesdev.org
... In addition, the TP53 and MADH4 tumor-suppressor genes are functionally inactivated
in ... The endocrine-specific transcription factors Isl1, Pax6, and Nkx2.2 were ...
Cited by 3 - Web Search - genesdev.org - dx.doi.org - ncbi.nlm.nih.gov - all 9 versions »
Peculiar structure and location of 9 p 21 homozygous deletion breakpoints in human cancer cells
AR Florl, WA Schulz - Genes Chromosomes and Cancer, 2003 - doi.wiley.com
... a negative regulator of cyclin-dependent kinases, and p14 ARF1 , an activa- tor
of TP53. ... site of a 300-kb deletion starting in intron 10 of the PAX6 gene in a ...
Cited by 4 - Web Search - uniklinik-duesseldorf.de - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Technical Advance
CM Chen, HL Chen, HCH Timothy, HAH Andrew, H Shi, … - American Journal of Pathology, 2003 - ajp.amjpathol.org
... CDH13 NM 001257 5 4 0 1 2 0 3 1 PAX6 NM 001604 7 10 — — 9 11 1 4 ... GJB2
NM 004004 0 2 0 2 0 1 0 1 TP53 NM 000546 0 0 5 2 5 5 4 5 ...
Web Search - 140.120.130.112 - Get it from MIT Libraries
Original Research Report
ESC Differentiation - dx.doi.org
... MDM2; PIGPC1; PIM1; PIR5A; PTEN; RBBP6; RB1; RBL1; RBL2; TP53; XRCC5 ACRV1 ... LASP1;
LLGL2; MILD1; MSX1; MSX2; NEUROG1; NKX2B; NSPC1; OLIG2; PAX6; PKNOX1; POU3F2 ...
Web Search - liebertonline.com - liebertonline.com
The Molecular Biology Database Collection: 2004 update - Full text - MIT Libraries
MY Galperin - Nucleic Acids Research, 2004 - nar.oupjournals.org
Page 1. The Molecular Biology Database Collection: 2004 update Michael
Y. Galperin* National Center for Biotechnology Information ...
Cited by 33 - Web Search - binf.gmu.edu - nbn.ac.za - sanbi.ac.za - all 14 versions »
Evolution by Phenotype - Full text - MIT Libraries
KM Weiss, AV Buchanan - Perspectives in Biology and Medicine, 2003 - muse.jhu.edu
... TP53 (colon, other cancers)1,300 CFTR (cystic fibrosis) 1,001 LDL receptor (heart ...
Gaucher’s disease) 157 BRCA2 (br, ovarian cancer) 154 Pax6 (eye problems ...
Web Search - anthro.psu.edu - anthro.psu.edu - muse.jhu.edu
Mechanisms of non-Mendelian inheritance in genetic disease - Full text - MIT Libraries
V van Heyningen, PL Yeyati - Human Molecular Genetics, 2004 - hmg.oupjournals.org
... In Brazil, where the incidence of paediatric adrenocortical carcinoma (ACC) is
10–15-fold higher than elsewhere, a TP53 allele, with a recurrently arising ...
Cited by 1 - Web Search - hmg.oupjournals.org - ncbi.nlm.nih.gov
Detection of methylated apoptosis-associated genes in urine sediments of bladder cancer patients - Full text - MIT Libraries
MG Friedrich, DJ Weisenberger, JC Cheng, S … - Clin. Cancer Res, 2004 - clincancerres.aacrjournals.org
... 53:260-8.[Medline]; Salem CE, Markl ID, Bender CM, et al PAX6 methylation and ... Presence
and location of TP53 mutation determines pattern of CDKN2A/ARF pathway ...
Cited by 2 - Web Search - clincancerres.aacrjournals.org - ncbi.nlm.nih.gov
Xiphophorus Genetic Linkage Map: Beginnings of Comparative Gene Mapping in Fishes - Full text - MIT Libraries
DC Morizot, RS Nairn, P Simhambhatla, L Della … - Marine Biotechnology - springerlink.com
... sarcoma oncogene homolog; TC1L1— mariner class transposon TC1-like; TP53—tumor
suppressor ... of the Fugu WAGR region from WT1 to PAX6: dramatic compaction and ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
DETECTION AND INTERPRETATION OF ALTERED METHYLATION PATTERNS IN CANCER CELLS - Full text - MIT Libraries
T Ushijima - Nature Reviews Cancer, 2005 - nature.com
Page 1. © 2005 Nature Publishing Group PERSPECTIVES they are more susceptible
to mutation 6 . However, clusters of CpG sites are ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Origin and evolution of avian microchromosomes - Full text - MIT Libraries
DW Burt, FTC Alert - Cytogenetic and Genome Research, 2002 - content.karger.com
Page 1. Cytogenet Genome Res 96:97–112 (2002) Origin and evolution of
avian microchromosomes DW Burt Department of Genomics and ...
Cited by 21 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
The river buffalo(Bubalus bubalis, 2 n= 50) cytogenetic map: assignment of 64 loci by fluorescence … - Full text - MIT Libraries
L Iannuzzi, GP Di Meo, A Perucatti, L Schibler, D … - Cytogenetic and Genome Research, 2003 - content.karger.com
Page 1. Cytogenet Genome Res 102:65–75 (2003) DOI: 10.1159/000075727 The river buffalo (
Bubalus bubalis , 2n = 50) cytogenetic map: assignment of 64 loci by ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Association between laminin-8 and glial tumor grade, recurrence, and patient survival
JY Ljubimova, M Fugita, NM Khazenzon, A Das, BB … - Cancer, 2004 - doi.wiley.com
Page 1. Association between Laminin-8 and Glial Tumor Grade, Recurrence,
and Patient Survival Julia Y. Ljubimova, MD, Ph.D. 1 Manabu ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
T HE D EVELOPMENTAL B IOLOGY OF B RAIN T UMORS - Full text - MIT Libraries
R Wechsler-Reya, MP Scott - Annual Review of Neuroscience, 2001 - neuro.annualreviews.org
... The homeobox gene pax6 is mutated in the mouse mutant "small-eye" and in
humans with aniridia (Glaser et al 1992, Quinn et al 1996). ...
Cited by 73 - Web Search - pharmacology.mc.duke.edu - scottlab.stanford.edu - ncbi.nlm.nih.gov - all 8 versions »
The Role of DNA Hypermethylation in the Pathogenesis and Prognosis of Acute Lymphoblastic Leukemia
J Roman-Gomez, JA Castillejo, A Jimenez, M Barrios … - Leukemia & Lymphoma, 2003 - dx.doi.org
... TP73, 1p36) p21 p57 14-3-3s (stratifin, SFN, 1p) Differentiation Myogenic
differentiation antigen-1 (MYOD,11p15.4) Paired box gene 6 (PAX6, 11p13) Retinoic ...
Web Search - taylorandfrancis.metapress.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Stanford Genome Technology Center
MIM Gene, D Reference - transgenomic.co.kr
Page 1. List of human genes screened entirely or partly by DHPLC (as of
December 15, 2003) Page 1 of 70 Stanford Genome Technology ...
Web Search - insertion.stanford.edu - transgenomic.co.kr - transgenomic.com.cn
MOLECULAR MECHANISMS FOR GENOMIC DISORDERS - Full text - MIT Libraries
K Inoue, JR Lupski - Annual Review of Genomics and Human Genetics, 2002 - genom.annualreviews.org
Annual Reviews tagline graphic, ...
Cited by 42 - Web Search - nutr.annualreviews.org - 128.194.251.107 - ncbi.nlm.nih.gov - all 7 versions »
| |
©2005 Google