![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 15 of 15 for RFX1 and NF1. (0.07 seconds) |
Einfluss exogener Faktoren auf die Transkriptionsregulation des Hepatitis B Virus
N Fiedler - bibl7.hrz.uni-giessen.de
... HNF-3 RFX1 1180 1210 GCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGG NF1 HNF-3
AP1; C/EBP ATF2; CREB 1240 1375 CTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTTTCGGCTCCTC ...
View as HTML - Web Search - geb.uni-giessen.de - bibd.uni-giessen.de - deposit.ddb.de
Regulatory elements of hepatitis B virus transcription - Full text - MIT Libraries
N Moolla, M Kew, P Arbuthnot - Journal of Viral Hepatitis, 2002 - blackwell-synergy.com
... activity. The central core domain of enhancer I has motifs for binding
HNF-3, RFX1, EF-C and NF1 transcription factors [33-35]. ...
Cited by 6 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Aus dem Heinrich-Pette-Institut fuer experimentelle Virologie und Immunologie Hamburg
PDDM Sterneck, S von Hepatitis-B-Virusvarianten, J … - sub.uni-hamburg.de
Page 1. 1 Aus dem Heinrich-Pette-Institut für experimentelle Virologie und
Immunologie Hamburg PD. Dr. Martina Sterneck Sequenzanalysen ...
View as HTML - Web Search - deposit.ddb.de
Cloning and characterization of the 5-flanking region of the rat glutamate-cysteine ligase catalytic … - Full text - MIT Libraries
Y Heping, W Jiaohong, ZZ HUANG, OU Xiaopeng, C … - Biochem. J, 2001 - biochemj.org
... the AP-4 site, whereas oligonucleotide 2, which spans the RFX1 (regulatory factor ...
intensity in the presence of oligonucleotide 4, which spans the NF1 site, the ...
Cited by 9 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
p 53 binds and represses the HBV enhancer: an adjacent enhancer element can reverse the … - Full text - MIT Libraries
A Ori, A Zauberman, G Doitsh, N Paran, M Oren, Y … - The EMBO Journal, 1998 - embojournal.npgjournals.com
... Two proteins are known to associate with the EP elements: RFX1, an evolutionarily ...
Enhancer mutants that do not bind the corresponding EP and NF1 proteins were ...
Cited by 40 - Web Search - emboj.org - weizmann.ac.il - wwwlib.bionet.nsc.ru - all 7 versions »
RFX 1, a Single DNA-binding Protein with a Split Dimerization Domain, Generates Alternative … - Full text - MIT Libraries
Y Katan-Khaykovich, Y Shaul - J Biol Chem, 1998 - intl.jbc.org
... and 16-19) unlabeled competitor DNA, 20 ng of the heterologous NF1-b competitor ... Complex
a* Formation by Overexpressed RFX1-- Complex a* was further analyzed by ...
Cited by 12 - Web Search - jbc.org - jbc.org - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... NF1 NFY 490.5 Oct-1 TCF11 123.3 MEF2 TATA 45.9 ELK1 SP1 24.6 ... NFAT NFKAPPAB65
431.3 NFAT YY1 111.4 MYB RFX1 43.7 CEBP RORA2 23.8 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... 2 MINI20 B Muscle initiator sequence-20 MUSCLE INI B Muscle initiator NF1 Q6 Nuclear ...
MIF1 01 MIBP-1/RFX1 complex Core should be GTAAC not GTAA and there might ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
The Epstein-Barr virus promoter initiating B-cell transformation is activated by RFX proteins and … - Full text - MIT Libraries
R Tierney, H Kirby, J Nagra, A Rickinson, A Bell - J. Virol, 2000 - jvi.asm.org
... in vivo; the consensus motif of RFX5 is related to that of RFX1 to -3 but ... binding
to HBV enh-I include ubiquitously expressed RFX, CREB, and NF1 proteins, plus ...
Cited by 15 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Hepatitis B virus genomes of patients with fulminant hepatitis do not share a specific mutation - Full text - MIT Libraries
M Sterneck, S Gunther, T Santantonio, L Fischer, … - Hepatology, 1996 - doi.wiley.com
... None of them were located within the C/EBP, NF1, HNF3, HNF4, RXR, PPAR, AP1,
EF-C:RFX1, Sp1, and TBP Kunitz domain-like region believed to be important for its ...
Cited by 39 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Functional characterization of the interferon regulatory element in the enhancer 1 region of the … - Full text - MIT Libraries
FF Alcantara, H Tang, A McLachlan - Nucleic Acids Research, 2002 - nar.oupjournals.org
... The locations of the C/EBP (61), p53 (52), NF1 (50,51), IRF (25), HNF3 (62,63),
HNF4 (64), RXR:PPAR (64–66), COUPTF (45,64), RFX1 (64,67,68), AP1 (51), CREB ...
Cited by 5 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Cellular factors controlling the activity of woodchuck hepatitis virus enhancer II - Full text - MIT Libraries
K Ueda, Y Wei, D Ganem - J. Virol, 1996 - jvi.asm.org
... Major roles for cellular transcription factors RF-X, NF1, HNF3, HNF4, and C/EBP
at En I have been defined both genetically and biochemically (15, 35–37, 48 ...
Cited by 12 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
EN Voronina, TD Kolokol’tsova, EA Nechaeva, ML … - MOLECULAR BIOLOGY, 2003 - kluweronline.com
... More recently, TF interacting with the promoters of these genes were identified
as RFX1 (factor α) [39], GABP (factor δ) [40], and YY1 ... GABP NF1 tctcttcct ...
Web Search - springerlink.com - ingentaconnect.com - Get it from MIT Libraries
Imprinting mechanisms - Full text - MIT Libraries
M Constancia, B Pickard, G Kelsey, W Reik - Genome Res, 1998 - genome.org
... These include Sp1, MTF-1, Krox-20, CTF/NF1, and TCR-ATF. ... dependent activator protein
is binding to the paternal DMRs (acting in the same way as RFX1/RFX2/RFX3 ...
Cited by 122 - Web Search - genome.org - ncbi.nlm.nih.gov
Plenary Talk P01: Experience-dependent modification of neural circuits–cellular and molecular … - Full text - MIT Libraries
MM Poo - Journal of Neurochemistry - blackwell-synergy.com
... USA Benign peripheral nerve tumors called neurofibromas are a major source of morbidity
for patients with the inherited disease neurofibro- matosis type 1 (NF1 ...
Web Search - blackwell-synergy.com
| |
©2005 Google