![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 23 of 23 for RFX1 and YY1. (0.06 seconds) |
Transcription factors RFX1/EF-C and ATF-1 associate with the adenovirus E1A-responsive element of … - Full text - MIT Libraries
C Labrie, BH Lee, MB Mathews - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... that the hepatitis B virus enhancer-associated protein RFX1 constitutes a major ... The
transcription factor YY1 associates with the initiator element of the PCNA ...
Cited by 11 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... NFAT NFKAPPAB65 431.3 NFAT YY1 111.4 MYB RFX1 43.7 CEBP RORA2 23.8 ... MYOD
TAL1ALPHAE47 313.3 CEBPB YY1 88.8 ER P300 38.1 AP4 RFX1 22.6 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
The Epstein-Barr virus promoter initiating B-cell transformation is activated by RFX proteins and … - Full text - MIT Libraries
R Tierney, H Kirby, J Nagra, A Rickinson, A Bell - J. Virol, 2000 - jvi.asm.org
... in the relevant binding reactions: a rabbit polyclonal antibody against YY1 (C-20 ...
Antisera against RFX1, RFX3, and RFX5 were kindly provided by Walter Reith ...
Cited by 15 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Adenoviral E1A: everlasting tool, versatile applications, continuous contributions and new …
N Sang, J Caro, A Giordano - Front. Biosci, 2002 - xylian.igh.cnrs.fr
... E1A functionally and physically interacts with YY1 and releases YY1-mediated
transcriptional ... of the human PCNA promoter revealed the involvement of RFX1/EF-C ...
Cited by 9 - Cached - Web Search - bioscience.org - bioscience.org - ncbi.nlm.nih.gov - all 7 versions » - Get it from MIT Libraries
Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
EN Voronina, TD Kolokol’tsova, EA Nechaeva, ML … - MOLECULAR BIOLOGY, 2003 - kluweronline.com
... More recently, TF interacting with the promoters of these genes were identified
as RFX1 (factor α) [39], GABP (factor δ) [40], and YY1 (factor β) [41]. ...
Web Search - springerlink.com - ingentaconnect.com - Get it from MIT Libraries
GEArray S Series Mouse Autoimmune and Inflammatory Response Gene Array: AR-SAMM-602.3
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.com
... Raf1, Rel, Rela, Relb, Runx1, Runx2, Sp1, Sp3, Srf, Stat1, Stat4, Stat6, Tcfcp2,
Yy1. ... Igsf6, Itgb5, Itgb7, Ivl, Myf5, Ncam1, Nos2, Orm1, Pin1, Rfx1, Rfx2, Rfx3 ...
View as HTML - Web Search - eurogentec.be
GEArray S Series Human Autoimmune and Inflammatory Response Gene Array: AR-SAHS-602
FG Grouping, A Proteins, CS Receptors, ST Proteins … - eurogentec.be
... REL, RELA, RELB, RUNX1, RUNX2, SP1, SP3, SRF, STAT1, STAT4, STAT6, TFCP2, YY1. ... ITGB5,
ITGB7, IVL, MGC27165, MYF5, NCAM1, NOS2A, ORM1, PIN1, RFX1, RFX2, RFX3 ...
View as HTML - Web Search - eurogentec.com
Einfluss exogener Faktoren auf die Transkriptionsregulation des Hepatitis B Virus
N Fiedler - bibl7.hrz.uni-giessen.de
... 1150 CCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCAACG HNF-3 RFX1 1180 1210
GCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGG NF1 HNF-3 AP1; C/EBP ATF2; CREB ...
View as HTML - Web Search - geb.uni-giessen.de - bibd.uni-giessen.de - deposit.ddb.de
The architecture of mammalian ribosomal protein promoters - Full text - MIT Libraries
S Material, R Perry - BMC Evol Biol, 2005 - pubmedcentral.nih.gov
... mouse rpL30 gene [11] are all conserved in the human orthologue (panel b). This
includes sites for RFX1 and the Gamma Factor as well as the GABP and YY1 sites. ...
Web Search
BMC Evolutionary Biology - Full text - MIT Libraries
RP Perry - BMC Evolutionary Biology, 2005 - bmc.ub.uni-potsdam.de
... mouse rpL30 gene [11] are all conserved in the human orthologue (panel b). This
includes sites for RFX1 and the Gamma Factor as well as the GABP and YY1 sites. ...
View as HTML - Web Search
The architecture of mammalian ribosomal protein promoters - Full text - MIT Libraries
R Perry, FCC Center - BMC Evolutionary Biology, 2005 - biomedcentral.com
... panel b). This includes sites for RFX1 and the Gamma Factor as well as the
GABP and YY1 sites. In addition to the conserved sites, a ...
View as HTML - Web Search - citebase.eprints.org - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
... stimulating factor VMAF 01 v-Maf XBP1 01 X-box-binding protein 1 YY1 01 Yin and ... MIF1
01 MIBP-1/RFX1 complex Core should be GTAAC not GTAA and there might be ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
TranSignal TM GR-TF Interaction Arrays
PU Manual - panomics.com
Page 1. TranSignal TM GR-TF Interaction Arrays GR-TFCat. # MA5061, MA5062 &
MA5063 Product User Manual Released 07/29/04 Panomics, Inc. ...
View as HTML - Web Search - biocat.de
TranSignal TM Protein/DNA Arrays
PU Manual, MA MA1014 - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays Cat. # MA1010, MA1011, MA1012 Product User
Manual, MA1013 & MA1014, MA1015 Released 09/28/04 Panomics, Inc. ...
View as HTML - Web Search - biocat.de
Proliferating cell nuclear antigen(PCNA): ringmaster of the genome - Full text - MIT Libraries
T Paunesku, S Mittal, M Proti& x 00107, J Oryhon, … - International Journal of Radiation Biology, 2001 - dx.doi.org
... through a cis element that binds activating transcrip- tion factor ATF, transcription
factor YY1, and the ... hepatitis B-virus enhancer-associated protein RFX1 ...
Cited by 30 - Web Search - taylorandfrancis.metapress.com - ingentaconnect.com - life.nthu.edu.tw - all 5 versions »
Discovering functional transcription-factor combinations in the human cell cycle - Full text - MIT Libraries
Z Zhu, J Shendure, GM Church - Genome Research, 2005 - genome.org
... We found RFX1 to be significantly enriched within 100 bp upstream of GABP, and the ...
In addition, YY1-cMyc, Oct1-C/EBP, CREB-YY1, Oct1-NF-Y, ELK1-HIF1, and POU ...
Web Search - arep.med.harvard.edu - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
BMC Genomics - Full text - MIT Libraries
S Nelander, E Larsson, E Kristiansson, R Maansson, … - BMC Genomics, 2005 - biomedcentral.com
... 5: Testis / spermatogenesis <2.5% 109 M00281:RFX1 <2.5% 142 MA0078:SOX17 <10% 108
M00036:v-Jun <10 ... 4 M00216:TATA 43% (3/7) 2% (220/9561) <20% 5 M00059:YY1 43% (3 ...
View as HTML - Web Search
Characterization of a major histocompatibility complex class II X-box-binding protein enhancing tat- … - Full text - MIT Libraries
C Mischiati, G Feriotto, M Borgatti, P Giacomini, … - J. Virol, 2000 - jvi.asm.org
... box motif interacts with several well-characterized transcription factors, including
RFX, RFX1, NF-X ... Among these, YY1 (31), USF (9), TFII-I (34, 35), LBP family ...
Cited by 8 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
The TATA-containing core promoter of the type II collagen gene (COL2A1) is the target of interferon- … - Full text - MIT Libraries
M Osaki, L Tan, BK Choy, Y Yoshida, KS Cheah, PE … - Biochem. J, 2003 - biochemj.org
... The recent report that IFN-γ inactivates the binding of the regulatory factor
for X-box proteins 1 (RFX1) to the Col1a2 transcription ...
Cited by 15 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Casein kinase II phosphorylation of the human papillomavirus-18 E7 protein is critical for promoting … - Full text - MIT Libraries
WM Chien, JN Parker, DC Schmidt-Grimminger, TR … - Cell Growth Differ, 2000 - cgd.aacrjournals.org
CG&D ...
Cited by 5 - Web Search - milkpa.idv.tw - cgd.aacrjournals.org - ncbi.nlm.nih.gov - all 5 versions »
TranSignal TM Protein/DNA Arrays
CS Version - panomics.com
Page 1. TranSignal TM Protein/DNA Arrays (Column Separation Version) Cat. #
MA1210, MA1211, MA1212l, MA1213 & MA1214, MA1215 Product ...
View as HTML - Web Search
Transcriptional regulation: a genomic overview
JL Riechmann - The Arabidopsis Book. The American Society of Plant …, 2002 - bioone.org
... cells that is related to the mammalian transcription activator-repressor YY1 (Xu
et al ... in animals and yeast (SOX/TCF, Fork head, and RFX1-like transcription ...
Cited by 18 - Web Search - bioone.org
Full Text View
JL Riechmann - bioone.org
... cells that is related to the mammalian transcription activator-repressor YY1 (Xu
et al ... in animals and yeast (SOX/TCF, Fork head, and RFX1-like transcription ...
Web Search
|
©2005 Google