![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 50 of about 179 for SOX9 and MYC. (0.08 seconds) |
The Transcription Factor SOX 9 Regulates Cell Cycle and Differentiation Genes in Chondrocytic CFK 2 … - Full text - MIT Libraries
DK Panda, D Miao, V Lefebvre, GN Hendy, D Goltzman - J Biol Chem, 2001 - intl.jbc.org
... A SOX9 deletion mutant (SOX9-Myc NLS) lacking the first 176 amino acids (within
which there are putative nuclear localization signals (NLSs)) and encoding a ...
Cited by 17 - Web Search - jbc.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Interactions between Sox9 and beta-catenin control chondrocyte differentiation - Full text - MIT Libraries
H Akiyama, JP Lyons, Y Mori-Akiyama, X Yang, R … - Genes Dev, 2004 - genesdev.org
... 3xHA-tagged Sox9. Cos-7 cells were transfected with 3xHA-tagged Sox9 and
6x myc-tagged st -catenin expression vectors. -Catenin was ...
Cited by 16 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Translocation breakpoints in three patients with campomelic dysplasia and autosomal sex reversal map … - Full text - MIT Libraries
J Wirth, T Wagner, J Meyer, RA Pfeiffer, HU Tietze … - Hum. Genet, 1996 - springerlink.com
... Another possibility is that the translocations bring the SOX9 gene under the influence ...
by translocations in Burkitt’s lymphoma that bring the c-myc gene on ...
Cited by 38 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
A male-specific role for SOX9 in vertebrate sex determination - Full text - MIT Libraries
J Kent, SC Wheatley, JE Andrews, AH Sinclair, P … - Development, 1996 - dev.biologists.org
... Mutation analyses of patients with campomelic dysplasia, a bone dysmorphology and
XY sex reversal syndrome, indicate that the SRY-related gene SOX9 is involved ...
Cited by 199 - Web Search - dev.biologists.org - wwwlib.bionet.nsc.ru - ncbi.nlm.nih.gov - all 5 versions »
Sex reversal by loss of the C–terminal transactivation domain of human SOX 9
P Suedbeck, ML Schmitz, PA Baeuerle, G Scherer - Nature Genetics, 1996 - nature.com
... The Sry-related gene Sox9 is expressed during chondrogenesis in mouse embryos. ... Clark,
HM et al.Mutations in the coding region of c-myc in AIDS-associated and ...
Cited by 87 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
From SRY to SOX9: Mammalian Testis Differentiation - Full text - MIT Libraries
Y Kanai, R Hiramatsu, S Matoba, T Kidokoro - Journal of Biochemistry, 2005 - jb.oxfordjournals.org
... Since the Sry-Myc construct containing the whole 14.6-kb murine Sry genomic sequence ...
In addition, WT1, SF1 and SOX9 have also been shown to transactivate the ...
Web Search - jb.oxfordjournals.org
SOX 9 is up-regulated by the transient expression of SRY specifically in Sertoli cell precursors - Full text - MIT Libraries
R SEKIDO, I BAR, V NARVAEZ, G PENNY, R LOVELLBADGE - Developmental Biology, 2004 - ncbi.nlm.nih.gov
... hPLAP), while the second gives expression of a functional Myc-epitope tagged ...
Subsequently, they became SRYMYC/SOX9-double-positive, but only for a few hours ...
Cited by 7 - Web Search
GeneInfoViz: Constructing and visualizing gene relation networks - Full text - MIT Libraries
M Zhou, Y Cui - In Silico Biol, 2004 - iospress.metapress.com
... GA T A 3 GZMB IGF2 MST1 MYBL2 MYC PLA T S O X 4 S O X 9 SRF T OP2B VIL2 XBP1 KIA ...
GA T A 3 GZMB IGF2 MST1 MYBL2 MYC PLA T S O X 4 S O X 9 SRF T OP2B VIL2 XBP1 ...
Web Search - bioinfo.de - bioinfo.de - ncbi.nlm.nih.gov - all 5 versions »
One tissue, two fates: molecular genetic events that underlie testis versus ovary development - Full text - MIT Libraries
J Brennan, B Capel - Nature Reviews Genetics, 2004 - nature.com
... This paper, which tracked the expression of the SRY protein through a MYC tag and ...
22. Clarkson, MJ & Harley, VR Sex with two SOX on: SRY and SOX9 in testis ...
Cited by 18 - Web Search - cellbio.duke.edu - note.cellbio.duke.edu - ncbi.nlm.nih.gov - all 5 versions »
Muscle Differentiation Is Antagonized by SOX 15, a New Member of the SOX Protein Family - Full text - MIT Libraries
F Beranger, C Mejean, B Moniot, P Berta, M … - J Biol Chem, 2000 - jbc.org
... We isolated Sox4, Sox8, and Sox9 cDNAs at similar frequencies in both cell ... eucaryotic
vector pRK5myc downstream and in-frame with the Myc epitope MEQKLISEEDL ...
Cited by 12 - Web Search - jbc.org - ncbi.nlm.nih.gov
Mint Represses Transactivation of the Type II Collagen Gene Enhancer through Interaction with {alpha … - Full text - MIT Libraries
X Yang, J Li, H Qin, H Yang, J Li, P Zhou, Y Liang … - J. Biol. Chem, 2005 - jbc.org
... NIH3T3 cells were transfected with pGL3-Col2 1 (0.1 µg), pCMV-FLAG-SOX9 (0.2 µg),
pCMV-HA-CRYBP1-C (0.2 µg), and increasing amount of pEFBOS-Myc-MINT (0.2 ...
Web Search - jbc.org - ncbi.nlm.nih.gov
A decade of site- and phosphorylation state-specific antibodies: recent advances in studies of … - Full text - MIT Libraries
K Nagata, I Izawa, M Inagaki - Genes to Cells, 2001 - genestocellsonline.org
... Chk2/Cds1 Ser68 ATM kinase ATM kinase SOX9 transcription factor Ser211 PKA enhance
transcriptional and DNA-binding activity of SOX9 2000 82 ... 2000 92 myc Thr58 ? ...
Cited by 5 - Web Search - ingentaconnect.com - genestocellsonline.org - ncbi.nlm.nih.gov
Smad-interacting Protein 1 Is a Repressor of Liver/Bone/Kidney Alkaline Phosphatase Transcription in … - Full text - MIT Libraries
P Tylzanowski, K Verschueren, D Huylebroeck, FP … - J Biol Chem, 2001 - jbc.org
... progress came with the discovery of Cbfa1 (1-4) and Sox9 (5) and the ... Mobility Shift
Assay (EMSA)-- The expression plasmid encoding N-terminally Myc-tagged SIP1 ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Recent findings in the cell and molecular biology of the small intestine.
JRF Walters - Current Opinion in Gastroenterology, 2005 - co-gastroenterology.com
... CD44, c-Myc, Tiam1, Sema3c, EphB2, EphB3, Sox17, Axim2, laminin γ2 were ... SOX9 has
recently been identified as another transcription factor involved in Wnt ...
Web Search - co-gastroenterology.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
[CITATION] NF- B mediates inhibition of mesenchymal cell differentiation through a posttranscriptional gene … - Full text - MIT Libraries
R Sitcheran, PC Cogswell, AS Baldwin Jr - Genes & Development, 2003
... GG CTACGACACCGCCTATTATTCGAGGCGGTTCGCGAGTCC; mMD- 2/3 , GGACTCGCGAACCGCCTCCGAATAA
TAGGCGGTGTCGTA GCC) and for Sox9. ... HindIII/SmaI of pcDNA/ TO/Myc/HisA (Invitrogen ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - dx.doi.org - genesdev.org - all 6 versions »
Supplementary data Table I.
T NP, SV VP, SV VP - emboreports.npgjournals.com
... SOX9. Sudbeck and Scherer (1997). PRRRK. SOX9. Sudbeck and Scherer (1997).
[KAR]TPIQKHWRPTVLTEGPPVKIRIETGEWE[KA]. ... PPQKKIKS. N-myc. Dang and Lee (1989). PQPKKKP. ...
Web Search
Transcriptional Profiling of Bone Regeneration - Full text - MIT Libraries
M Hadjiargyrou, F Lombardo, S Zhao, W Ahrens, J … - J. Biol. Chem, 2002 - jbc.org
... IGF-1, TGF, FGF, PDGF-R, NGF-R (32, 37-40), cytokines, IL-1, IL-6, G-MCF, neuroleukin
(17, 42), transcription factors, Fos (35), c-myc (43), and Sox9 (15-16 ...
Cited by 28 - Web Search - jbc.org - bme.sunysb.edu - ncbi.nlm.nih.gov - all 5 versions »
Neural crest specification: migrating into genomics - Full text - MIT Libraries
LS Gammill, M Bronner-Fraser - Nature Reviews Neuroscience, 2003 - nature.com
1. LeDouarin, N. & Kalcheim, C. The Neural Crest (eds. Bard, J., Barlow,
P. & Kirk, D.) (Cambridge Univ. Press, 1999). 2. His, W ...
Cited by 18 - Web Search - nature.com - genetics.wisc.edu - ncbi.nlm.nih.gov - all 5 versions »
IgG1 Plasmacytosis in Interleukin 6 Transgenic Mice - Full text - MIT Libraries
S Suematsu, T Matsuda, K Aozasa, S Akira, N Nakano … - J. Biol. Chem, 2004 - pnas.org
... mice and were found not to contain chromosomal aberrations including c-myc gene
rearrangements. ... ASSOCIATION WITH A DOWN-REGULATION OF SOX9 EXPRESSION J. Biol. ...
Cited by 117 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - adsabs.harvard.edu
Appendix: Finding nuclear localization signals
M Cokol, R Nair, B Rost - cubic.bioc.columbia.edu
... KRPMNAFMVWAQAARRK SOX9 Sudbeck and Scherer, 1997. PRRRK SOX9 Sudbeck and Scherer,
1997. ... PLLKKIKQ c-myb Dang and Lee, 1989. PPQKKIKS N-myc Dang and Lee, 1989. ...
Cached - Web Search
v-maf, a Viral Oncogene that Encodes a" Leucine Zipper" Motif - Full text - MIT Libraries
M Nishizawa, K Kataoka, N Goto, KT Fujiwara, S … - Mol. Endocrinol, 2005 - pnas.org
... DNA binding proteins, including the gene products of the fos, jun, and myc oncogenes ...
B. de Crombrugghe A New Long Form of c-Maf Cooperates with Sox9 to Activate ...
Cited by 55 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide, a Calmodulin Antagonist, Inhibits Cell … - Full text - MIT Libraries
H Hidaka, Y Sasaki, T Tanaka, T Endo, S Ohno, Y … - J. Biol. Chem, 2004 - pnas.org
... Dickson Calmodulin-mediated Activation of Akt Regulates Survival of c-Myc-
overexpressing Mouse ... S. Preiss, A. Clayton, DA Jans, and VR Harley A SOX9 Defect ...
Cited by 117 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
SRY Interacts with and Negatively Regulates Androgen Receptor Transcriptional Activity - Full text - MIT Libraries
X Yuan, ML Lu, T Li, SP Balk - J Biol Chem, 2001 - jbc.org
... One such candidate direct regulator of the Mis gene is SOX9, an SRY related ... expression
vector encoding full-length human SRY with a C terminus Myc epitope tag ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Genome and Hormones: Gender Differences in Physiology - Full text - MIT Libraries
H Ostrer - J Appl Physiol, 2001 - jap.physiology.org
... A transgenic insertion upstream of Sox9 is associated with dominant XX sex ... Multiple
androgen response elements and a Myc consensus site in the androgen ...
Cited by 2 - Web Search - jap.physiology.org
Characterisation of Crim1 expression in the developing mouse urogenital tract reveals a sexually … - Full text - MIT Libraries
K Georgas, J Bowles, T Yamada, P Koopman, MH … - Dev Dyn, 2000 - doi.wiley.com
... Selected results are indicated WT1 zinc fingers (1), cyclin E (2), GATA1 (3), VHL
(4),Stim1 (5), a Sox gene HMG box (Sox9) (6), c-myc (7), ITG 1 (8), MDM2 (9 ...
Cited by 5 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
Nmyc plays an essential role during lung development as a dosage-sensitive regulator of progenitor … - Full text - MIT Libraries
T Okubo, PS Knoepfler, RN Eisenman, BLM Hogan - Development, 2005 - dev.biologists.org
... H), note the absence of a clear boundary and the high Sox9 expression, even ... many
genes that are directly or indirectly upregulated by Nmyc or Myc in mammalian ...
Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Position effect in human genetic disease - Full text - MIT Libraries
D Kleinjan, V van Heyningen - Human Molecular Genetics, 1998 - dx.doi.org
... For instance, in Burkitt's lymphoma a translocation places the c-MYC gene under
the control of ... This is even more striking in the cases of PITX2, SOX9 and POU3F4 ...
Cited by 118 - Web Search - hmg.oupjournals.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
WISP 3-dependent regulation of type II collagen and aggrecan production in chondrocytes - Full text - MIT Libraries
M Sen, YH Cheng, MB Goldring, MK Lotz, DA Carson - Arthritis & Rheumatism, 2004 - doi.wiley.com
... with an anti-Myc antibody in the supernatant collected from Myc-tagged WISP3 ex ... aggrecan
in parallel with increased expression of SOX9 and 2) the activation of ...
Cited by 3 - Web Search - ncbi.nlm.nih.gov
Protein Kinases in Chondrocyte Signaling and Osteoarthritis.
CJ Malemud - Clinical Orthopaedics and Related Research, 2004 - corronline.com
... phenotype was also shown to be dependent on ERK-1 and -2, but Sox9 gene expression
was ... in TNF-α and NO synthase up-regulation, induction of p53, c-myc, and bax ...
Web Search - corronline.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Sox 6 regulation of cardiac myocyte development - Full text - MIT Libraries
O Cohen-Barak, Z Yi, N Hagiwara, K Monzen, I … - Nucleic Acids Research, 2003 - nar.oupjournals.org
... These vectors contain a T7 RNA polymerase promoter and either a c-Myc or HA ... The Sox9
probe is a mouse cDNA fragment of 278 bp including nucleotides 1049–1326 ...
Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
To proliferate or to die: role of Id 3 in cell cycle progression and survival of neural crest … - Full text - MIT Libraries
Y Kee, M Bronner-Fraser - Genes & Development, 2005 - genesdev.org
... has been shown for several transcription factors involved in neural crest specification,
including Slug, FoxD3, Sox9, Sox10, and c-Myc; knock-down or dominant ...
Cited by 1 - Web Search - dx.doi.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
SUMO Represses Transcriptional Activity of the Drosophila SoxNeuro and Human Sox3 Central Nervous … - Full text - MIT Libraries
J Savare, N Bonneaud, F Girard - Mol Biol Cell, 2005 - molbiolcell.org
... In Sox9, several posttranslational events were shown to be essential for its activity ...
Antibodies Mouse anti-myc (Tebu, Le Perray en Yvelines, France), mouse anti ...
Web Search - pubmedcentral.nih.gov - molbiolcell.org - ncbi.nlm.nih.gov
Wnt-4 regulation by the Wilms' tumour suppressor gene, WT 1 - Full text - MIT Libraries
EUH Sim, A Smith, E Szilagi, F Rae, P Ioannou, MH … - Oncogene, 2002 - nature.com
... A B C D E F G H Bactin Pax2 Pax 8 p53 p21 GATA 1 GATA 2 Sox9 Sox11 EGR-1 c-myb
c-myc N-myc FosB c fos B jun C jun D jun WT1 RRM WT1 ZF VHL ...
Cited by 11 - Web Search - nature.com - ncbi.nlm.nih.gov
Effect of the distribution and clustering of the type IA BMP receptor (ALK3) with the type II BMP … - Full text - MIT Libraries
A Nohe, E Keating, TM Underhill, P Knaus, NO … - Journal of Cell Science, 2003 - jcs.biologists.org
... Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. ...
SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro ...
Cited by 4 - Web Search - jcs.biologists.org - ncbi.nlm.nih.gov
Recombinant Rat CBF-C, the Third Subunit of CBF/NFY, Allows Formation of a Protein-DNA Complex with … - Full text - MIT Libraries
S Sinha, SN Maity, J Lu, B de Crombrugghe - Proceedings of the National Academy of Sciences - pnas.org
... of SOX9 by Cyclic AMP-Dependent Protein Kinase A Enhances SOX9's Ability To ...
Down-regulation of Human hsp70 Gene Expression by Interaction between c-Myc and ...
Cited by 123 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
HMG box transcription factor geneHbp 1 is expressed in germ cells of the developing mouse testis - Full text - MIT Libraries
JM Smith, J Bowles, M Wilson, P Koopman - Developmental Dynamics, 2004 - doi.wiley.com
... repressor of cell cycle targets such as the promoters for n-Myc (Tevosian et al ... a
ubiquitously expressed gene in- cluded as a positive control), Sox9 (a Sertoli ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov
SOX2 functions to maintain neural progenitor identity - Full text - MIT Libraries
V Graham, J Khudyakov, P Ellis, L Pevny, N Center - Neuron, 2003 - healthsystem.virginia.edu
... Inhibition of SOX2 Activity Results in Lateral fused to a myc epitope-tagged
Engrailed-Repressor (ER) domain, SOX2ER myc , converting SOX2 from a tran- ... myc ...
Cited by 39 - View as HTML - Web Search - bio.unc.edu - ingentaconnect.com - all 6 versions »
Expression profiles of two types of human knee-joint cartilage - Full text - MIT Libraries
K Ochi, Y Daigo, T Katagiri, A Saito-Hisaminato, T … - Journal of Human Genetics, 2003 - springerlink.com
... V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B (1997) SOX9 is a ... The basic
region/helix–loop–helix/ leucine zipper domain of Myc proto-oncoproteins ...
Cited by 2 - Web Search - ncbi.nlm.nih.gov
Sex-determining genes in mice: building pathways
R Lovell-Badge, C Canning, R Sekido - Novartis Found Symp, 2002 - doi.wiley.com
... sex reversal, and could be detected by antibodies to the MYC epitope in the genital
ridge. Co-localization experiments using antibodies against SOX9 allowed us ...
Cited by 16 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Effects of Tumor Necrosis Factor-{alpha}(TNF {alpha}) in Epidermal Keratinocytes Revealed Using … - Full text - MIT Libraries
T Banno, A Gazel, M Blumenberg - J Biol Chem, 2004 - jbc.org
... Two interferon regulatory factor (IRF) family (IRF1, IRF5) and two Sry HMG box
(SOX) family (SOX4, SOX9) proteins were induced, whereas MYC, a multifunctional ...
Cited by 5 - Web Search - jbc.org - ncbi.nlm.nih.gov
Identification of a novel Sry-related gene and its germ cell-specific expression - Full text - MIT Libraries
E Osaki, Y Nishina, J Inazawa, NG Copeland, DJ … - Nucleic Acids Research, 1999 - nar.oupjournals.org
... Sox9 and steroidgenic factor-1 (SF-1) also synergistically activate the anti ... generated
by inserting a synthesized oligonucleotide containing a myc tag sequence ...
Cited by 13 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
[CITATION] Research Article - Full text - MIT Libraries
A Nohe, E Keating, TM Underhill, P Knaus, NO … - Journal of Cell Science, 2003
Web Search
SOX 7 transcription factor: sequence, chromosomal localisation, expression, transactivation and … - Full text - MIT Libraries
W Takash, J Canizares, N Bonneaud, F Poulat, MG … - Nucleic Acids Research, 2001 - nar.oupjournals.org
... Mutations of human SOX9 leads to campomelic dysplasia, a bone dysmorphogenesis often ...
constructs, shown in Figure 5, were inserted into the Myc-tagged modified ...
Cited by 26 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
Sox genes and cancer - Full text - MIT Libraries
C Dong, D Wilhelm, P Koopman, F Alert - Cytogenetic and Genome Research, 2004 - content.karger.com
... Resources 4 Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B: Sox9 is required ...
v-ras and v-mos oncogenes and by co-transfection with c-myc and polyoma ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Impaired intervertebral disc formation in the absence of Jun - Full text - MIT Libraries
A Behrens, J Haigh, F Mechta-Grigoriou, A Nagy, M … - Development, 2003 - dev.biologists.org
... Targeted inactivation of Sox9 results in skeletal defects due to impaired cartilage ...
the Pax family members Pax1 and Pax9, the proto-oncogene Myc, the homeobox ...
Cited by 10 - Web Search - dx.doi.org - dev.biologists.org - ncbi.nlm.nih.gov
Structural basis for Hif-1 alpha/CBP recognition in the cellular hypoxic response - Full text - MIT Libraries
SA Dames, M Martinez-Yamout, RN De Guzman, HJ … - J. Biol. Chem, 2004 - dx.doi.org
... 1{alpha} induces cell cycle arrest by functionally counteracting Myc EMBO J ... p300
Regulate Chondrocyte-specific Gene Expression via Association with Sox9 J. Biol ...
Cited by 52 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
A Comparative Study of Eya 1 and Eya 4 Protein Function and Its Implication in Branchio-oto-renal … - Full text - MIT Libraries
Y Zhang, BM Knosp, M Maconochie, RA Friedman, RJH … - Journal of the Association for Research in Otolaryngology, 2004 - springerlink.com
... 4 h after transfection (detection—primary antibody: mouse anti-c-myc antibody; second ...
1995), and SOX9, a cause of cam- pomelic dysplasia (Sock et al. 2001). ...
Web Search - ncbi.nlm.nih.gov
Smad-Dependent Recruitment of a Histone Deacetylase/Sin3A Complex Modulates the Bone Morphogenetic … - Full text - MIT Libraries
DW Kim, AB Lassar - Mol Cell Biol, 2003 - pubmedcentral.nih.gov
... gene(s) that blocks the expression or function of both Sox9 (3, 4, 37 ... that Smad3
can support TGF-β-dependent transcriptional repression of the c-myc promoter (7 ...
Cited by 5 - Web Search - dx.doi.org - mcb.asm.org - ncbi.nlm.nih.gov
The paired homeobox gene Uncx4. 1 specifies pedicles, transverse processes and proximal ribs of the … - Full text - MIT Libraries
M Leitges, L Neidhardt, B Haenig, BG Herrmann, A … - Development, 2000 - dev.biologists.org
... Key words: Skeleton, Vertebra, Chondrogenesis, Somite, Sox9, Scleraxis, Pax1,
Pax9 SUMMARY ... further supported by the expression of Sox9. ...
Cited by 16 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Identification and validation of novelERBB 2(HER 2, NEU) targets including genes involved in … - Full text - MIT Libraries
J Beckers, F Herrmann, S Rieger, AL Drobyshev, M … - International Journal of Cancer, 2005 - doi.wiley.com
... cell migration or adhesion and cytoskeletal integrity (eg, Sox9, Hmga1, Klf5 ... terms
of upregulated genes in ERBB2-expressing cells, N- myc downstream regulated 1 ...
Cited by 2 - Web Search
| |
©2005 Google