![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 51 for REST and USF1. (0.17 seconds) |
Did you mean: REST and US F1
CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA COMPLEX & CRYSTAL …
FJ FERNENDEZ-PEREZ, P DOCTOR - tdx.cesca.es
... CLONING, EXPRESSION, PURIFICATION AND CRYSTALLISATION OF THE HUMAN Ets-1/USF1/DNA
COMPLEX & CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA HISTIDINOL-PHOSPHATE ... USF1. ...
Web Search
EXERCISE DOWN-REGULATION OF FATTY ACID SYNTHASE MAY BE CAUSED BY REDUCED NUCLEAR PROTEIN BINDING TO …
R Fiebig, M Gore, LF Oscai, LL Ji - Medicine & Science in Sports & Exercise, 1998 - acsm-msse.org
... and refed a high-fructose diet for 8 h and killed at rest (R); or ... Using antibodies
to the upstream stimulatory factors (USF1+USF2), we showed in gel supershift ...
Web Search
Exercise attenuates nuclear protein binding to gene regulatory sequences of hepatic fatty acid … - Full text - MIT Libraries
R Fiebig, MT Gore, LL Ji - J. Appl. Physiol, 1999 - jap.org
... 6), or fasted, refed a high-fructose diet for 6 h, and killed at rest (R, n ... The upstream
stimulatory factors (USF; USF1, 43 kD and USF2, 44 kD), members of the ...
Cited by 4 - Cached - Web Search - jap.physiology.org - jap.org - ncbi.nlm.nih.gov - all 5 versions »
Interferon-gamma regulation of the human mimecan promoter - Full text - MIT Libraries
ES Tasheva, GW Conrad - Mol Vis, 2003 - molvis.org
... acti- vated protein kinase (MAPK), transcription factors CBP/p300, USF1 and NF ... hy-
perplastic primary vitreous, corneal vascularization, and ar- rest of retinal ...
Cited by 2 - View as HTML - Web Search - molvis.org - ncbi.nlm.nih.gov
Human papillomavirus type 16 E6 activates TERT gene transcription through induction of c-Myc and … - Full text - MIT Libraries
HR McMurray, DJ McCance - J Virol, 2003 - jvi.asm.org
... This shows that a repressive complex containing USF1 and USF2 is present in normal
cells ... to be up-regulated in 85 to 90% of tumor cells, the rest utilizing the ...
Cited by 12 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Upstream stimulatory factor regulates expression of the cell cycle-dependent cyclin B1 gene promoter - Full text - MIT Libraries
JP Cogswell, MM Godlevski, M Bonham, J Bisi, L … - Mol. Cell. Biol, 1995 - mcb.asm.org
... kb KpnI fragment (CB2) and an 8-kb BamHI fragment (CB3), which contained the rest
of the ... against the C-terminal portion of the 43-kDa form of human USF1 (55, 59 ...
Cited by 58 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
The bHLH-Zip transcription factor Tfeb is essential for placental vascularization - Full text - MIT Libraries
T Tfe - Development, 1998 - dev.biologists.org
... proteins and other members of the bHLH-Zip family tested, such as USF1, MYC or ... The
rest of the tissue, both embryo and placenta, was dehydrated and embedded in ...
Cited by 36 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Quantitative analysis of DNA demethylation and transcriptional reactivation of the FMR 1 gene in … - Full text - MIT Libraries
R Pietrobono, MG Pomponi, E Tabolacci, B Oostra, P … - Nucleic Acids Research, 2002 - nar.oupjournals.org
... The rest of the activity appears to be driven by the binding of transcription factors
USF1 and USF2 to footprint I, coinciding with an E-box sequence ...
Cited by 10 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Transcriptional Regulation of Mouse delta-Opioid Receptor Gene - Full text - MIT Libraries
P Sun, HH Loh - J. Biol. Chem, 2001 - jbc.org
... g of NS20Y nuclear extracts or indicated amounts of recombinant Ets-1 or USF1 in
a ... The rest of the primary culture dishes were transfected with the pSG5-Ets-1 ...
Cited by 12 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
A Novel Factor Binding to the Glucose Response Elements of Liver Pyruvate Kinase and Fatty Acid … - Full text - MIT Libraries
J Hasegawa, K Osatomi, RF Wu, K Uyeda - J Biol Chem, 1999 - jbc.org
... the nuclear and cytosolic extracts (7.5 µg) with 2 µg each of anti-USF1, anti-USF2 ...
170 to 145) of the LPK promoter DNA was linked to 96 of the rest of the ...
Cited by 29 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Occupancy and function of the-150 sterol regulatory element and-65 E-box in nutritional regulation … - Full text - MIT Libraries
MJ Latasa, MJ Griffin, YS Moon, C Kang, HS Sul - Mol. Cell. Biol, 2003 - mcb.asm.org
... Four micrograms of anti-USF1 antibody (sc-229 X; Santa Cruz), 30 µg ... sample was collected,
labeled "input," and processed simultaneously with the rest of the ...
Cited by 6 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Putting its fingers on stressful situations: the heavy metal-regulatory transcription factor MTF-1 - Full text - MIT Libraries
P Lichtlen, W Schaffner - BioEssays, 2001 - doi.wiley.com
... similarity is confined to several short patches throughout the rest of the ... least
in this cell type, cooperates with the transcription factor USF1 to regulate ...
Cited by 23 - Web Search - doi.wiley.com - teaching.ucdavis.edu - ncbi.nlm.nih.gov
Activation of the Epstein-Barr virus DNA polymerase promoter by the BRLF1 immediate-early protein is … - Full text - MIT Libraries
C Liu, ND Sista, JS Pagano - J. Virol, 1996 - jvi.asm.org
... The rest of the oligonucleotide competitors were synthesized in the Lineberger ...
polyclonal antibody (a gift of Michelle Sawadogo) which recognizes both USF1 and ...
Cited by 21 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
The evolution of protein interaction networks in regulatory proteins
GD Amoutzias, DL Robertson, E Bornberg-Bauer - Comparative and Functional Genomics, 2004 - doi.wiley.com
... eHand Usf1 Bmal1 Hey2 Dec1 ... closely related than the rest [15]. No other phy- logenetic
relationship between the subfamilies has been reliably inferred as yet. ...
Cited by 1 - Web Search - ingentaconnect.com
Motif-Based Protein Sequence Classification Using Neural Networks - Full text - MIT Libraries
K Blekas, DI Fotiadis, A Likas - Journal of Computational Biology, 2005 - dx.doi.org
... The obtained gradient-log-probability vectors are applied to an SVM to identify
the decision boundary between the family and the rest of the protein universe. ...
Web Search - liebertonline.com - cs.uoi.gr - ncbi.nlm.nih.gov - all 6 versions »
Operations and single-particle interferometry - Full text - MIT Libraries
J Aaberg - Physical Review A, 2004 - link.aps.org
... 5 below are formulated in slightly more general settings than in the rest of this ...
independent Kraus representation of F1 [6]. One can see that UsF1, Ha ,uald ...
Web Search - adsabs.harvard.edu - adsabs.harvard.edu
Nonlinear Interaction of Light with Transversely Moving Medium - Full text - MIT Libraries
NV Tabiryan, SR Nersisyan, M Warenghem - Physical Review Letters, 1996 - link.aps.org
... process with a simple exponential law of relaxation ustd ng usf1 2 exps2tytdg ... to
themotion when the initial stationary state is the state of rest is ymin ng ...
Cited by 3 - Web Search - adsabs.harvard.edu - ncbi.nlm.nih.gov
Thyroid Hormone Regulates the Hypotriglyceridemic Gene APOA5 - Full text - MIT Libraries
X Prieur, T Huby, H Coste, FG Schaap, MJ Chapman, … - J. Biol. Chem, 2005 - jbc.org
... regions but display remarkably sequence homology throughout the rest, especially
in ... In Vitro Transcription/Translation and EMSAs—TR , RXR , USF1, and USF2 ...
Web Search - jbc.org - ncbi.nlm.nih.gov
A transcription factor involved in skeletal muscle gene expression is deleted in patients with …
M Tassabehji, M Carette, C Wilmot, D Donnai, AP … - European Journal of Human Genetics, 1999 - nature.com
... The rest were identified by sequencing directly from the BAC/PAC clones using ... box
family transcrip- tion factor), Phox (a homeodomain protein) and USF1 (a bHLH ...
Cited by 16 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Metabolic Energetics and Genetics in the Heart - Full text - MIT Libraries
H TAEGTMEYER, CR WILSON, P RAZEGHI, S SHARMA - Ann. NY Acad. Sci, 2005 - annalsnyas.org
... Because the heart works even when the body is at rest, myocardial O 2 ... SREBPs),
stimulatory protein 1 (Sp1), and upstream stimulatory factor 1 (USF1) 33 have ...
Web Search - annalsnyas.org
Evidence against the peroxisome proliferator-activated receptor alpha (PPARalpha) as the mediator … - Full text - MIT Libraries
DA Pan, MK Mater, AP Thelen, JM Peters, FJ … - J Lipid Res, 2000 - jlr.org
... regions (Fig 4b), a USF region binding E-box-related proteins like USF1 and USF2
and ... An alternative explanation for the WY14,643 effect on L-PK may rest in the ...
Cited by 24 - Web Search - jlr.org - ncbi.nlm.nih.gov
Upstream stimulatory factor activates the vasopressin promoter via multiple motifs, including a non- … - Full text - MIT Libraries
JM Coulson, JL Edgson, ZV Marshall-Jones, R … - Biochem. J, 2003 - biochemj.org
... (NRSF / REST) isoforms [10]. In addition, three E-boxes were predicted within
this fragment of ... NRSF/REST in this tumour type [9, 10]. ...
Cited by 6 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Variation in the Lamin A/C Gene - Full text - MIT Libraries
NI Steinle, R Kazlauskaite, IG Imumorin, WC Hsueh, … - Arteriosclerosis, Thrombosis, and Vascular Biology, 2004 - atvbaha.org
... Connell, BD Mitchell, AR Shuldiner, unpublished data, 2004), USF1 (upstream stimulatory ...
sphygmomanometer while the subject was seated after 10 minutes of rest. ...
Cited by 2 - Cached - Web Search - atvb.ahajournals.org - ahavj.ahajournals.org - ncbi.nlm.nih.gov - all 7 versions »
bcn-1 Element-dependent Activation of the Laminin gamma 1 Chain Gene by the Cooperative Action of … - Full text - MIT Libraries
Y Kawata, H Suzuki, Y Higaki, O Denisenko, D … - J Biol Chem, 2002 - jbc.org
... accounting for more than 80% of the transcripts, and the rest are mostly ... Besides
TFE3, this class of transcription factors includes USF1 (37-39), TEFB (40), Mi ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov
507F CLSC 920 E. 58 thSt. Chicago, IL 60637 Ph.(773) 834-1037 FAX (773) 834-0505 - Full text - MIT Libraries
VJ Clark, NJ Cox, M Hammond, CL Hanis, A Di Rienzo … - Hum Genet - genapps.uchicago.edu
... p. 15 shows levels of sequence divergence comparable to those of the rest of the
sequenced ... USF1 and 1 HNF1 binding sites overlapping this 102 bp segment. ...
View as HTML - Web Search
Multiple QTLs Influencing Triglyceride and HDL and Total Cholesterol Levels Identified in Families …
Y Yu, DF Wyszynski, DM Waterworth, SD Wilton, PJ … - jlr.org
... 7q35-q36 (20). A gene for FCHL was localized to chromosome 1q21-q23, and the USF1
gene in ... pressure was measured 3 times after a 5-minute seated rest. ...
Web Search
[BOOK] Mechanisms of Suntanning
MD Publishers, JP Ortonne, R Ballotti - 2002 - print.google.com
... Distributed in the rest of the world by Thomson Publishing Services Cheriton House
North Way Andover, Hampshire SP1 O 5BE, UK Tel.: +44 (0)1 264 332424 E-mail ...
Web Search - Get it from MIT Libraries
The Use of Partial Fatty Acid Oxidation Inhibitors for Metabolic Therapy of Angina Pectoris and … - Full text - MIT Libraries
H Rupp, A Zarain-Herzberg, B Maisch - Herz, 2002 - springerlink.com
... Energy Metabolism of Overloaded Hearts The normal heart derives approximately
60–80% of en- ergy consumed from fatty acids and the rest from glu- cose and ...
Cited by 4 - Web Search - uni-marburg.de - ncbi.nlm.nih.gov
The human beta-globin locus control region - Full text - MIT Libraries
PP Levings, J Bungert - Eur. J. Biochem, 2002 - content.febsjournal.org
... family of proteins and binds to DNA as a heterodimer usually composed of USF1 and
USF2. ... by the fact that even in the absence of an intact LCR, the rest of the ...
Cited by 24 - Cached - Web Search - ejbiochem.org - ingentaconnect.com - batzerlab.lsu.edu - all 8 versions »
Contribution of Sp1 to initiation of transcription of angiotensinogen
B Jochimsen… - springerlink.com
... between genetic variation and physiological change will have to rest on gene ... the
binding activity has biological and immunologi- cal similarity to USF1, a helix ...
Web Search
Cloning and Functional Analysis of the Human IRF-3 Promoter
WJ Lowther, PA Moore, KC Carter, PM Pitha - DNA and Cell Biology, 1999 - dx.doi.org
... been shown to be essential in mediating cell-cycle ar- rest in response ... E-box-bind-
ing protein, TFII-I, that interacts physically and functionally with USF1. ...
Cited by 15 - Web Search - liebertonline.com - liebertonline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Metal-responsive transcription factor-1(MTF-1) is essential for embryonic liver development and … - Full text - MIT Libraries
Y WANG, U Wimmer, P Lichtlen, D Inderbitzin, B … - The FASEB Journal, 2004 - fasebj.org
... 5% CO 2 and the medium was renewed every 24 h. The rest of the ... M., Sawadogo, M.,
Schaffner, W. (2001) The transcription factors MTF-1 and USF1 cooperate to ...
Cited by 5 - Web Search - dx.doi.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Characterization and gene structure of a novel retinoblastoma-protein-associated protein similar to … - Full text - MIT Libraries
YAN Xiumin, X ZHAO, Q Min, N GUO, X GONG, ZHU … - Biochem. J, 2000 - biochemj.org
... TFII-I also interacts directly with various transcription factors such as c-myc
[13], USF1 # 2000 Biochemical Society Page 2. 750 X. Yan and others ...
Cited by 18 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
[BOOK] Molecular Biology of the Toxic Response
A Puga, K Wallace - 1998 - print.google.com
Page 1. MOLECULAR BIOLOGY OF THE TOXIC RESPONSE ThiBOne IUIIIIIIIUIIIIIUIIIIIIII
UIIHIIIU RTWO-U9Z-81BO Page 2. MOLECULAR BIOLOGY OF THE TOXIC R ESPONSE Edited by ...
Cited by 1 - Web Search - Get it from MIT Libraries - Library Search
Genes, Human Diseases and Genome Evolution in the Post-Genomic Era: Insights from Uric Acid …
F Gianfrancesco, T Esposito - Current Genomics, 2005 - ingentaconnect.com
... by higher prevalence of UAN than is seen in the rest of the ... L. Familial combined
hyperlipidemia is associated with upstream transcription factor 1 (USF1). Nat. ...
Web Search
BR22, a novel protein, interacts with thyroid transcription factor-1 and activates the human … - Full text - MIT Libraries
YS Yang, MC Yang, B Wang, JC Weissler - Am J Respir Cell Mol Biol, 2001 - ajrcmb.org
... B message was detected in the lung and H441, while the rest of tissues ... The basic
helix-loop-helix-zipper transcription factor USF1 regulates expression of the ...
Cited by 9 - Web Search - ajrcmb.org - ncbi.nlm.nih.gov
Haplotype structure and phylogenetic shadowing of a hypervariable region in the CAPN10 gene. - Full text - MIT Libraries
VJ Clark, NJ Cox, M Hammond, CL Hanis, A Di Rienzo - Hum Genet, 2005 - springerlink.com
... This segment is present in all other species examined and shows levels of sequence
divergence comparable to those of the rest of the se- quenced region. ...
Web Search - ncbi.nlm.nih.gov
Novel transcription factors in human CD34 antigen-positive hematopoietic cells - Full text - MIT Libraries
I Gomes, TT Sharma, S Edassery, N Fulton, BG Mar, … - Blood, 2002 - bloodjournal.org
... 11p15.1-p14 4.3 L W Hs.227630 REST RE1-silencing transcription factor
4q12-q13.3 4.3 L W Hs.21704 TCF12 Transcription factor 12 ...
Cited by 3 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 7 versions »
PROSTATIC GENE EXPRESSION: PROBASIN, HUMAN PROSTATIC ACID PHOSPHATASE AND MACROPHAGE INHIBITORY …
B Oulu - herkules.oulu.fi
... A 32 amino acid signal sequence and the first eight amino acids of the protein are
encoded by exon 1, and the rest of the coding region and the 3-untranslated ...
View as HTML - Web Search
Chromium (VI) Down-regulates Heavy Metal-induced Metallothionein Gene Transcription by Modifying … - Full text - MIT Libraries
S Majumder, K Ghoshal, D Summers, S Bai, J Datta, … - J Biol Chem, 2003 - jbc.org
... Besides MTF1, several other transcription factors like Sp1, USF1, glucocorticoid
receptor, STAT3 ... finger domain in the MTF1 fusion proteins, as the rest of the ...
Cited by 3 - Web Search - dx.doi.org - ncbi.nlm.nih.gov
THE ROLE OF PU. 1 IN B-LYMPHOCYTE DEVELOPMENT AND FUNCTION
S RAO, MC SIMON - doi.wiley.com
... Btk AAAGGGAACTGA C/EBP, E-box, Sp1 Himmelmann et al., 1996; Muller et al., 1996
CD20 TTTCAAGAAGTGAAACCTGG Pip, USF1 Himmelmann et al., 1997 ...
Web Search
Topics in Xenobiochemistry Receptor-dependent transcriptional activation of cytochrome P4503A genes: …
xenobiotica, 2002 - dx.doi.org
... CYP3A5 has been detected in a statistically higher percentage of children and
adolescents compared with the rest of the population and also in one of 10 human ...
Cited by 37 - ingentaconnect.com - ncbi.nlm.nih.gov - csa.com - Get it from MIT Libraries
The role of a Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription … - Full text - MIT Libraries
C Ring, S Ogata, L Meek, J Song, T Ohta, K … - Genes & Development, 2002 - genesdev.org
... Fig. 5D). Interestingly, the rest of the axial structures and mesoderm
patterning was not affected at lower concentrations. The ...
Cited by 6 - Web Search - genesdev.org - pubmedcentral.nih.gov - dx.doi.org - all 7 versions »
Clontechniques
CPA II, BD In-Fusion, PCRC Kit - bdbiosciences.com
... New Products Page 6. Design your own BD Atlas™ Array on-line and let our experts
do the rest 4 New Products BD Biosciences Clontech • www.bdbiosciences.com ...
View as HTML - Web Search - ebiotrade.com - clontech.com
Clontechniques Canada
CPA II, BD In-Fusion, PCRC Kit - bdbiosciences.ca
... Page 6. Design your own BD Atlas™ Array on-line and let our experts do the rest
BD Atlas ™ Custom Array Printing Services Design your Custom Array ...
View as HTML - Web Search
[BOOK] Exclusion of Black Soldiers from the Medal of Honor in World War II: The Study Commissioned by the …
EV Converse, DK Gibran, JA Cash, RH Kohn, RK … - 1997 - print.google.com
Page 1. The Exclusion ofBlack Soldiers from the Medal of Honor in World War II -
s .. p —i ELLIOT!' V. CONVERSE III . DANIEL K. GIBRAN JOHN A. CASH ...
Web Search - Get it from MIT Libraries - Library Search
Bibliography Current World Literature
S Al Ruzzeh, G Asimakopoulos, G Ambler… - Current Opinion in Cardiology, 2005 - co-cardiology.com
... to exercise electrocardiographic testing added to echocardiography at rest for risk ...
hyperlipidemia is associated with upstream transcription factor 1 (USF1). ...
Web Search
Sources of salinity in the Rio Grande and Mesilla Basin groundwater
JC Witcher, JP King, JW Hawley, JF Kennedy, J … - 2004 - wrri.nmsu.edu
Page 1. FEBRUARY 2004 SOURCES OF SALINITY IN THE RIO GRANDE AND MESILLA
BASIN GROUNDWATER WRRI Technical Completion Report No. 330 ...
Cited by 2 - View as HTML - Web Search - Library Search
DNA bending and wrapping around RNA polymerase: a'revolutionary' model describing transcriptional … - Full text - MIT Libraries
B Coulombe, ZF Burton - Microbiology and Molecular Biology Reviews, 1999 - mmbr.asm.org
MMBR Search for figures and tables Home Help [Feedback] [For Subscribers]
[Archive] [Search] [Contents] Abstract of this Article ( ). ...
Cited by 41 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - csa.com - all 5 versions »
DNA Bending and Wrapping around RNA Polymerase: a “Revolutionary” Model Describing …
HAMRNA POLYMERASES, T MECHANISM, TT FACTORS - www-lehre.img.bio.uni-goettingen.de
Page 1. M ICROBIOLOGY AND M OLECULAR B IOLOGY R EVIEWS , 1092-2172/99/$04.00
0 June 1999, p. 457–478 Vol. 63, No. 2 Copyright © 1999 ...
View as HTML - Web Search - biology.ualberta.ca - gaea.bch.msu.edu - bch.msu.edu - all 5 versions »
Did you mean to search for: REST and US F1
| |
©2005 Google