![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
| Scholar | Results 1 - 48 of 48 for SP1 and EN1. (0.12 seconds) |
Jahrestrainingsplanung fuer eine HighSchool Mannschaft
S References - gsv1.de
... EN1 is base endurance work, with a low to moderate effort level from swimmers. ...
SP1-2 is sprint work, with the swimmer going as fast as possible, even if it ...
View as HTML - Web Search - gsv.business.t-online.de
Age and Gender Effects in Physical Self-Concepts: A Longitudinal Comparison between Athletes and …
ALC between Athletes - self.uws.edu.au
... Page 5. Table 3. Error Covariance Matrix (Theta-Epsilon) - Completely Standardized
Solution CO1 PA1 SP1 ST1 FL1 EN1 CO5 PA5 SP5 ST5 FL5 - 89 EN5 GP1 GP5 ES1 ES5 ...
View as HTML - Web Search
Fibroblast Growth Factor-8 Expression Is Regulated by Intronic Engrailed and Pbx 1-binding Sites - Full text - MIT Libraries
J Gemel, C Jacobsen, CA MacArthur - J Biol Chem, 1999 - jbc.org
... 4). These results suggest that the AP2/Sp1 DNA-binding site in the Fgf8 5'-region ...
5). Pbx1, En1, and En2 are present in day 9 embryoid bodies as determined by ...
Cited by 17 - Web Search - dx.doi.org - jbc.org - ncbi.nlm.nih.gov
Sp8 is crucial for limb outgrowth and neuropore closure - Full text - MIT Libraries
SM Bell, CM Schreiner, RR Waclaw, K Campbell, SS … - Proc. Natl. Acad. Sci. USA, 2003 - pnas.org
... Targeted mutations of mouse Sp1, 3, 4, 5, and 7 have previously been ... Alexandra Joyner
(New York University School of Medicine, New York) (En1), Robert Maxson ...
Cited by 7 - Web Search - pubmedcentral.nih.gov - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
GSM 6.10 speech codec implementation
S Kangude - prism.gatech.edu
... sp1/maxSp1; sp2_l=sp2/maxSp2; wavwrite(sp1_l,8000,'sp1.wav'); wavwrite ... lp_rs_d0) +
(mean(lp_rs_d0)*mean(lp_rs_d0)); lp_rs_d1 = lp_rs .* dl1; en1 = cov(lp_rs_d1 ...
View as HTML - Web Search
mBtd is required to maintain signaling during murine limb development - Full text - MIT Libraries
D Treichel, F Schoeck, H Jaeckle, P Gruss, A … - Genes & Development, 2003 - genesdev.org
... 1C-H). Therefore, the encoded protein contains functional features of BTD, which
are absent from SP1 and BTS1. ... Initial expression of En1 at E9.5 is normal. ...
Cited by 4 - Web Search - genesdev.org - pubmedcentral.nih.gov - dx.doi.org - all 7 versions »
Genomic structure and promoter activity of the mouse polysialic acid synthase gene (mST8Sia II) - Full text - MIT Libraries
Y Yoshida, N Kurosawa, T Kanematsu, N Kojima, S … - J. Biol. Chem, 1996 - jbc.org
... 10 kcpm of 32 P-labeled DNA fragment, and 1 footprinting unit of recombinant Sp1. ...
For construction of pBO1-EN1.8, the resultant DNA fragment was subcloned into ...
Cited by 22 - Web Search - jbc.org - ncbi.nlm.nih.gov
Parnassia palustris: a genetically diverse species in Scandinavia
P PALUSTRIS - ingentaconnect.com
... SP1 Spain, E Pyrenees, Catalonia, Girona, La Vall de Ribes, Coma de Fontenegra,
42 ... EN1 England, North Yorkshire, Stainforth, 53∞36¢N 1∞01¢W, c.750–975 ...
Web Search
The neuronal microtubule-associated protein 1B is under homeoprotein transcriptional control - Full text - MIT Libraries
ML Montesinos, I Foucher, M Conradt, G Mainguy, L … - J. Neurosci, 2001 - jneurosci.org
... additional 30 min with a polyclonal antibody that recognizes both En1 and En2 ... several
regulatory motifs, including two cAMP-responsive elements, an Sp1 site, a ...
Cited by 10 - Web Search - jneurosci.org - ncbi.nlm.nih.gov
Pax2 and homeodomain proteins cooperatively regulate a 435 bp enhancer of the mouse Pax5 gene at the … - Full text - MIT Libraries
PL Pfeffer, M Bouchard, M Busslinger - Development, 2000 - dev.biologists.org
... Wnt1, Fgf8) and transcription factors (Otx2, Gbx2, En1, En2, Pax2 ...
AGCTCCAAATTTAATTGAAGAGTG-3′; Sp1, 5′-AATTCGATC- GGGGCGGGGCGAGCG-3′; Oct (H2A octamer) ...
Cited by 21 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Analysis of DNase-I-hypersensitive sites at the 3'end of the cystic fibrosis transmembrane … - Full text - MIT Libraries
HN Nuthall, DS Moulin, C Huxley, A Harris - Biochem. J, 1999 - biochemj.org
... include several potential binding sites for the ubiquitous transcription factor
Sp1 and other ... 9 (0.9 kb EcoRI\HindIII), XE1.4 (1.4 kb XbaI\ EcoRI), EN1.5 (1.5 ...
Cited by 13 - View as HTML - Web Search - imm.ox.ac.uk - biochemj.org - ncbi.nlm.nih.gov - all 5 versions »
The human chorionic somatomammotropin enhancers form a composite silencer in pituitary cells in … - Full text - MIT Libraries
SW Jiang, NL Eberhardt - Mol. Endocrinol, 1997 - mend.endojournals.org
... 18) play an essential role in mediating TEF-1 function (8). Although Sp1 is clearly ...
and CSEn5 were ligated to BglII-digested 493CSp.LUC to generate En1 CSp.LUC ...
Cited by 4 - Web Search - dx.doi.org - mend.endojournals.org - ncbi.nlm.nih.gov
The two isozymes of rat intestinal alkaline phosphatase are products of two distinct genes - Full text - MIT Libraries
Q Xie, DH Alpers - Physiol Genomics, 2000 - intl-physiolgenomics.physiology.org
... The Sp1 site found in all IAP genes is active in transcriptional ... Comparative gene
mapping: cytogenetic localization of PROC, EN1, ALPI, TNP1, and IL1B in ...
Cited by 8 - Web Search - intl-physiolgenomics.physiology.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Interference of the Simian Virus 40 Origin of Replication by the Cytomegalovirus Immediate Early … - Full text - MIT Libraries
PH Chen, WB Tseng, Y Chu, MT Hsu - Mol Cell Biol, 2000 - mcb.asm.org
... Plasmids pCM-en1, pCM-en2, and pCM-en4 were derived from pCM by the insertion of
an ... This region includes an NF- B and two SP1 transcription factor binding sites ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Regulation of Hepatitis B Virus Core Promoter by Transcription Factors HNF1 and HNF4 and the Viral X … - Full text - MIT Libraries
Y Zheng, J Li, J Ou - J Virol, 2004 - pubmedcentral.nih.gov
... could stimulate the core promoter via its binding site in the EN1 enhancer (24). ...
regulation of hepatitis B virus gene expression by the Sp1 transcription factor ...
Web Search - jvi.asm.org - ncbi.nlm.nih.gov
Parnassia palustris: a genetically diverse species in Scandinavia - Full text - MIT Libraries
LIV BORGEN, UMAJ HULTGARD - Botanical Journal of the Linnean Society, 2003 - blackwell-synergy.com
... Nei, 1978) between the diploid populations ranged from I = 0.701 (EN1 and SW11 ... cluster
included populations from all over Europe: the Pyrenees (SP1, SP2), the ...
Cited by 4 - Web Search
Validation of the Physical Self-Description Questionnaire for use in Norwegian populations
AT Klomsten - 2002 - self.uws.edu.au
... Physical (OV), SP1 – SP6 = Sports Competence (OV), PA1 – PA6 = Physical activity
(OV), A1 – A6 = Appearance (OV), BF1- BF6 = Body Fat (OV), EN1 – EN6 ...
Cited by 1 - View as HTML - Web Search
The activation and maintenance of Pax2 expression at the mid-hindbrain boundary is controlled by … - Full text - MIT Libraries
PL Pfeffer, B Payer, G Reim, MP di Magliano, M … - Development, 2002 - dev.biologists.org
... for homeodomain proteins (Gehring et al., 1994) and a recognition sequence for
Sp1-like zinc ... able to bind to the early enhancer in contrast to Gbx2 and En1 (Fig ...
Cited by 12 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Operational Semantics of DEMOS 2000.
C Tofts, G Birtwistle, S Gifford, W Lane, B Leeds - hpl.hp.com
... ENTER en [] = [ en ] ENTER en1 (en2::EL) = if evTime en1 < evTime en2 then
en1::en2::EL else if evTime en1 = evTime en2 then if pPri en1 ≥ pPri en2 then en1 ...
View as HTML - Web Search - demos2k.org
Functional characterization and genomic organization of the human Na-sulfate cotransporter hNaS2 … - Full text - MIT Libraries
D Markovich, RR Regeer, K Kunzelmann, PA Dawson - Biochemical and Biophysical Research Communications, 2005 - uq.edu.au
... The GC- (SP1 binding site) and CAAT-boxes, as well as putative transcription ... b signaling;
NF1, nuclear factor 1; NFKAPPAB50, NF-jB (p50); EN1, homeobox protein ...
Cited by 1 - View as HTML - Web Search - ncbi.nlm.nih.gov
Interaction between STAT-3 and HNF-3 leads to the activation of liver-specific hepatitis B virus … - Full text - MIT Libraries
G Waris, A Siddiqui - J Virol, 2002 - jvi.asm.org
... of the C/EBP gene in hepatocyte is mediated by Stat3 and Sp1. ... Regulation of hepatitis
B virus EN1 enhancer activity by hepatocyte-enriched transcription factor ...
Cited by 8 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov - all 5 versions »
The core promoter of hepatitis B virus - Full text - MIT Libraries
A Kramvis, MC Kew - Journal of Viral Hepatitis, 1999 - blackwell-synergy.com
... There is a single HNF4 site in the EN1/X-gene promoter region and ... Human Sp1 protein,
one of the best characterized transcription factors [55], increases the ...
Cited by 20 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
Hormone-dependent Recruitment of NF-Y to the Uteroglobin Gene Enhancer Associated with Chromatin … - Full text - MIT Libraries
A Scholz, M Truss, M Beato - J Biol Chem, 1999 - jbc.org
... For the upper strand: En1, CTTTGCTTGATTGGCC; En2, CTTGATGTTCACTAAACAGGCACCTTGG;
En3 ... NF-Y B, pR YB (26), or an unrelated control serum, anti-Sp1 (27), were ...
Cited by 3 - Web Search - jbc.org - ncbi.nlm.nih.gov
Characterization of Salmonella enterica Subspecies I Genovars by Use of Microarrays - Full text - MIT Libraries
S Porwollik, EF Boyd, C Choy, P Cheng, L Florea, E … - Journal of Bacteriology, 2004 - pubmedcentral.nih.gov
... Montevideo Mo1 with the serovar Oranienburg isolates; Enteritidis En1 with serovar ...
of SARA22 and SARA23, representing serovar Saint Paul types Sp1 and Sp2 ...
Cited by 9 - Web Search - dx.doi.org - jb.asm.org - csa.com - all 6 versions »
[PS] Belgian-Spanish Proposal for a Time Extended LOTOS
L Leonard, G Leduc, D de Frutos, L Llana, C Miguel … - Revised Draft on Enhancements to LOTOS, ISO/IEC JTC1/SC21/WG …, 1994 - lotos.site.uottawa.ca
Page 1. 1 Belgian-Spanish Proposal for a Time Extended LOTOS Luc Léonard
1 , Guy Leduc 1 , David de Frutos 2 , Luis Llana 2 , Carlos ...
Cited by 3 - View as HTML - Web Search
[BOOK] Versuch Einer Academischen Gelehrten-Geschichte Von Der Georg-Augustus-Universitaet Zu Goettingen
JS Puetter - 1838 - print.google.com
Page 1. 4 Page 2. ‘ f Page 3. 3 e f4 i dj tt b u Unit'njität hittin cn In born eitvaume
om Za ve 1820 bI u Urev e ften &u avfeicr hu td) 1837. R3om ...
Cited by 1 - Web Search - Get it from MIT Libraries
Axon Guidance at the Midline of the Developing CNS
Z KAPRIELIAN, R IMONDI, E RUNKO - THE ANATOMICAL RECORD (NEW ANAT.), 2000 - doi.wiley.com
... is perturbed in the absence of the floor plate by crossing En1/tau-lacZ (see ... comprise
a single nerve cord), many of these neurons (eg, RP1, SP1) project axons ...
Cited by 11 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
An Automatic Petri-Net Generator for Modeling
SM Method - ieeexplore.ieee.org
... Algorithm 2.1 : FindAlLPath_To_Stop_Point (i) Step 1: ARRAY Snius[1 NSP] Step 2:
MATRIX Answer[1,. ..,N_SP][1 N..SP1 Step 3: Initialize STACK Step 4 ...
Web Search
Identification of NKL, a novel Gli-Kruppel zinc-finger protein that promotes neuronal … - Full text - MIT Libraries
E Lamar, C Kintner, M Goulding - Development, 2001 - dev.biologists.org
... fragment. Double-stranded oligonucleotide Sp1 binding sites dsI and dsII
(Jones et al., 1985) were used for competition experiments. ...
Cited by 11 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
SERVICE MANUAL
PM RECORDER - wimtv.be
Page 1. CCD-TR618/TR618E/TR718E/TR728E/TR818 CCD-TRV49/TRV49E/TRV58/TRV58E/TRV59E/
TRV68/ TRV78/TRV78E/TRV88/TRV98/TRV98E RMT-708 SERVICE MANUAL ...
View as HTML - Web Search - dingdong.uw.hu - amulation.co.uk - zoot.minidisc.org - all 34 versions »
Untersuchung und Charakterisierung des Hic2-Gens der Maus
A Terzic - edoc.ub.uni-muenchen.de
Page 1. Aus dem Institut für Entwicklungsgenetik des GSF-Forschungszentrums für
Umwelt und Gesundheit, GmbH Direktor: Prof. Dr. Wolfgang Wurst ...
View as HTML - Web Search
Tracing of her 5 progeny in zebrafish transgenics reveals the dynamics of midbrain-hindbrain … - Full text - MIT Libraries
A Tallafuss, L Bally-Cuif - Development, 2003 - dev.biologists.org
Summary of this Article. Figures Only for this Article. PDF Version of this
Article. Email this article to a friend. Similar articles ...
Cited by 2 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
HOXA 13 regulates the expression of bone morphogenetic proteins 2 and 7 to control distal limb … - Full text - MIT Libraries
WM Knosp, V Scott, HP Baechinger, HS Stadler - Development, 2004 - dev.biologists.org
... of polarizing activity in the anteroposterior axis; and Wnt7a and En1, which specify ...
suggesting that the cooperative regulation of Bmp4 by SP1 may compensate ...
Cited by 2 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov
Regulation of pattern formation in the Drosophila hindgut by wg, hh, dpp, and en - Full text - MIT Libraries
S Takashima, R Murakami - Mech. Dev, 2001 - milkpa.idv.tw
... that the development of the border cells requires direct interaction of en1/en2
cells ... Sp1/egr-like zinc-®nger protein required for endo- derm speci®cation and ...
Cited by 15 - View as HTML - Web Search - ncbi.nlm.nih.gov
Variation of serotonergic gene expression: neurodevelopment and the complexity of response to …
KP Lesch - Eur Neuropsychopharmacol, 2001 - uni-wuerzburg.de
... each con- variation in gene function as well as environmental factors
taining an Sp1 binding site in reversed orientation. A at ...
Cited by 13 - View as HTML - Web Search - ingentaconnect.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The psychopharmacogenetic-neurodevelopmental interface in serotonergic gene pathways
KP Lesch, J Benninghoff, A Schmitt - Pharmacogenetics of psychotropic drugs, 2002 - uni-wuerzburg.de
... The core promoter region contains two 90bp repeat sequences, which are further divided
into four imperfect tandem repeats, each containing an Sp1 binding site ...
Cited by 1 - View as HTML - Web Search
A brief history of human autosomes - Full text - MIT Libraries
D Haig - Philos Trans R Soc Lond B Biol Sci, 1999 - journals.royalsoc.ac.uk
Page 1. A brief history of human autosomes David Haig Department of Organismic
and Evolutionary Biology, Harvard University, 26 Oxford ...
Cited by 26 - Web Search - oeb.harvard.edu - ingentaconnect.com - ncbi.nlm.nih.gov - all 5 versions »
Axon guidance at the midline choice point - Full text - MIT Libraries
Z Kaprielian, E Runko, R Imondi - Developmental Dynamics, 2001 - doi.wiley.com
... mice that express tau- -galactosidase under the control of EN1 regulatory sequences,
EN-1 ... identical segments) many of these neurons (eg, RP1, SP1) project axons ...
Cited by 37 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
A statistical analysis of the TRANSFAC database.
GB Fogel, DG Weekes, G Varga, ER Dow, AM Craven, … - Biosystems, 2005 - natural-selection.com
Page 1. BioSystems xxx (2005) xxx–xxx A statistical analysis of the TRANSFAC database
Gary B. Fogel a , Dana G. Weekes a , Gabor Varga b , Ernst R. Dow b , ...
View as HTML - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
An Evidential Reasoning Approach to Attribute Value Conflict Resolution in Database Integration
J Srivastava - IEEE TRANSACTIONS ON KNOWLEDGE AND DATA ENGINEERING, 1995 - ieeexplore.ieee.org
Page 1 IEEE TRANSACTIONSON KNOWLEDGEANO DATA ENGINEERING, VOL. 8, NO.5,
OCTOBER1996 707 1041-4347196$05.C0 Cl 996 IEEE An Evidential ...
Web Search - Get it from MIT Libraries
‘Cartilage Hair Hypoplasia and the RMRP gene’
PD Thesis - ubm.opus.hbz-nrw.de
... extoderm, the homoebox protein Engrailed-1 (En1) with expression in the
ventral ectoderm as well as by the transcription factor ...
View as HTML - Web Search
OLARY DOMAIN, OLARY 1: 250 000 MAP SHEET Olary and Mingary 1: 100 000 MAP SHEETS, SOUTH AUSTRALIA
WS McCallum - pir.sa.gov.au
Page 1. REPORT BOOK 98/23 REVIEW of OPEN FILE COMPANY EXPLORATION DATA
From 1991 to MID-1997 , OLARY DOMAIN, OLARY 1:250 000 MAP ...
View as HTML - Web Search
E E--V V i i s s i i o o n n 2 2 0 0 0 0 0 0::
OE Future - eere.energy.gov
Page 1. Science and Technology Policy Institute RAND E E - - V V i i s s i i o o
n n 2 2 0 0 0 0 0 0 : : Key Issues That Will Shape Our Energy Future ...
Web Search - rand.org - rand.org
A. Scenario Analysis
R Silberglitt, A Hove - E-Vision 2000 Conference, 2000 - rand.org
Page 1. 303 A. Scenario Analysis Richard Silberglitt RAND Anders Hove RAND
RAND undertook an analysis of future scenarios to help ...
Cited by 1 - View as HTML - Web Search - rand.org - rand.org
1803 Collins Settlement Site: Future Directions Management Plan
F Report - mornpen.vic.gov.au
Page 1. 1803 Collins Settlement Site: Future Directions Management Plan Draft Report
June 2002 Prepared for ParksVictoria & Mornington Peninsula Shire Page 2. ii ...
View as HTML - Web Search - svc009.bne197p.server-web.com - parkweb.vic.gov.au
Improving DOE/EM Risk Information: Content and Format
R Version - staff.washington.edu
Page 1. Improving DOE/EM Risk Information: Content and Format Conclusions
and Recommendations from Two Working Meetings Organized ...
View as HTML - Web Search - instrm.org
Extension of the Isobaric Nucleon Model for Pion Production in Pion-Nucleon, Nucleon-Nucleon, and … - Full text - MIT Libraries
RM Sternheimer, SJ Lindenbaum - Physical Review, 1961 - link.aps.org
... This phase space will be denoted by Fd(N2* > N(0*) and is given by Fd(N2*- Ni(l)*)-
p*E*EN1*/m2, (82) where p,* = pNl* is the momentum of the pion (or N1*) in ...
Cited by 34 - Web Search - adsabs.harvard.edu
An Investigation of Cellulose-binding Domains in Non-cellulolytic enzymes
S Mulcahy, BSI Biochemistry, JT Pembroke - skynet.ie
Page 1. An Investigation of Cellulose- binding Domains in Non-cellulolytic enzymes
Final Year Project Submitted by Stephen Mulcahy 9224076 B.Sc. ...
View as HTML - Web Search - csn.ul.ie
| |
©2005 Google