![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 63 for RFX1 and SP1. (0.23 seconds) |
Differential regulation of hepatitis B virus gene expression by the Sp1 transcription factor - Full text - MIT Libraries
J Li, JH Ou - J Virol, 2001 - jvi.asm.org
... These factors include liver-enriched factors such as HNF1, HNF3, and C/EBP and
ubiquitous factors such as Sp1, RFX1, NF-Y, and AP1 (4, 7, 15-19, 22, 24, 25, 30 ...
Cited by 5 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Transcription factors RFX1/EF-C and ATF-1 associate with the adenovirus E1A-responsive element of … - Full text - MIT Libraries
C Labrie, BH Lee, MB Mathews - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... B, Emery P, David E, Hearing P, Mach B, Reith W. RFX1 is identical to ... [PubMed]; Seto
E, Lewis B, Shenk T. Interaction between transcription factors Sp1 and YY1. ...
Cited by 11 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
RFX1 and NF-1 associate with P sequences of the human growth hormone locus in pituitary chromatin - Full text - MIT Libraries
LD Norquay, X Yang, P Sheppard, S Gregoire, JG … - Mol Endocrinol, 2003 - mend.endojournals.org
... including one derived from Pit-1 and Sp1 binding in the GH-N proximal promoter region
[20, 21]. This suggests that when RFX1 is competed, the binding of NF-1 ...
Cited by 6 - Web Search - mend.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Hepatitis B virus genomes of patients with fulminant hepatitis do not share a specific mutation - Full text - MIT Libraries
M Sterneck, S Gunther, T Santantonio, L Fischer, … - Hepatology, 1996 - doi.wiley.com
... None of them were located within the C/EBP, NF1, HNF3, HNF4, RXR, PPAR, AP1,
EF-C:RFX1, Sp1, and TBP Kunitz domain-like region believed to be important for its ...
Cited by 39 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cloning and characterization of mCRIP 2, a mouse LIM-only protein that interacts with PDZ domain IV … - Full text - MIT Libraries
M van Ham, H Croes, J Schepens, J Fransen, B … - Genes to Cells, 2003 - genestocellsonline.org
... AP1,AP4, E2F, RFX1 and SP1, are present in addition to multiple targets for
transcription factors that are found in muscle, brain and/or haematopoietic cells ...
Cited by 4 - Web Search - blackwell-synergy.com - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Einfluss exogener Faktoren auf die Transkriptionsregulation des Hepatitis B Virus
N Fiedler - bibl7.hrz.uni-giessen.de
... Yu and Mertz, 1997) noch weitere wie zB für Sp1 (SV40 promotor protein 1), HNF-3 ...
1150 CCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCAACG HNF-3 RFX1 1180 1210 ...
View as HTML - Web Search - geb.uni-giessen.de - bibd.uni-giessen.de - deposit.ddb.de
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... NF1 NFY 490.5 Oct-1 TCF11 123.3 MEF2 TATA 45.9 ELK1 SP1 24.6 ... NFAT NFKAPPAB65
431.3 NFAT YY1 111.4 MYB RFX1 43.7 CEBP RORA2 23.8 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
Role for RFX Transcription Factors in Non-neuronal Cell-specific Inactivation of the Microtubule- … - Full text - MIT Libraries
A Nakayama, H Murakami, N Maeyama, N Yamashiro, A … - J Biol Chem, 2003 - jbc.org
... RFX1 and p107 has not been ascertained (36). p107, best known as the corepressor
for E2F-dependent transcription, has also been reported to associate with Sp1 ...
Cited by 2 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Aus dem Heinrich-Pette-Institut fuer experimentelle Virologie und Immunologie Hamburg
PDDM Sterneck, S von Hepatitis-B-Virusvarianten, J … - sub.uni-hamburg.de
Page 1. 1 Aus dem Heinrich-Pette-Institut für experimentelle Virologie und
Immunologie Hamburg PD. Dr. Martina Sterneck Sequenzanalysen ...
View as HTML - Web Search - deposit.ddb.de
receptor b-chain gene (IL-2Rb) - Full text - MIT Libraries
EK Codias, F Olosz, TR Malek - Immunogenetics, 2000 - springerlink.com
... growth factor-induced protein A (NGFIA) site, has been shown to bind Sp1, Sp3, and ...
shown), myeloid zinc finger 1 (MZF1), and X-box-binding pro- tein RFX1 (Fig. ...
Web Search
RFX2 is a potential transcriptional regulatory factor for histone H1t and other genes expressed …
RFXED SPERMATOGENESIS - biolreprod.org
... (Fig 2A, lanes 7-9). As a control, a 100-fold excess of an unrelated oligo containing
the Sp1 ... RFX1,2,3 respectively (SWISS-PROT P48377, P48379, P48381). ...
Web Search
The RFX family interacts at the collagen (COL1A2) start site and represses transcription - Full text - MIT Libraries
PK Sengupta, J Fargo, BD Smith - J. Biol. Chem, 2002 - jbc.org
... Smad3 interacts cooperatively with the co-activator CBP/p300 and Sp1 (22-24 ... responsive
binding site for regulatory factor for X-box 1 (RFX1, also referred to as ...
Cited by 14 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Interaction of the Human NF-kappa B p 52 Transcription Factor with DNA-PNA Hybrids Mimicking the NF- … - Full text - MIT Libraries
C Mischiati, M Borgatti, N Bianchi, C Rutigliano, … - J Biol Chem, 1999 - jbc.org
... oligonucleotides to RFX1, in addition to a block of activation of RFX1-regulated
genes ... 1) or the Sp1 (the plus strand sequence was 5'-GAGGCGTGGC-3') binding ...
Cited by 29 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Full Text View - Full text - MIT Libraries
GC Horvath, WS Kistler, MK Kistler - Biology of Reproduction - bioone.org
... factor for the CCTAGG palindrome motif that lies between the Sp1 and CCAAT ... additional
RFX-related binding proteins and that a prominent RFX1 heterodimer also ...
Web Search - bioone.org
Molecular interactions with nuclear factor kappaB(NF-kappaB) transcription factors of a PNA-DNA … - Full text - MIT Libraries
A Romanelli, C Pedone, M Saviano, N Bianchi, M … - European Journal of Biochemistry, 2001 - content.febsjournal.org
... well-characterized disorders [1-9]. Decoy molecules against HNF-1, RFX1, NFYB, E2F,
CRE and Sp1 were found to alter specific functions in eukaryotic cells [7-11 ...
Cited by 2 - Cached - Web Search - ejbiochem.org - blackwell-synergy.com - ncbi.nlm.nih.gov - all 7 versions »
In Vivo Footprinting of the Human 11 beta-Hydroxysteroid Dehydrogenase Type 2 Promoter - Full text - MIT Libraries
AR Nawrocki, CE Goldring, RM Kostadinova, FJ Frey, … - J. Biol. Chem, 2002 - jbc.org
... 11. EMSA analysis of Sp1 motifs in the upstream regions. ... weak binding activity was
found using the GSIV probe covering an Ikaros-2 and a RFX1 consensus motif ...
Cited by 10 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
In vivo regulation of hepatitis B virus replication by peroxisome proliferators - Full text - MIT Libraries
LG Guidotti, CM Eggers, AK Raney, SY Chi, JM … - J. Virol, 1999 - pubmedcentral.nih.gov
... X receptor α (RXRα), and peroxisome proliferator-activated receptor α (PPARα), and
ubiquitous transcription factors including Sp1 and RFX1 have been shown ...
Cited by 11 - Web Search - ncbi.nlm.nih.gov
Structural organization and chromosomal localization of the human ribosomal protein L9 gene
K Mazuruk, TJ Schoen, GJ Chader, T Iwata, IR … - Biochim Biophys Acta, 1996 - ncbi.nlm.nih.gov
... including Sp1 sites, CACCC boxes, inverted CCAAT boxes, and GATA elements. Another
possible element of interest in the rpL9 5' flanking region is RFX1 also ...
Cited by 8 - Web Search - Get it from MIT Libraries
Regulation of matrix biosynthesis and degradation in systemic sclerosis
RL Widom - Curr Opin Rheumatol, 2000 - co-rheumatology.com
... demonstrated direct interaction between the p65 NF-κB subunit and Sp1 in NIH3T3 ... 7
of the α2(I) collagen gene that binds a nuclear factor known as MDBP/RFX1. ...
Cited by 7 - Web Search - co-rheumatology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Biospecific interaction analysis (BIA) as a tool for the design and development of gene …
R Gambari - Curr. Med. Chem.–Anti-Cancer Agents, 2001 - ingentaconnect.com
... Decoy molecules against other transcription factors (HNF-1, RFX1, NFYB, E2F) were
found to alter ... 20], Ets-1 [21], Id-1 [22], AP-1 [23, 24] and Sp1 [25] cancer ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Interaction of the Human NF-B p52 Transcription Factor with DNA-PNA Hybrids Mimicking the NF-B …
C Mischiati, M Borgatti, N Bianchi, C Rutigliano, … - jbc.org
... oligonucleotides to RFX1, in addition to a block of activation of RFX1-regulated
genes ... 1) or the Sp1 (the plus strand sequence was 5 -GAGGCGTGGC-3 ) binding ...
Cited by 2 - Web Search
Transcription Factor Decoy Molecules Based on a Peptide Nucleic Acid(PNA)-DNA Chimera Mimicking Sp 1 … - Full text - MIT Libraries
M Borgatti, I Lampronti, A Romanelli, C Pedone, M … - J Biol Chem, 2003 - jbc.org
... B superfamily, decoy molecules for other target transcription factors, such as
HNF-1, RFX1, nuclear factor YB, E2F, cAMP-response element, and Sp1, were found ...
Cited by 15 - Web Search - jbc.org - ncbi.nlm.nih.gov
Molecular interactions between nuclear factor kB (NF-kB) transcription factors and a PNA-DNA chimera … - Full text - MIT Libraries
A Romanelli, C Pedone, M Saviano, N Bianchi, M … - Eur J Biochem, 2001 - ingentaconnect.com
... disorders [1–9]. Decoy molecules against HNF-1, RFX1, NFYB, E2F, CRE and Sp1 were
found to alter specific functions in eukaryotic cells [7–11]. ...
Cited by 10 - Web Search
Regulatory elements of hepatitis B virus transcription - Full text - MIT Libraries
N Moolla, M Kew, P Arbuthnot - Journal of Viral Hepatitis, 2002 - blackwell-synergy.com
... domain of enhancer I has motifs for binding HNF-3, RFX1, EF-C and ... transcription factor)
HFL (hepatocyte leukaemia factor), E4BP4 (aC/EBP-like protein) and Sp1. ...
Cited by 6 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Regulatory factor X 2(RFX 2) binds to the H 1 t/TE 1 promoter element and activates transcription of … - Full text - MIT Libraries
SA Wolfe, DC Wilkerson, S Prado, SR Grimes - Journal of Cellular Biochemistry, 2004 - doi.wiley.com
... Neither RFX1 nor RFX3 down-regulate promoter activity in neuronal cells ... It is
interesting that Sp1 and Sp3 can bind to the GC-box located between and partially ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Nfkbie, Nfkbil1, P300-ESTs, Raf1, Rel, Rela, Relb, Runx1, Runx2, Sp1, Sp3, Srf ... Igfbp3,
Igsf6, Itgb5, Itgb7, Ivl, Myf5, Ncam1, Nos2, Orm1, Pin1, Rfx1, Rfx2, Rfx3 ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... NFKBIE, NFKBIL1, NFKBIL2, NFRKB, RAF1, REL, RELA, RELB, RUNX1, RUNX2, SP1, SP3,
SRF ... ITGB5, ITGB7, IVL, MGC27165, MYF5, NCAM1, NOS2A, ORM1, PIN1, RFX1, RFX2, RFX3 ...
View as HTML - Web Search - eurogentec.com
In Vivo Regulation of Hepatitis B Virus Replication by Peroxisome Proliferators dagger
LG Guidotti, CM Eggers, AK Raney, SY Chi, JM … - jvi.asm.org
... receptor (PPAR ), and ubiquitous transcription factors including Sp1 and RFX1 have
been shown to modulate nucleocapsid promoter activity in cell culture (2, 13 ...
Web Search - jvi.asm.org
Characterization of a major histocompatibility complex class II X-box-binding protein enhancing tat- … - Full text - MIT Libraries
C Mischiati, G Feriotto, M Borgatti, P Giacomini, … - J. Virol, 2000 - jvi.asm.org
... with several well-characterized transcription factors, including RFX, RFX1, NF-X ...
by incubation of the footprinting probe with recombinant Sp1 protein (Fig. ...
Cited by 8 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Combinatorial Complexity of 5' Alternative Acetylcholinesterase Transcripts and Protein Products - Full text - MIT Libraries
E Meshorer, D Toiber, D Zurel, I Sahly, A Dori, E … - Journal of Biological Chemistry - jbc.org
... zinc finger 1; RREB1, Ras-responsive element binding 1; SP1, specificity protein
1 ... leukemia 1; ATF6, activating transcription factor 6; RFX1, regulatory factor ...
Cited by 4 - Web Search - jbc.org - ncbi.nlm.nih.gov
BMC Evolutionary Biology - Full text - MIT Libraries
RP Perry - BMC Evolutionary Biology, 2005 - bmc.ub.uni-potsdam.de
... sites for RFX1 and the Gamma Factor as well as the GABP and YY1 sites. In addition
to the conserved sites, a few non conserved (unaligned) GABP and Sp1 sites ...
View as HTML - Web Search
Leptin promoter mutations affect leptin levels and performance traits in dairy cows 1 - Full text - MIT Libraries
SC Liefers, RF Veerkamp, MFW te Pas, C Delavaud, Y … - Animal Genetics, 2005 - blackwell-synergy.com
... functional transcription factor binding domains in the leptin promoter (C/EBP, SP1,
LP1 and ... binding site for NFY and CAAT whereas SNP 415 binds NFAT and RFX1. ...
Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
The architecture of mammalian ribosomal protein promoters - Full text - MIT Libraries
R Perry, FCC Center - BMC Evolutionary Biology, 2005 - biomedcentral.com
... sites for RFX1 and the Gamma Factor as well as the GABP and YY1 sites. In addition
to the conserved sites, a few non conserved (unaligned) GABP and Sp1 sites ...
View as HTML - Web Search - citebase.eprints.org - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
The architecture of mammalian ribosomal protein promoters - Full text - MIT Libraries
S Material, R Perry - BMC Evol Biol, 2005 - pubmedcentral.nih.gov
... sites for RFX1 and the Gamma Factor as well as the GABP and YY1 sites. In addition
to the conserved sites, a few non conserved (unaligned) GABP and Sp1 sites ...
Web Search
Regulation of MHC class I and II gene transcription: differences and similarities - Full text - MIT Libraries
PJ van den Elsen, SJP Gobin, MCJA van Eggermond, A … - Immunogenetics, 1998 - springerlink.com
... The possible in- teraction of NF-kB and Sp1 would explain the NF-kB- mediated
activation of the ... To date this family comprises at least five members (RFX1-RFX5 ...
Cited by 49 - Web Search - ncbi.nlm.nih.gov
The TATA-containing core promoter of the type II collagen gene (COL2A1) is the target of interferon- … - Full text - MIT Libraries
M Osaki, L Tan, BK Choy, Y Yoshida, KS Cheah, PE … - Biochem. J, 2003 - biochemj.org
... p300 by Stat1α could block interactions with constitutive factors such as Sp1 and
thereby ... binding of the regulatory factor for X-box proteins 1 (RFX1) to the ...
Cited by 15 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
TranSignal TM GR-TF Interaction Arrays
PU Manual - panomics.com
... AP-1 (1) AP-1 (1) CREB (1) CREB (1) GA T A GA T A NF A T c NF A T c Pit 1 Pit 1
Sp1 Sp1 TR TR 1 AP-1 (1) AP-1 (1) CREB (1) CREB (1) GA T A GA T A NF A T c NF A ...
View as HTML - Web Search - biocat.de
Transcriptional regulation of human excitatory amino acid transporter 1 (EAAT1): cloning of the EAAT … - Full text - MIT Libraries
SY Kim, SY Choi, W Chao, DJ Volsky - J. Neurochem, 2003 - blackwell-synergy.com
... the presence of seven sites that could potentially bind transcription factors,
including a GC-box for Sp1 and Sp-like factors; X-box for protein RFX1 and sites ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Major Histocompatibility Class II Transactivator (CIITA) Mediates Repression of Collagen (COL1A2) … - Full text - MIT Libraries
Y Xu, L Wang, G Buttice, PK Sengupta, BD Smith - J. Biol. Chem, 2004 - jbc.org
... monoclonal anti- actin (1:1000) (Sigma), monoclonal anti-FLAG (1:1000) (Sigma),
polyclonal anti-RFX5 (194, 1:1000) (Rockland), or polyclonal anti-RFX1 (1:100 ...
Cited by 1 - Web Search - jbc.org
TranSignal TM Protein/DNA Arrays
PU Manual, MA MA1014 - panomics.com
... AP-1 (1) AP-1 (1) CREB (1) CREB (1) GA T A GA T A NF A T c NF A T c Pit 1 Pit 1
Sp1 Sp1 TR TR 1 AP-1 (1) AP-1 (1) CREB (1) CREB (1) GA T A GA T A NF A T c NF A ...
View as HTML - Web Search - biocat.de
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... GTAAA not GTAA MIF1 01 MIBP-1/RFX1 complex Core should be GTAAC not GTAA
and there might be another core of GTT upstream. XFD3 01 ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Imprinting mechanisms - Full text - MIT Libraries
M Constancia, B Pickard, G Kelsey, W Reik - Genome Res, 1998 - genome.org
... These include Sp1, MTF-1, Krox-20, CTF/NF1, and TCR-ATF. ... dependent activator protein
is binding to the paternal DMRs (acting in the same way as RFX1/RFX2/RFX3 ...
Cited by 122 - Web Search - genome.org - ncbi.nlm.nih.gov
Solution NMR structure of the C-terminal domain of the human protein DEK - Full text - MIT Libraries
M Devany, NP Kotharu, H Matsuo - Protein Science, 2004 - protsci.highwire.org
... A cooperative interaction between NF- B and Sp1 is required for HIV-1 enhancer ... RFX1
is identical to enhancer factor C and functions as a transactivator of the ...
Cited by 1 - Cached - Web Search - proteinscience.org - cbs.umn.edu - dx.doi.org - all 10 versions »
Ribosomal protein S19 expression during erythroid differentiation - Full text - MIT Libraries
L Da Costa, G Narla, TN Willig, LL Peters, M Parra … - Blood, 2003 - bloodjournal.org
... At least 6 potential SP1 binding motifs are present in the human RPS19 gene ...
Transcription factor RFX1 helps control the promoter of the mouse ribosomal protein ...
Cited by 10 - Web Search - bloodjournal.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Transcriptional activation of the testis-specific histoneH 1 t gene by RFX 2 may require both … - Full text - MIT Libraries
SR Grimes, S Prado, SA Wolfe - Journal of Cellular Biochemistry, 2005 - doi.wiley.com
... Locations of human and mouse genes encoding the RFX1 and RFX2 transcription factor
proteins. ... Sp1-mediated transcriptional activation is repressed by Sp3. ...
Web Search - ncbi.nlm.nih.gov
Interaction between STAT-3 and HNF-3 leads to the activation of liver-specific hepatitis B virus … - Full text - MIT Libraries
G Waris, A Siddiqui - J Virol, 2002 - jvi.asm.org
... Stat1 depends on transcriptional synergy with Sp1. ... The Myc intron-binding polypeptide
associates with RFX1 in vivo and binds to the major histocompatibility ...
Cited by 8 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov - all 5 versions »
Analysis of the defect in IFN-gamma induction of MHC class II genes in G1B cells: identification of … - Full text - MIT Libraries
WJ Brickey, KL Wright, XS Zhu, JP Ting - J. Immunol, 1999 - jimmunol.org
... line SJO (25). RFX5 belongs to a family of novel DNA binding proteins,
including among its members RFX1 to RFX4 (29). This family ...
Cited by 16 - Web Search - jimmunol.org - jimmunol.org - ncbi.nlm.nih.gov - all 6 versions »
Analysis of the Defect in IFN-Induction of MHC Class II Genes in G1B Cells: Identification of a … - Full text - MIT Libraries
WJ Brickey, KL Wright, XS Zhu, PYT Jenny - Immunology, 1999 - jimmunol.org
... 25). RFX5 belongs to a family of novel DNA binding pro- teins, including
among its members RFX1 to RFX4 (29). ... RFX1 Human . . ...
Web Search
Proliferating cell nuclear antigen(PCNA): ringmaster of the genome - Full text - MIT Libraries
T Paunesku, S Mittal, M Proti& x 00107, J Oryhon, … - International Journal of Radiation Biology, 2001 - dx.doi.org
... response element binding protein), GATA (enhancer binding protein), Sp1 (transcription
factor Sp1), AP-1 ... hepatitis B-virus enhancer-associated protein RFX1 ...
Cited by 30 - Web Search - taylorandfrancis.metapress.com - ingentaconnect.com - life.nthu.edu.tw - all 5 versions »
Organization of the Human tarbp 2 Gene Reveals Two Promoters That Are Repressed in an Astrocytic … - Full text - MIT Libraries
S Bannwarth, L Talakoub, F Letourneur, M Duarte, … - J Biol Chem, 2001 - jbc.org
... Computer sequence predictions also identified binding sites for Sp1, AP1, AP2, AP4,
NFAT, MZF-1, RFX1, NFY, CREB, and GATA transcription factors (Fig. ...
Cited by 6 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
|
©2005 Google