![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 176 for REL and IRF1. (0.25 seconds) |
Constitutive activation of Epstein-Barr virus (EBV) nuclear antigen 1 gene transcription by IRF1 and … - Full text - MIT Libraries
BC Schaefer, E Paulson, JL Strominger, SH Speck - Mol. Cell. Biol, 1997 - mcb.asm.org
... Constitutive Activation of Epstein-Barr Virus (EBV) Nuclear Antigen 1 Gene
Transcription by IRF1 and IRF2 ... Transfections into IRF1 / , IRF2 / , ...
Cited by 35 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
GEArray Q Series Mouse NFkB Signaling Pathway Gene Array Cat. No.* Kit Size MM-016-2/MM-016N-2 2 …
FG Grouping, NFBR Genes, E Ligands, T Receptors, A … - tebu-bio.com
... Nfkbib (IkBβ), Nfkbie (IkBε ), nfkbil1, nfkbil2, Rel (c- rel), Rela, Relb (I-rel) ...
Csf3 (G-CSF), Ifna1, Ifnb, Ifng, Il2, Il6, Il12a, Il12b, Irf1, Scya2, Tnf ...
View as HTML - Web Search
GEArray S Series Human Immunology Signaling Pathways Gene Array: AR-SAHS-605
FG Grouping, A Molecules, I ICAM, CS Molecules, C … - eurogentec.com
... NFκB / IκB Family: NFKB1, NFKB2, NFKBIA, NFKBIB, NFKBIL1, NFKBIL2, NFRKB, REL, RELA,
RELB. ... IL2, IL3, IL4, IL6, IL8, IL10, IL12A, IL12B, IL13, IRF1, LTA, TGFB1 ...
View as HTML - Web Search - eurogentec.be
GEArray Q Series Mouse NF-kB Signaling Pathway Gene Array: AR-SAMM-016
FG Grouping, NFBR Genes, E Ligands, I Il1a, T … - eurogentec.be
... Nfkbib (IκBβ), Nfkbie (IκBε), nfkbil1, nfkbil2, Rel (c-rel), Rela, Relb (I-rel) ... Csf3
(G-CSF), Ifna1, Ifnb, Ifng, Il2, Il6, Il12a, Il12b, Irf1, Scya2, Tnf ...
View as HTML - Web Search - eurogentec.com
GEArray Q Series Mouse NFκB Signaling Pathway Gene Array
C No, K Size, FG Grouping, NFBR Genes, E Ligands, … - cosmobio.co.jp
... Nfkbib (IκBβ), Nfkbie (IκBε), nfkbil1, nfkbil2, Rel (c-rel), Rela, Relb (I-rel) ... Csf3
(G-CSF), Ifna1, Ifnb, Ifng, Il2, Il6, Il12a, Il12b, Irf1, Scya2, Tnf ...
View as HTML - Web Search - cosmobio.co.jp - superarray.com
GEArray Q Series Human NFkB Signaling Pathway Gene Array Cat. No.* Kit Size HS-016-2/HS-016N-2 2 …
FG Grouping, NFBR Genes, E Ligands, ILB IL1A, T … - tebu-bio.com
... IκBα / mad3), NFKBIB (IκBβ), NFKBIE (IκBε ), NFKBIL1, NFKBIL2, NFRKB, REL, RELA,
RELB ... IFNA1, IFNB1, IFNG, IL2, IL6, IL8, IL12A, IL12B, IRF1, LTA (TNF-b ...
View as HTML - Web Search
Interferon Regulatory Factor 1 Is an Essential and Direct Transcriptional Activator for Interferon { … - Full text - MIT Libraries
J Liu, X Guan, X Ma - J. Biol. Chem, 2005 - jbc.org
... Fig. 5D). However, the response to activation by NF B components p50, p65,
and c-Rel in the IRF1-RE mutant (M1) was intact (Fig. 5E ...
Web Search - jbc.org
GEArray Q Series Human NFkB Signaling Pathway Gene Array: AR-SAHS-016.2
FG Grouping, NFBR Genes, E Ligands, ILB IL1A, T … - eurogentec.be
... NFKB2, NFKBIA (IκBα / mad3), NFKBIB (IκBβ), NFKBIL1, NFKBIL2, NFRKB, REL, RELA,
RELB ... G-CSF), IFNA1, IFNB1, IFNG, IL2, IL6, IL8, IL12A, IL12B, IRF1, LTA (TNF ...
View as HTML - Web Search - eurogentec.com
Synergistic induction of HLA class I expression by RelA and CIITA - Full text - MIT Libraries
J Girdlestone - Blood, 2000 - bloodjournal.org
... To investigate the influence of Rel and IRE sites on CIITA action, expression vectors
for RelA and IRF1 were titrated with the CIITA vector (Figure 3A). At the ...
Cited by 14 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
scientificreport - Full text - MIT Libraries
I Albrecht, T Tapmeier, S Zimmermann, M Frey, K … - EMBO reports, 2004 - nature.com
... c-rel is not involved despite the requirement for c-rel for transcriptional ... Also,
neither IRF1 nor ICSBP seems to be responsible for differential induction of ...
Web Search - nature.com
EXPLORING CONCEPT SPACES FOR TEXT MINING
AK Sehgal - cs.uiowa.edu
... IRF1 ALAD LAMC2 COL17A1 LAMA3 SSX2 PON2 BMPR1A MADH4 PTEN KCNE1 AFP TP53 BRCA2 ARMET
ABCA4 ACADVL PXF PEX10 PXR1 SCN4A ABCC6 Table 3.2: Gene groups. Rel.: ...
View as HTML - Web Search - cs.uiowa.edu
Mining MEDLINE for Similar Genes and Similar Drugs
P Srinivasan, AK Sehgal - The Ninth ACM SIGKDD International Conference on Knowledge … - mingo.info-science.uiowa.edu
... COL5A1 IRF1 ALAD LAMC2 COL17A1 LAMA3 SSX2 PON2 BMPR1A MADH4 PTEN KCNE1 AFP TP53
BRCA2 ARMET ABCA4 ACADVL PXF PEX10 PXR1 SCN4A ABCC6 Table 5: Gene groups. Rel.: ...
Cited by 1 - View as HTML - Web Search - cs.uiowa.edu - mingo.info-science.uiowa.edu
Molecular Endocrinology. First published May 20, 2004 as doi: 10.1210/me. 2003-0467
G Zoumpoulidou, MC Jones, SF de Mattos, JM Francis … - mend.endojournals.org
... JAK, Janus kinase; PIAS, protein inhibitor of activated STAT; GAS, IFNγ activation
site; PRL, prolactin; Nmi, N-Myc interactor; IRF1, interferon response ...
Web Search
Toll-like receptors differentially induce nucleosome remodelling at the IL-12 p 40 promoter - Full text - MIT Libraries
I Albrecht, T Tapmeier, S Zimmermann, M Frey, K … - EMBO Reports, 2004 - emboreports.npgjournals.com
... c-rel is not involved despite the requirement for c-rel for transcriptional ... Also,
neither IRF1 nor ICSBP seems to be responsible for differential induction of ...
Web Search - nature.com - emboreports.npgjournals.com - ncbi.nlm.nih.gov
Human myeloma cell apoptosis induced by interferon-alpha - Full text - MIT Libraries
T Otsuki, O Yamada, H Sakaguchi, A Tomokuni, H … - British Journal of Haematology, 1998 - blackwell-synergy.com
... The REL for each gene from KMS-12-PE cells cultured with IFN for 2 d ... Furthermore,
up-regulation of the IRF1 and IRF2 genes is also notable because these genes ...
Cited by 24 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Early response genes induced in chondrocytes stimulated with the inflammatory cytokine interleukin-1 … - Full text - MIT Libraries
M Vincenti, C Brinckerhoff - Arthritis Res, 2001 - biomedcentral.com
... Genbank# Panel A: Transcription Factors/RNA-binding Proteins 18.0 I-rel (RELB)
M83221 ... X61498 15.7 interferon regulatory factor 1 (IRF1) X14454 ...
Cited by 21 - View as HTML - Web Search - pubmedcentral.nih.gov - bmc.ub.uni-potsdam.de - arthritis-research.com - all 10 versions »
Drosophila immunity. A sequence homologous to mammalian interferon consensus response element … - Full text - MIT Libraries
P Georgel, C Kappler, E Langley, I Gross, E … - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... regulation of HLA-A and -B: differential binding of members of the Rel and IRF ... Ten
RM, Blank V, Le Bail O, Kourilsky P, Israël A. Two factors, IRF1 and KBF1/NF ...
Cited by 16 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Deficient cytokine signaling in mouse embryo fibroblasts with a targeted deletion in the PKR gene: … - Full text - MIT Libraries
A Kumar, YL Yang, V Flati, S Der, S Kadereit, A … - The EMBO Journal, 1997 - embojournal.npgjournals.com
... NF- B is a multisubunit transcription factor comprising p50, p65 and rel proto-oncogene ...
For (A) and (B), the wild-type IRF-1 promoter (IRF1-WT) linked to a ...
Cited by 156 - Web Search - nature.com - emboj.org - ncbi.nlm.nih.gov - all 6 versions »
Regulation of human beta 2-microglobulin transactivation in hematopoietic cells - Full text - MIT Libraries
SJ Gobin, P Biesta, PJ Van den Elsen - Blood, 2003 - bloodjournal.org
... NF- B subunits p50 and p65, and specifically in B cells weakly bound by c-Rel and
RelB (Figure 6). The ISRE was bound by the ubiquitous factors IRF1 and IRF2. ...
Cited by 6 - Web Search - dx.doi.org - bloodjournal.org - ncbi.nlm.nih.gov - all 6 versions »
Lactobacilli and Streptococci Activate NF- Kappa B and STAT Signaling Pathways in Human Macrophages - Full text - MIT Libraries
M Miettinen, A Lehtonen, I Julkunen, S Matikainen - Journal of Immunology, 2000 - jimmunol.org
... activated NF- B dimers consist mainly of the Rel family proteins ... NF- B (5'-
AGTTGAGGGGACTTTCCCAGG-3'), IRF1-GAS (5'-AGCTTCAGCCTGATTTCCCCGAAATGACGGCA-3'), SIE ( ...
Cited by 39 - Web Search - jimmunol.org - ncbi.nlm.nih.gov - csa.com - all 6 versions »
Analysis of the Sequence Polymorphism within Class II Transactivator Gene Promoters
M Janitz, L Reiners-Schramm, A Muhlethaler-Mottet, … - Experimental and Clinical Immunogenetics, 2001 - content.karger.com
... IV contains an NF-GMa site, a GAS box, an E box, an IRF1/2 site ... Lucifer- ase activities
are presented as rel- ative to the pGL3 vector (with- out insert) after ...
Cited by 4 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate … - Full text - MIT Libraries
B He, X Qiao, A Cerutti - J. Immunol, 2004 - jimmunol.org
... reaction mixtures with 1 µl of a DNA-binding inhibiting/supershifting Ab to p65,
c-Rel, Rel-B, p50, p52, STAT1, STAT2, STAT3, STAT6, IRF1, IRF9 (Santa Cruz ...
Cited by 5 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
The mechanism of transcriptional synergy of an in vitro assembled interferon-b enhanceosome - Full text - MIT Libraries
TK KIM, T MANIATIS - Mol. Cell, 1997 - bioinformatics.buffalo.edu
... Figure 2. HMG I(Y) and Specific Dimeric bZIP/Rel Complexes Are Required for Tran ...
Increasing amounts of ATF2/ c-JUN, IRF1, and p50/p65 were added to in vitro ...
Cited by 145 - View as HTML - Web Search - ncbi.nlm.nih.gov
Organization and Functional Analysis of the Mouse Transporter Associated with Antigen Processing 2 … - Full text - MIT Libraries
E Arons, V Kunin, C Schechter, R Ehrlich - J. Immunol, 2001 - jimmunol.org
... 2 C). It is, therefore, likely, that the IRF1 binding site is the major regulatory
element ... in immune responses are regulated by members of the NF- B/Rel family ...
Cited by 7 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Identification and characterization of a novel Ets-2-related nuclear complex implicated in the … - Full text - MIT Libraries
X Ma, M Neurath, G Gri, G Trinchieri - J Biol Chem, 1997 - jbc.org
... The consensus IRF-1 oligonucleotide (IRF1-CS) did compete somewhat, although the ...
In addition, the -c-Rel antibody also produced a consistent supershift of the ...
Cited by 62 - Web Search - jbc.org - ncbi.nlm.nih.gov
HLA-G unique promoter region: functional implications - Full text - MIT Libraries
C Solier, VE Mallet, FE Lenfant, A Bertrand, A … - Immunogenetics, 2001 - springerlink.com
... and lacks the ISRE which renders this gene unresponsive to NK-κB, IRF1, and class ...
The enhancer A element contains binding sites for the NF-κB/Rel DNA-binding ...
Cited by 12 - Web Search - ncbi.nlm.nih.gov
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Elk1, Elk3, Fkbp1b, Fos, Fosb, Fosl1, Fosl2, Gata3, Gata4, Icos, Irf1, Jun, Junb ...
Nfkb1, Nfkb2, Nfkbia, Nfkbib, Nfkbie, Nfkbil1, P300-ESTs, Raf1, Rel, Rela, Relb ...
View as HTML - Web Search - eurogentec.be
Negative regulation by protein tyrosine phosphatase of IFN-gamma-dependent expression of inducible … - Full text - MIT Libraries
MJ Diaz-Guerra, A Castrillo, P Martin-Sanz, L … - J. Immunol, 1999 - jimmunol.org
... Anti-p50 (human), anti-c-Rel (human), and anti-p65 (murine) Abs were from Santa ... I
B , I Bß, IRF1, and Stat1 were recognized by the corresponding Abs (Santa ...
Cited by 14 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... NIP45), FOS, FOSL1, FOSL2, FOXP3, GATA3, GATA4, GRLF1, ICOS, IRF1, JUN, JUNB ... NFKB1,
NFKB2, NFKBIA, NFKBIB, NFKBIE, NFKBIL1, NFKBIL2, NFRKB, RAF1, REL, RELA, RELB ...
View as HTML - Web Search - eurogentec.com
Functional Gene Grouping Toll-Like Receptors:
D Pathways, T Genes - search.cosmobio.co.jp
... Map3k14, Map4k4, Nfkb1, Nfkb2, Nfkbia, Nfkbib, Nfkbie, Nfkbil1, Nfrkb, Rel, Rela,
Relb ... Ptges, Ptgs2; IRF Pathway: Cxcl10, Ifna1, Ifnb, Ifng, Irf1, Irf3, Irf7 ...
View as HTML - Web Search
OMM-018 (previously OMM-003) Oligo GEArray® Mouse Toll-Like Receptor Signaling Pathway Microarray
FG Grouping, D Pathways, T Genes - search.cosmobio.co.jp
... NIK), Nfkb1, Nfkb2, Nfkbia (IkBa / mad3), Nfkbib (IkBb), Nfkbie, Nfkbil1, Rel, Rela,
Relb ... 2); IRF Pathway: Cxcl10 (IP-10), Ifna1, Ifnb, Ifng, Irf1, Irf3, Irf7 ...
View as HTML - Web Search
An Interferon {gamma}-Regulated Protein that Binds the Interferon-Inducible Enhancer Element of … - Full text - MIT Libraries
PH Driggers, DL Ennist, SL Gleason, W Mak, MS … - Proceedings of the National Academy of Sciences - pnas.org
... Role in Immune Defense and Is Induced by the v-Rel Oncoprotein Mol ... gp91PHOX and p67PHOX
Expression by Inhibiting Interaction of PU.1, IRF1, Interferon Consensus ...
Cited by 97 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - adsabs.harvard.edu - all 5 versions »
Endothelial interferon regulatory factor 1 cooperates with NF-B as a transcriptional activator of … - Full text - MIT Libraries
AS Neish, MA Read, D Thanos, R Pine, T Maniatis, T … - Mol. Cell. Biol, 1995 - mcb.asm.org
... regulation of VCAM-1. This report characterizes the Rel species interacting ... used
for construct generation were VCAM-RP- IRF1 (CTTTATAAAGGGTCTTGTTGCAGAG), VCAM ...
Cited by 117 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
IFN-Regulates TLR-Dependent Gene Expression of IFN-, IFN-, IL-28, and IL-29
J Siren, J Pirhonen, I Julkunen, S Matikainen - medmicro.wisc.edu
... precipitated), anti-IRF1, anti- IRF7 (IFN- 14 PRD-like precipitated), or rabbit
anti-p50 (SC-7178; Santa Cruz Biotechnology), anti-p65 (SC-372), anti-c-rel (SC ...
View as HTML - Web Search - medmicro.wisc.edu
Transcriptional Response of T Cells to IFN-: Changes Induced in IFN--Sensitive and Resistant …
L Tracey, I Spiteri, P Ortiz, M Lawler, MA Piris, … - Journal of Interferon & Cytokine Research, 2004 - dx.doi.org
... Resistance to IFN-a appears to be associated with failure to induce IRF1 and IRF7 ...
may play a role in IFN-a resistance, (12–15) these are rel- atively rare ...
Cited by 2 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Role of Nuclear Factor-{kappa} B in the Antiviral Action of Interferon and Interferon-regulated Gene … - Full text - MIT Libraries
LM Pfeffer, JG Kim, SR Pfeffer, DJ Carrigan, DP … - J Biol Chem, 2004 - jbc.org
... derived from mice in which the p50 and p65 members of the Rel family have ... ISGs such
as Ifit1, Gbp2, mx1, Isg15, Stat1, nmi, mx2, If204, Adar, Irf1, and protein ...
Cited by 2 - Web Search - jbc.org
Signaling Pathways Mediated by the TNF-and Cytokine-Receptor Families Target a Common cis-Element of … - Full text - MIT Libraries
S Gupta, D Xia, M Jiang, S Lee, AB Pernis - J. Immunol, 1998 - jimmunol.org
... In contrast to induction of STATs by cytokines, the IRF-1 GAS-binding complex activated
by CD40, TNF- , or EBV contains Rel proteins, specifically p50 and p65. ...
Cited by 18 - Web Search - jimmunol.org - cumc.columbia.edu - ncbi.nlm.nih.gov - all 8 versions »
IFN-{alpha} Regulates TLR-Dependent Gene Expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29 - Full text - MIT Libraries
J Siren, J Pirhonen, I Julkunen, S Matikainen - The Journal of Immunology, 2005 - jimmunol.org
... precipitated), anti-IRF1, anti-IRF7 (IFN- 14 PRD-like precipitated), or rabbit
anti-p50 (SC-7178; Santa Cruz Biotechnology), anti-p65 (SC-372), anti-c-rel (SC ...
Cited by 1 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 5 versions »
Roles of interferon-regulatory factors in T-helper-cell differentiation - Full text - MIT Libraries
M Lohoff, TW Mak - Nature Reviews Immunology, 2005 - nature.com
... R., Burnside, J. & Bose, HR A novel interferon regulatory factor (IRF), IRF-10,
has a unique role in immune defense and is induced by the v-Rel oncoprotein. ...
Cited by 1 - Web Search - nature.com - ncbi.nlm.nih.gov
TranSignal™ NFκB Target Gene Arrays
PU Manual - panomics.com
... ALOX12 CD80 CD23 FB SCY A11 CSF2 IGFBP1 IL1B IRF1 CSF-1 NFKB1 T AP1 TCRB VCAM-1
1 ... A1A T BCL2A1 CD 69 c -rel F as -L GSTP1 MAD-3 IL2 JU NB MIP2 g PRG1 LMP-2 T H ...
View as HTML - Web Search - b-bridge.com - panomics.com - biocat.de
The Cytokine Responsive Vascular Smooth Muscle Cell Enhancer of Inducible Nitric Oxide Synthase - Full text - MIT Libraries
BY ACTIVATION - J. Biol. Chem, 2004 - jbc.org
... same conditions was without effect, as were the antibodies to the other rel gene
family ... sequences for a B site, a GAS/ISRE element and binding sites for IRF1. ...
Web Search - jbc.org
Inhibition of nuclear factor jB activity by viral interferon regulatory factor 3 of Kaposi’s … - Full text - MIT Libraries
T Seo, J Park, C Lim, J Choe - Oncogene, 2004 - nature.com
... IFN) regulatory factors (IRFs), including ORF K9-encoded viral (v) IRF1, ORF K11 ...
is composed of homo- and heterodimers from members of the Rel family (Baeuerle ...
Web Search - nature.com - ncbi.nlm.nih.gov
BMC Genomics - Full text - MIT Libraries
J Schwamborn, A Lindecke, M Elvers, V Horejschi, M … - BMC Genomics, 2003 - biomedcentral.com
... Clusters containing genes that peaked rel- atively early were identified (Fig. ... eg
constit- uents of transcription factors: IκB-α and IRF-1 (NFKBIA, IRF1). ...
Cited by 1 - View as HTML - Web Search - dx.doi.org - bioinformatics.pzr.uni-rostock.de - bmc.ub.uni-potsdam.de - all 10 versions »
as Revealed by Immunoprinting
H Przuntek, T Epplen - doi.wiley.com
... Primers were modified as follows to allow multiplexed poly- merase chain reactions
(PCR)-IRF1, GT strand: 5' TAT- GGCAGATAGGTCCACCGG 3', CA strand: 5' CCT- ...
Web Search
Stat1 is induced and activated by all-trans retinoic acid in acute promyelocytic leukemia cells - Full text - MIT Libraries
M Gianni, M Terao, I Fortino, M LiCalzi, V … - Blood, 1997 - bloodjournal.org
... Finally ATRA increases the expression of two IFN-responsive genes like interferon
responsive factor 1 (IRF1) and 2'-5' oligoadenylate synthetase (OAS) and ...
Cited by 50 - Web Search - bloodjournal.org - ncbi.nlm.nih.gov
In-silico identification of chicken immune-related genes - Full text - MIT Libraries
J Smith, D Speed, AS Law, EJ Glass, DW Burt - Immunogenetics, 2004 - springerlink.com
... 603322645F1 349 4e-93 BLASTN IRF1 MAR Interferon regulatory factor ... Interferon regulatory
factor; induced by the v-Rel oncoprotein AF380350 603104393F1 1,320 0 ...
Cited by 7 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
BIOINFORMATICS ORIGINAL PAPER
SW Cole, W Yan, Z Galic, J Arevalo, JA Zack - bioinformatics.oxfordjournals.org
... are over- or under-represented in the promoters of co-regulated genes rel- ative
to ... yielded no results at all with short promoter sequences (eg IRF1 Figure 2B ...
Web Search
Negative Regulation of NF-{kappa} B Signaling by PIAS1 {dagger}
B Liu, R Yang, KA Wong, C Getman, N Stein, MA … - mcb.asm.org
... p65 contains a transcriptional activation domain and a Rel homology domain. ... I B ,
IL-1ß, Mip2 (macrophage inflammatory protein 2), Irf1 (interferon regulatory ...
Web Search - dx.doi.org - mcb.asm.org
Gene Array Identification of Epstein Barr Virus-Regulated Cellular Genes in EBV-Converted Burkitt … - Full text - MIT Libraries
F Baran-Marszak, R Fagard, B Girard, S Camilleri- … - Lab Invest, 2002 - nature.com
... Furthermore, three families of transcription factors, Rel/NF- , STAT1, and ETS proteins
were ... Within this set of genes, SHP-1, p21, Rb, c-myc, IRF1, SOCS3, TNFR ...
Cited by 5 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Computationally Identifying Novel NF-{kappa} B-Regulated Immune Genes in the Human Genome - Full text - MIT Libraries
R Liu, RC McEachin, J David - METHODS, 2003 - genome.org
... for the presence of binding sites for AP1, IK (IK1, IK3), IRF (IRF1, IRF2, ISRE ... NF-
B and Rel proteins: Evolutionarily conserved mediators of immune responses. ...
Cited by 14 - Web Search - pubmedcentral.nih.gov - dx.doi.org - dx.doi.org - all 5 versions »
|
©2005 Google