![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 10 of 10 for PAX6 and USF1. (0.05 seconds) |
Did you mean: PAX6 and US F1
Transcription Factors in Islet Development and Physiology: Role of PDX-1 in Beta-Cell Function - Full text - MIT Libraries
P Cancer, G Expression, E Tumors - Ann. NY Acad. Sci, 2004 - annalsnyas.org
... the transcription factors that so far have been identified as regulators of the
pdx-1 gene include HNF-3ß/Foxa2, HNF-1 , SP1/3, Pax6, USF1/2, PDX-1, 75 and ...
Web Search - annalsnyas.org
Cooperative E-box regulation of humanGLI 1 by TWIST and USF - Full text - MIT Libraries
EH Villavicencio, JW Yoon, DJ Frank, EM … - genesis, 2002 - doi.wiley.com
... Here we report that the human GLI1 promoter is regulated by Sp1, USF1,
USF2, and Twist. ... The 482 E-box does not bind USF1 or USF2. ...
Cited by 6 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hox regulation of normal and leukemic hematopoietic stem cells.
C Abramovich, RK Humphries - Current Opinion in Hematology, 2005 - co-hematology.com
... by the reported ability of Meis1 to bind and activate the promoter of Pax6 and platelet ...
the interaction of the upstream stimulating factor 1 and 2 (USF1/2) [98 ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Molecular Biology of Glucokinase Regulation
PB Iynedjian - content.karger.com
... to Pdx-1 and Beta2, positive signals were obtained for binding of Pax6 and
Nkx2.2 ... Co-expression of USF1 with the reporter plasmid in HepG2 hepatoma cells stim ...
Web Search - content.karger.com
Nitric Oxide–Dependent and Nitric Oxide–Independent Transcriptional Responses to High Shear … - Full text - MIT Libraries
B Braam, R de Roos, H Bluyssen, P Kemmeren, F … - Hypertension, 2005 - hyper.ahajournals.org
... of NO and cGMP For a few important genes, induction (HMOX1, USF1, Heat shock 70kD ...
Of interest is that SOX5, SOX9, and PAX6 binding sites were more frequently ...
Web Search - hypertensionaha.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 6 versions »
A duplicated gene in the breakpoint regions of the 7q11. 23 Williams Beuren syndrome deletion … - Full text - MIT Libraries
LAP Jurado, Y Wang, R Peoples, A Coloma, J Cruces, … - Hum Mol Genet, 1998 - hmg.oupjournals.org
... Haploinsufficiency for the paired-box DNA binding protein PAX6 results in eye ... binding
protein, TFII-I, that interacts physically and functionally with USF1. ...
Cited by 10 - Web Search - hmg.oupjournals.org
The Lacrimal Gland Transcriptome Is an Unusually Rich Source of Rare and Poorly Characterized Gene … - Full text - MIT Libraries
AM Ozyildirim, GJ Wistow, J Gao, J Wang, DP … - Investigative Ophthalmology & Visual Science, 2005 - iovs.org
... CREB1, NFIL3, ELK1, FOXF2 GATA3, NHLH1, MAX, ZNF42, HAND1, USF1, and YY1. ... 44 TFAP2A
interacts with PAX6 in ocular development, including corneal epithelial ...
Web Search - dx.doi.org - iovs.org - ncbi.nlm.nih.gov
Transcriptional regulation by the MAP kinase signaling cascades - Full text - MIT Libraries
SH Yang, AD Sharrocks, AJ Whitmarsh - Gene, 2003 - www-unix.oit.umass.edu
... CREB MSK, MAPKAPK2 5, 30 bHLH BMAL1 ERK 31 USF1 p38 32 c-Myc ERK, JNK, ERK5 33–35 ...
p38 60–64 HSF-1 ERK, JNK 65, 66 Pax6, TBP ERK, p38 67–69 p53, SMAD3 ...
Cited by 48 - View as HTML - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
The circadian E-box: when perfect is not good enough
E Munoz, R Baler - Chronobiol Int, 2003 - taylorandfrancis.metapress.com
... For example, upstream stimulatory factors 1 and 2 (USF1/2) are ubiquitous bHLH nuclear
proteins involved in the regulation of many genes such as the cell cycle ...
Cited by 8 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
THE ROLE OF PU. 1 IN B-LYMPHOCYTE DEVELOPMENT AND FUNCTION
S RAO, MC SIMON - doi.wiley.com
... Btk AAAGGGAACTGA C/EBP, E-box, Sp1 Himmelmann et al., 1996; Muller et al., 1996
CD20 TTTCAAGAAGTGAAACCTGG Pip, USF1 Himmelmann et al., 1997 ...
Web Search
Did you mean to search for: PAX6 and US F1
|
©2005 Google