![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 19 of 19 for PLAU and ESR1. (0.20 seconds) |
Did you mean: PAUL and ESR1
Oligo GEArray® Human Prostate Cancer Biomarkers Microarray
B APOC, C CHGA, C CLU, EGF COL6A1, ERK ERBB, FGF … - search.cosmobio.co.jp
... Other proteases: CASP1, CASP3, CASP7, PLAU, PLG. ... Transcription factors and regulators:
Nuclear Receptors: ESR1, ESR2, NR0B1, NR0B2, NR1D1, NR1D2, NR1H2, NR1H3 ...
View as HTML - Web Search
GEArray Q Series Human Breast Cancer and Estrogen Receptor Signaling Gene Array: AR-SAHS-020
FG Grouping - eurogentec.com
... COL6A1, CTNNB1 (b-catenin), CTSB (cathepsin B), EGFR, ERBB2 (Her-2), ESR1, ESR2,
F3 ... c-Jun), MKI67 (Ki-67), NGFB (NGF), NGFR, NME1 (NM23A), PGR, PLAU (uPA), PTEN ...
View as HTML - Web Search - eurogentec.be
GEArray Q Series Mouse Breast Cancer and Estrogen Receptor Signaling Gene Array: AR-SAMM-020
FG Grouping - eurogentec.com
... Cdkn2a (p16INK4a), Col6a1, Ctsb (cathepsin B), Egfr, Erbb2 (Her-2), Esr1, Esr2,
F3 ... c-Jun), Mki67 (Ki-67), Ngfa, Ngfb, Ngfr, Nme1 (NM23A), Pgr, Plau (uPA), Pten ...
View as HTML - Web Search - eurogentec.be
Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment
LC Li, PR Carroll, R Dahiya - Prostate - jncicancerspectrum.oupjournals.org
... Gene symbol References DNA hypermethylation Hormonal response AR, ESR1, ESR2, RARB,
RARRES1 ... 19, 57, 202 DNA hypomethylation CAGE, HPSE, PLAU 115, 117 ...
Web Search - ncire.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Panels of somatic cell hybrids specific for chimpanzee, gorilla, orangutan, and baboon - Full text - MIT Libraries
R Marzella, C Carrozzo, P Chiarappa, V Miolla, M … - Cytogenetic and Genome Research, 2005 - content.karger.com
... ESR1 r GAAAGCCATTGGTGTTGGAT GRB10 f TCAGCCTAGATGACGGGAAC 7p12.2 50124665–50124865 ...
GAD2 r CCTGTGCCTTCTTTGTCCAT PLAU f CTGCTATGAGGGGAATGGTC 10q22.2 74627066 ...
Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Molecular Profiling of Hepatocellular Carcinomas (HCC) Using a Large-Scale Real-Time RT-PCR Approach - Full text - MIT Libraries
V Paradis, I Bieche, D Dargere, I Laurendeau, C … - American Journal of Pathology, 2003 - ajp.amjpathol.org
... IGF2 NM-000612 0.13 0.11 0.05 (0–0.66) ESR1 NM-000125 0.15 0 0.17
(0.01–0.91) NRG3 ... 8.11) PLAU NM-002658 3.67 0.19 4.2 (2.34–10.35) ...
Cited by 6 - Web Search - ajp.amjpathol.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Molecular Cancer - Full text - MIT Libraries
I Bieche, S Tozlu, I Girault, R Lidereau - Molecular Cancer, 2004 - bmc.ub.uni-potsdam.de
... ERBB4 NM_005235 2q33.3-q34 ErbB4 ESR1/ER α NM_000125 6q25.1 Estrogen receptor 1
(alpha) ... PLAU/UPA NM_002658 10q24 Plasminogen activator, urokinase ...
View as HTML - Web Search
Molecular triangulation: Bridging linkage and molecular-network information for identifying …
M Krauthammer, CA Kaufmann, TC Gilliam, A Rzhetsky - Proceedings of the National Academy of Sciences - pnas.org
... For example, seed genes ESR1 and APP turned out to be the ... validated [APOE,
mitogen-activated protein 8 (MAPK8), and urokinase plasminogen activator (PLAU)]. ...
Cited by 2 - Web Search - pubmedcentral.nih.gov - mcb.mcgill.ca - statgen.ncsu.edu - all 8 versions » - Get it from MIT Libraries
A low-density DNA microarray for analysis of markers in breast cancer
M Lacroix, N Zammatteo, J Remacle, G Leclercq - Int J Biol Markers, 2002 - geocities.com
... the estrogen re- ceptor-alpha (ER-alpha, gene ESR1), has been ... Urokinase-type plasminogen
activator (uPA, gene PLAU) and plasminogen activator inhibitors-1 and ...
Cited by 6 - View as HTML - Web Search - geocities.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
A comprehensive review of genetic association studies
JN Hirschhorn, K Lohmueller, E Byrne, K Hirschhorn - Genet Med, 2002 - psych.umn.edu
... CYP1B1 (55, 56) ERBB2 (57) ESR1 (58) GSTM1 (59) ... 13,14,16–20 However, despite the
biologic plau- sibility of these associations, none have been reproducibly ob ...
Cited by 184 - View as HTML - Web Search - geneticsinmedicine.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Evidence for substantial effect modification by gender in a large-scale genetic association study of … - Full text - MIT Libraries
JJ McCarthy, J Meyer, DJ Moliterno, LK Newby, WJ … - Human Genetics, 2003 - springerlink.com
... First, the results of our study have generated biologically plau- sible hypotheses
to test in larger study populations with more exhaustive SNP genotyping ... ESR1 ...
Cited by 9 - Web Search
Origin and evolution of avian microchromosomes - Full text - MIT Libraries
DW Burt, FTC Alert - Cytogenetic and Genome Research, 2002 - content.karger.com
... 2000 MYB 3 6 10 23 Schmid et al. 2000 CCNC 3 6 10 Schmid et al. 2000 ESR1 3 6 10
Schmid et al. 2000 FYN 3 6 10 Schmid et al. 2000 PLN 3 6 10 Schmid et al. 2000 ...
Cited by 21 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Relevance of Breast Cancer Cell Lines as Models for Breast Tumours: An Update - Full text - MIT Libraries
M Lacroix, G Leclercq - Breast Cancer Research and Treatment, 2004 - springerlink.com
... The importance of oestrogen receptor-alpha (gene ESR1) and Her-2/neu (ERBB2) as
classifiers for cell lines and tumours is under- lined. ... g ESR1 mRNA present. ...
Cited by 16 - Web Search - kluweronline.com - geocities.com - ncbi.nlm.nih.gov - all 5 versions »
Stable ‘portrait’of breast tumors during progression: data from biology, pathology and genetics
M Lacroix, RA Toillon, G Leclercq - Endocrine-Related Cancer, 2004 - erc.endocrinology-journals.org
... For instance, ESR1, PGR, CDH1, TFF1 etc. are associated with the ER-positive/
low-grade phenotype. In contrast, CDKN2A, GSTPI, PLAU etc. ...
Cited by 1 - Web Search - geocities.com - journals.endocrinology.org - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
A brief history of human autosomes - Full text - MIT Libraries
D Haig - Philos Trans R Soc Lond B Biol Sci, 1999 - journals.royalsoc.ac.uk
Page 1. A brief history of human autosomes David Haig Department of Organismic
and Evolutionary Biology, Harvard University, 26 Oxford ...
Cited by 26 - Web Search - oeb.harvard.edu - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Comparative chromosome painting defines the high rate of karyotype changes between pigs and bovids - Full text - MIT Libraries
L Froenicke, J Wienberg - Mamm Genome, 2001 - springerlink.com
... HSA 1 pter-p1.1 8 9 CGA (1p2.1; 9), ESR1 (1p2.4-q2.5; 9) 6 (q) ... 4 , 12 (q22-qter),
22 (q11-q13.1) q2.3-q2.6 25 28 PLAU (14q2.4-q2.6; 28), RBP3 (14q2.5; 28) ...
Cited by 13 - Web Search - ncbi.nlm.nih.gov
Applying classification separability analysis to microarray data
Z Zhang, G Page, H Zhang - Method of microarray data analysis: papers from CAMDA - soph.uab.edu
... The results is show in figure 3. The clusters of genes from our analysis seem to
have responses to heat shock that are biologically plau- sible. ...
Cited by 15 - View as HTML - Web Search
Factors genetics de risc en la malaltia d'Alzheimer
AC Echavarria, UPF Universidad - tdx.cesca.es
... Universitat Pompeu Fabra. Amb el vist i plau de: Els directors de Tesi: Jaume
Bertranpetit Busquets David Comas Martínez Barcelona, gener de 2003 Page 3. ...
Web Search - tdx.cesca.es
EDUCATIONAL SESSION 2: THE ROLE OF APOPTOSIS IN THE PATHOGENESIS OF CANCER
M a Reality - aacr.org
Page 1. Page 186 American Association for Cancer Research Invited Abstracts EDUCATIONAL
SESSION 2: THE ROLE OF APOPTOSIS IN THE PATHOGENESIS OF CANCER ...
View as HTML - Web Search - testbed.aacr.org - aacr.org - services.aacr.org
Did you mean to search for: PAUL and ESR1
|
©2005 Google