![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 112 for PBX1 and SP1. (0.24 seconds) |
Selective repression of transcriptional activators by Pbx1 does not require the homeodomain - Full text - MIT Libraries
Q Lu, MP Kamps - Biochemistry, 1996 - dx.doi.org
... While no segments of Pbx1 activated transcription, an internal domain of Pbx1 repressed
transcription induced by the activation domain of Sp1, but not by the ...
Cited by 7 - Web Search - pubmedcentral.nih.gov - pnas.org - ncbi.nlm.nih.gov - all 5 versions »
Fibroblast Growth Factor-8 Expression Is Regulated by Intronic Engrailed and Pbx 1-binding Sites - Full text - MIT Libraries
J Gemel, C Jacobsen, CA MacArthur - J Biol Chem, 1999 - jbc.org
... locations in the Fgf8 gene depicted in A. The DNA-binding sites in Fgf8 for AP2,
CREB/ATF, Egr1, Engrailed (En), Msx2, Pbx1, and Sp1 are indicated in B. In C ...
Cited by 17 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... COUP HNF4 1698.5 NFY PBX1 170.4 NFKAPPAB50 SP1 57.6 CEBP GATA1 28.9 ... FREAC3 FREAC7
220.8 PBX1 TATA 66.3 SP1 USF 33.0 ARNT GRE 220.0 ATF P53 63.4 MZF1 SP1 32.8 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
NF-1C, Sp1, and Sp3 are essential for transcription of the human gene for P450c17 (steroid 17alpha- … - Full text - MIT Libraries
CJ Lin, JW Martens, WL Miller - Mol Endocrinol, 2001 - mend.endojournals.org
... Thus, Sp1 and Sp3 binding to the -227/-184 site and NF-1C proteins ... A cooperative
interaction between members of the Pbx1 (37) and Meis1 families of proteins (38 ...
Cited by 23 - Web Search - dx.doi.org - mend.endojournals.org - ncbi.nlm.nih.gov
Cross-talk between glucocorticoid and retinoic acid signals involving glucocorticoid receptor … - Full text - MIT Libraries
N Subramaniam, J Campion, I Rafter, S Okret - Biochem J, 2003 - biochemj.org
... protein-protein contact with Pbx1. Biochemical Journal Immediate Publication. ... A
polyclonal anti-Sp1 antibody (X-7 (X), Santa Cruz Biotechnology) was ...
Cited by 6 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Synergistic cooperation between Sp1 and Smad3/Smad4 mediates TGFβ1 stimulation of α2 (I) collagen … - Full text - MIT Libraries
W Zhang, J Ou, Y Inagaki, P Greenwel, F Ramirez - J Biol Chem, 2000 - jbc.org
Page 1. Synergistic cooperation between Sp1 and Smad3/Smad4 mediates ... Key words: collagen
regulation; Sp1; Smad proteins; TGF β signaling; extracellular ...
Cited by 4 - Web Search
A putative binding site for Sp1 is involved in transcriptional regulation of CYP17 gene expression … - Full text - MIT Libraries
R Borroni, Z Liu, ER Simpson, MM Hinshelwood - Endocrinology, 1997 - endo.endojournals.org
... sequence (CRS1) of CYP17 is a cellular target for the homeodomain protein Pbx1. ... Berg
JM 1992 Sp1 and the subfamily of zinc finger proteins with guanidine-rich ...
Cited by 10 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov
Identification of Homeodomain Proteins, PBX1 and PREP1, Involved in the Transcription of Murine … - Full text - MIT Libraries
SH Chao, JR Walker, SK Chanda, NS Gray, JS … - Mol Cell Biol, 2003 - mcb.asm.org
... competitor (ie, unlabeled SP1 consensus oligonucleotide [NSC]). (B) Nuclear extracts
(NE) of 293 cells were incubated with antibodies against PBX1, MEIS1, PREP1 ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
FOXC1 Transcriptional Regulatory Activity Is Impaired by PBX1 in a Filamin A-Mediated Manner - Full text - MIT Libraries
FB Berry, MA O'Neill, M Coca-Prados, MA Walter - Mol Cell Biol, 2005 - mcb.asm.org
... The subcellular localization of PBX1 and EXD proteins depends on nuclear import
and ... Interaction of p38 and Sp1 in a mechanical force-induced, beta 1 integrin ...
Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Protein kinase A-dependent transactivation by the E 2 A-Pbx 1 fusion protein. - Full text - MIT Libraries
A Ogo, MR Waterman, MP Kamps, N Kagawa - J Biol Chem, 1995 - jbc.org
... cells (a GC-box control indicates Sp1 concentrations are similar in Y1 and S194
extracts). This signal can be both depleted and supershifted with anti-Pbx1 (Fig ...
Cited by 2 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Regulatory Sequence Analysis of Coclustering Genes
A TFBS - ahavj.ahajournals.org
... PBX1, 12/52=23, 9/29=31, 3/11=27, 1/6=17, 3/16=19, 2/3=67, 3/4=75, 0/9=0, 0/1=0,
0/1=0. RREB1, 13/52=25, 1/29=3, 0/11=0, 1/6=17, 3/16=19, 1/3=33, 2/4=50, 5/9=56 ...
Web Search
Cloning and transcriptional analysis of the mouse receptor activity modifying protein-1 gene … - Full text - MIT Libraries
MD Pondel, R Mould, C Terrace - BMC Molecular Biology, 2005 - biomedcentral.com
... 1). These include binding sites for the transcription factors NFκB, PBX1, AML1,
OCT1, MITF, TEF1 and Sp1. Of note is a 147 bp region (-2188 to –2336) ...
View as HTML - Web Search - pubmedcentral.nih.gov - citebase.eprints.org - dx.doi.org - all 7 versions »
BMC Molecular Biology - Full text - MIT Libraries
MD Pondel, R Mould - BMC Molecular Biology, 2005 - bmc.ub.uni-potsdam.de
... present (Fig. 1). These include binding sites for the transcription factors
NFκB, PBX1, AML1, OCT1, MITF, TEF1 and Sp1. Of note ...
View as HTML - Web Search
Synergistic Cooperation between Sp 1 and Smad 3/Smad 4 Mediates Transforming Growth Factor beta 1 … - Full text - MIT Libraries
W Zhang, J Ou, Y Inagaki, P Greenwel, F Ramirez - J Biol Chem, 2000 - jbc.org
... The identity of the complexes was determined by their immunoreactivity to antibodies
against Sp1, Smad3, or Smad4. Incubation with an anti-PBX1 antibody was ...
Cited by 37 - Web Search - jbc.org - ncbi.nlm.nih.gov
Insulin Drives Transcriptional Activity of the CYP17 Gene in Primary Cultures of Swine Theca Cells - Full text - MIT Libraries
G Zhang, JD Veldhuis, M Clinic - Biology of Reproduction - bioone.org
... indicate that basal and cAMP-regulated transcription of CYP17 probably involves
Sp1 and AP-2 ... sequences in the rat and cow [18 , 20 , 21] and a Pbx1 site in the ...
Cited by 4 - Web Search - biolreprod.org - biolreprod.com - ncbi.nlm.nih.gov - all 8 versions »
Functional Cloning and Characterization of a Novel Nonhomeodomain Protein That Inhibits the Binding … - Full text - MIT Libraries
C Abramovich, WF Shen, N Pineault, S Imren, B … - J Biol Chem, 2000 - jbc.org
... Kamps to selectively repress Sp1-activated transcription in a DNA binding-independent
manner (49). Moreover, Kamps et al. reported a region of PBX1 upstream of ...
Cited by 6 - Web Search - jbc.org - ncbi.nlm.nih.gov
Rapid Generation of de novo Biological Pathways from Large-Scale Gene Expression Data Using the …
DC Siu - ingenuity.com
... FYN, SYK COL1A2, DNTT,TNC, CDC4, TGFBR2, SP1, SP3, PSG1, ERG, USF1, ETS1 ... PBX1,TR
ALPHA, Malic Enzyme, HOXA9, HOXA11, HOXD12, HOXB13, SST, RB1, E2F1, HOXA10 ...
View as HTML - Web Search
Formation of in vivo Complexes Between the TAL1 and E2A Polypeptides of Leukemic T Cells - Full text - MIT Libraries
H Hsu, I Wadman, R Baer - Proceedings of the National Academy of Sciences - pnas.org
... Z. Liu and ER Simpson Steroidogenic Factor 1 (SF-1) and SP1 Are Required ... deletion
mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic mice ...
Cited by 65 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Biochemical diversity of peptide-hormone-dependent regulation of steroidogenic P450s
N Kagawa, LJ Bischof, PY Cheng, A Anwar, MR … - Drug Metab. Rev, 1999 - taylorandfrancis.metapress.com
... 225 CYP17 (P450c17) CRSI TTGATGGACAGTGAGCAAG Pbx1 Meis 20 (both have homeodomain ...
698 Adrenodoxin CRS GCCAGGGGGCGGGGCGGAGCGCC Sp1 type (all have Zn-finger 22 ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
A Novel Retinoic Acid-Responsive Element Regulates Retinoic Acid-Induced BLR1 Expression - Full text - MIT Libraries
J Wang, A Yen - Mol Cell Biol, 2004 - pubmedcentral.nih.gov
... Biotin-labeled probes and unlabeled competitors for DR5, DR2, DR1, EGR1, Sp1,
NFATc, NF1, CREB, and Pbx1 were also purchased from Panomics. ...
Cited by 1 - Web Search - panomics.com - dx.doi.org - mcb.asm.org - all 6 versions »
Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators
M Wilson, P Koopman - Curr Opin Genet Dev, 2002 - imb.uq.edu.au
... showed that the SOX2/Oct1 complex was able to increase the transcriptional activity
of the Hox/Pbx1 complex. ... SOX10 Sp1/3 HMG domain nicotinic acetylcholine PNS ...
Cited by 41 - View as HTML - Web Search - imb.uq.edu.au - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Cloning and Characterization of a 5'Regulatory Region of the Prolactin Receptor-Associated Protein/ … - Full text - MIT Libraries
M Risk, A Shehu, J Mao, CO Stocco, LT Goldsmith, … - Endocrinology - endo.endojournals.org
... 1293 [Abstract/Free Full Text]; Sugawara T, Saito M, Fujimoto S 2000 Sp1 and SF ... sequence
(CRS1) of CYP17 is a cellular target for the homeodomain protein Pbx1. ...
Web Search - endo.endojournals.org
ACTH modulation of transcription factors responsible for steroid hydroxylase gene expression in the … - Full text - MIT Libraries
MB Sewer, MR Waterman - Microscopy Research and Technique, 2003 - doi.wiley.com
... sequence (CRS1) of CYP17 is a cellular target for the homeodomain protein Pbx1. ... Cloning
of GT box-binding proteins: a novel Sp1 multigene family regulating T ...
Cited by 12 - Web Search - ncbi.nlm.nih.gov
Cloning and characterization of a 5'regulatory region of the PRAP/17 {beta} HSD7 gene - Full text - MIT Libraries
M Risk, A Shehu, J Mao, CO Stocco, LT Goldsmith, … - Endocrinology, 2005 - endo.endojournals.org
... PRAP/17βHSD7 promoter identified two enhancer regions that contained highly
conserved Sp1 7 ... Antibodies to Sp1 (sc-59, sc-420), 4 ...
Web Search - dx.doi.org - endo.endojournals.org - ncbi.nlm.nih.gov
A Protein Sequestering System Reveals Control of Cellular Programs by the Transcriptional … - Full text - MIT Libraries
B Khurana, TM Kristie - J Biol Chem, 2004 - jbc.org
... by HCF-1 sequestering includes transcriptional activators with predicted binding
sites in the HSV IE genes such as Sp1, ELK-1, ATF3, NFI-C, PBX1, c/EBP , and ...
Cited by 2 - Web Search - jbc.org - ncbi.nlm.nih.gov
A comparative analysis of relative occurrence of transcription factor binding sites in vertebrate … - Full text - MIT Libraries
M Stepanova, T Tiazhelova, M Skoblov, A Baranova - Bioinformatics, 2005 - bioinformatics.oxfordjournals.org
... PWMs for factors GC and SP1 were over-represented in category OTHER repeats in ... The
same is true for homeobox-containing transcription factor PBX1 with its core ...
Web Search - bioinformatics.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
Activin Regulation of the Follicle-Stimulating Hormone
SM MCGILLIVRAY, D COSS, PL MELLON - mend.endojournals.org
... Page 17. Pbx1, Prep1 and Smads in Activin Regulation of FSH β 17 ... Smad3/4 binding
to distal CAGA elements and Smad interaction with Sp1 protein at promoter ...
Web Search
GATA-4 and Nkx-2.5 coactivate Nkx-2 DNA binding targets: role for regulating early cardiac gene … - Full text - MIT Libraries
JL Sepulveda, N Belaguli, V Nigam, CY Chen, M … - Mol. Cell. Biol, 1998 - mcb.asm.org
... Nkx-2.5 might be similar to the effects of Extradenticle and Pbx1 on the ... In addition,
mammalian Nkx-2.1 cooperates with Sp1 and Sp3 to synergistically activate ...
Cited by 130 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Induction of Differentiation of the Human Promyelocytic Leukemia Cell Line (HL-60) by Retinoic Acid - Full text - MIT Libraries
TR Breitman, SE Selonick, SJ Collins - Mol. Endocrinol, 2004 - pnas.org
... Coeur, KK Resendes, and AG Rosmarin GA-binding protein (GABP) and Sp1 are required ...
Home page DB Sykes and MP Kamps Estrogen-dependent E2a/Pbx1 myeloid cell ...
Cited by 335 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The cardiac transcription factors Nkx 2-5 and GATA-4 are mutual cofactors - Full text - MIT Libraries
D Durocher, F Charron, R Warren, RJ Schwartz, M … - The EMBO Journal, 1997 - embojournal.npgjournals.com
... pentapeptide-containing Hox proteins: proposal for a model of a Pbx1-Hox-DNA ... erythroid
transcription factor gata-1 with the kruppel family proteins sp1 and eklf ...
Cited by 207 - Web Search - nature.com - emboj.org - ncbi.nlm.nih.gov - all 6 versions »
MyoD Targets Chromatin Remodeling Complexes to the Myogenin Locus Prior to Forming a Stable DNA- …
L Ivana, Y Ohkawa, CA Berkes, DA Bergstrom, CS … - mcb.asm.org
... is initially targeted to the myogenin promoter via the constitutively bound Pbx1. ...
cells stimulated MMP2 transcription and increased the binding of Sp1 and AP2 ...
Web Search - mcb.asm.org
An Otx-related homeodomain protein binds an LHss promoter element important for activation during … - Full text - MIT Libraries
SB Rosenberg, PL Mellon - Mol Endocrinol, 2002 - mend.endojournals.org
... 9A , uppermost bands, SP1+HD). ... appears to be limited to Ptx and Otx HD family members
as it fails to interact with other HD proteins such as Oct-1, Pbx1/2/3 ...
Cited by 15 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov
Inhibition of CYP17 expression by adrenal androgens and transforming growth factor b in …
JM Biernacka-Łukanty, TP Lehmann, WH Trzeciak - actabp.pl
... on human CYP17 expression (Sewer et al., 2002), whereas the Sp1 and Sp3 ... CRS1 provides
a binding site for the homeodomain proteins Pbx1 and Meis1 (Bischof et al ...
View as HTML - Web Search - actabp.pl
Pax2 and homeodomain proteins cooperatively regulate a 435 bp enhancer of the mouse Pax5 gene at the … - Full text - MIT Libraries
PL Pfeffer, M Bouchard, M Busslinger - Development, 2000 - dev.biologists.org
... AGCTCCAAATTTAATTGAAGAGTG-3′; Sp1, 5′-AATTCGATC- GGGGCGGGGCGAGCG-3′; Oct (H2A octamer)
5′-GTCTTTT- GTGCAGCTTATGCAAATGAGGGTAGG-3′; Pit (Pit1-binding ...
Cited by 21 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Identification of novel functional regions important for the activity of HOXB7 in mammalian cells - Full text - MIT Libraries
Y Yaron, JK McAdara, M Lynch, E Hughes, JC Gasson - J. Immunol, 2001 - jimmunol.org
... LFPWMR in Hoxb-8 is required for cooperative DNA binding with Pbx1 and Pbx2 ... Casein
kinase II-mediated phosphorylation of the C terminus of Sp1 decreases its ...
Cited by 10 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
The neuronal microtubule-associated protein 1B is under homeoprotein transcriptional control - Full text - MIT Libraries
ML Montesinos, I Foucher, M Conradt, G Mainguy, L … - J. Neurosci, 2001 - jneurosci.org
... pE-lacZ contains TATA box2 (TATA-2) and the upstream Sp1 motif (Fig. ... In rat embryos,
Pbx1 and Engrailed show overlapping expression patterns (Roberts et al ...
Cited by 10 - Web Search - jneurosci.org - ncbi.nlm.nih.gov
The mechanism of Drosophila leg development along the proximodistal axis - Full text - MIT Libraries
T Kojima - Development Growth and Differentiation, 2004 - blackwell-synergy.com
... Recently, buttonhead (btd) and the Drosophila homologue of human Sp1, which encode
zinc-finger transcription factors having partially redundant functions with ...
Cited by 2 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Pancreatic duodenal homeobox-1, PDX-1, a major regulator of beta cell identity and function - Full text - MIT Libraries
CM McKinnon, K Docherty - Diabetologia, 2001 - springerlink.com
... complex is in part stabilised through interactions between PDX-1 and PBX1 that involve
a ... involved in regulating the PDX-1 gene in- clude HNF1a and SP1/3 [55]. ...
Cited by 44 - Web Search - uni-greifswald.de - biochemie.uni-greifswald.de - ncbi.nlm.nih.gov - all 5 versions »
A Novel Signaling Pathway Mediates the Inhibition of CCL 3/4 Expression by Prostaglandin E 2 - Full text - MIT Libraries
H Jing, JH Yen, D Ganea - J Biol Chem, 2004 - jbc.org
... I). PGE 2 decreased the DNA binding activity of NFAT, Sp1, SRE, TFIID, and Pbx1
and increased the DNA binding activity of CDP/CBF, Est-1/PEA3, and P53 (Table I ...
Cited by 1 - Web Search - jbc.org - ncbi.nlm.nih.gov
A conserved motif present in a class of helix-loop-helix proteins activates transcription by direct … - Full text - MIT Libraries
ME Massari, PA Grant, MG Pray-Grant, SL Berger, JL … - Mol. Cell, 1999 - www-biology.ucsd.edu
Page 1. Molecular Cell, Vol. 4, 63–73, July, 1999, Copyright ©1999 by
Cell Press A Conserved Motif Present in a Class of Helix ...
Cited by 53 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Compilation of vertebrate-encoded transcription factors - Full text - MIT Libraries
S Faisst, S Meyer - Nucleic Acids Res, 1992 - pubmedcentral.nih.gov
... [PubMed]; Kamps MP, Look AT, Baltimore D. The human t(1;19) translocation in
pre-B ALL produces multiple nuclear E2A-Pbx1 fusion proteins with differing ...
Cited by 344 - Web Search - ncbi.nlm.nih.gov
Role of the transcription factor Sox-2 in the expression of the FGF-4 gene in embryonal carcinoma …
LR Johnson, KA Lamb, Q Gao, TK Nowling, A Rizzino - Molecular Reproduction and Development, 1998 - doi.wiley.com
... In addition to a conserved TATA box, this region also contains two well conserved
Sp1 motifs that bind Sp1 and Sp3 in vitro (Lamb et al., 1996). ...
Cited by 11 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
HOX and Non-HOX Homeobox Genes in Leukemic Hematopoiesis - Full text - MIT Libraries
BM Owens, RG Hawley - Stem Cells, 2002 - stemcells.alphamedpress.org
... Transcription factors are frequent targets in these lesions, and rearrangements
can result in the generation of fusion proteins, as in E2A-PBX1 associated with ...
Cited by 32 - Web Search - stemcells.alphamedpress.org - dx.doi.org - ncbi.nlm.nih.gov
Bibliography Current world literature
M Gabbianelli, U Testa, A Massa, E Pelosi, NM … - Current Opinion in Hematology, 2002 - co-hematology.com
... for multiple factors including GATA-1, NF-E2, erythroid Kruppel-like factor, and
Sp1. ... O'Gorman S, et al.: The Hox cofactor and proto-oncogene Pbx1 is required ...
Web Search
Lysophosphatidylcholine stimulates monocyte chemoattractant protein-1 gene expression in rat aortic … - Full text - MIT Libraries
JX Rong, JW Berman, MB Taubman, EA Fisher - Arterioscler Thromb Vasc Biol, 2002 - atvb.ahajournals.org
... J, Kawamoto S, Ishigatsubo Y, Okubo T. NF-kappa B and Sp1 regulate transcription ...
factor-8 expression is regulated by intronic engrailed and Pbx1-binding sites. ...
Cited by 12 - Web Search - atvb.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular effects of novel mutations in Hesx1/HESX1 associated with human pituitary disorders - Full text - MIT Libraries
JM Brickman, M Clements, R Tyrell, D McNay, K … - Development, 2001 - dev.biologists.org
... In addition to the multiple Sp1 sites and AT rich sequences immediately ... Recent
structural studies of Pbx1 class homeodomains highlight the importance of ...
Cited by 32 - Web Search - www-unix.oit.umass.edu - dev.biologists.org - ncbi.nlm.nih.gov
Sequence analysis of porcine endogenous retrovirus long terminal repeats and identification of … - Full text - MIT Libraries
CA Wilson, S Laeeq, A Ritzhaupt, W Colon-Moran, FK … - J Virol, 2003 - jvi.asm.org
... The Pbx1 binding site is present only in the PERV-C, PERV-NIH, and PERV ... region revealed
potential protein binding sites for the REBP, AML1, AP1, Sp1, and MZF1 ...
Cited by 6 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Accumulation of viral transcripts and DNA during establishment of latency by herpes simplex virus - Full text - MIT Libraries
MF Kramer, SH Chen, DM Knipe, DM Coen - J. Virol, 1998 - jvi.asm.org
... The tk transcription plasmid, pSVtk1, and the gH transcription plasmid, pBX1. ...
operationally substitutes for the cellular transcription factor Sp1 for efficient ...
Cited by 26 - Web Search - pubmedcentral.nih.gov - virologyj.com - ncbi.nlm.nih.gov - all 5 versions »
Children and adults with acute lymphoblastic leukaemia have similar gene expression profiles. - Full text - MIT Libraries
E Kuchinskaya, M Heyman, D Grander, M Linderholm, … - European Journal Of Haematology, 2005 - blackwell-synergy.com
... Cancer Institute, Buffalo, USA: PAC569O5 is located at the 5 end of PBX1, and ...
BCR/ABL, 3 with high hyperdiploidy and 1 with PBX1/TCF3. Microarray analysis ...
Web Search - blackwell-synergy.com - ejh.dk - ncbi.nlm.nih.gov
The Development of Beta-cell Mass: Recent Progress and Potential Role of GLP-1 - Full text - MIT Libraries
DA Stoffers - Hormone and Metabolic Research, 2004 - thieme-connect.com
... levels than observed in the single Pdx1 and Pbx1 heterozygous mutant ... these conserved
regions are functionally important binding sites for Sp1, Sp3, Hepatocyte ...
Cited by 2 - Web Search - thieme-connect.com - ncbi.nlm.nih.gov
| |
©2005 Google