![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 912 for SP1 and NF1. (0.09 seconds) |
Characterization of a GC-rich region containing Sp1 binding site (s) as a constitutive responsive … - Full text - MIT Libraries
T Tamaki, K Ohnishi, C Hartl, EC LeRoy, M … - J Biol Chem, 1995 - jbc.org
... In a different experimental system using mouse COL1A1 promoter, two sets of overlapping
binding sites for Sp1 and NF1 have been identified(22) . ...
Cited by 38 - Web Search - jbc.org
Ubiquitous transcription factors NF1 and Sp1 are involved in the androgen activation of the mouse …
CH Darne, L Morel, F Claessens, M Manin, S Fabre, … - Mol Cell Endocrinol, 1997 - ingentaconnect.com
... Ubiquitous transcription factors NF1 and Sp1 are involved in the androgen
activation of the mouse vas deferens protein promoter. ...
Cited by 14 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
INCREASED PHOSPHORYLATION OF TRANSCRIPTION FACTOR Sp1 IN SCLERODERMA FIBROBLASTS - Full text - MIT Libraries
S However - ARTHRITIS & RHEUMATISM, 2000 - doi.wiley.com
... Hitraya et al reported that Sp1/NF1 binding sites of the 1(I) collagen promoter
were implicated in the up- regulation of expression of the 1(I) collagen gene ...
Cited by 22 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
A nuclear factor other than Sp1 binds the GC-rich promoter of the gene encoding rat poly (ADP-ribose …
MA Laniel, MJ Bergeron, GG Poirier, SL Guerin - Biochem. Cell Biol, 1997 - article.pubs.nrc-cnrc.gc.ca
... Of particular interest is the finding that binding of both Sp1 and NF1 to their
respective, adjacent elements in the upstream promoter of the gene for the ...
Cited by 10 - Web Search - article.pubs.nrc-cnrc.gc.ca - pubs.nrc-cnrc.gc.ca - ncbi.nlm.nih.gov - Get it from MIT Libraries
Sp 1-mediated Transcriptional Activation from the Dominant Promoter of the Rat alpha 1 B Adrenergic … - Full text - MIT Libraries
J Chen, MS Spector, G Kunos, B Gao - J Biol Chem, 1997 - jbc.org
... Gel shift assays indicate that footprint II can bind Sp1, NF1, and CP1, and
that the binding of these 3 proteins is mutually exclusive. ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov
Nuclear Factor 1 Interferes with Sp 1 Binding through a Composite Element on the Rat Poly (ADP- … - Full text - MIT Libraries
MA Laniel, GG Poirier, SL Guerin - J Biol Chem, 2001 - jbc.org
... 6B). However, coexpression of both Sp1 and NF1-L led to a concentration-dependent
decrease of the transcriptional activation mediated by Sp1 on the pCR3 ...
Cited by 9 - Web Search - jbc.org - ncbi.nlm.nih.gov
The RNA polymerase I promoter-activating factor CPBF is functionally and immunologically related to … - Full text - MIT Libraries
PK Datta, AK Ghosh, ST Jacob - J Biol Chem, 1995 - jbc.org
... 2 B) probably represents E BF-DNA interaction, which is competed by cold rCP,
MLTF, and to some extent by SP1 and NF1 but not by MRE-d. ...
Cited by 11 - Web Search - jbc.org - ncbi.nlm.nih.gov
Nucleoprotein structure of immediate-early promoters Zp and Rp and of oriLyt of latent Epstein-Barr … - Full text - MIT Libraries
HH Niller, D Salamon, J Uhlig, S Ranf, M Granz, F … - J Virol, 2002 - jvi.asm.org
... Gel shifts and transient transfection assays indicated that an Sp1-NF1 locus may
serve as a repressive transcriptional element against Zp induction from latent ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - jvi.asm.org - ncbi.nlm.nih.gov
Identification of a 42-kDa nuclear factor (NF1-MUC5B) from HT-29 MTX cells that binds to the 3' … - Full text - MIT Libraries
P Pigny, I Van Seuningen, JL Desseyn, S Nollet, N … - Biochem Biophys Res Commun, 1996 - ingentaconnect.com
... the interaction. The nuclear factor called NF1-MUC5B which binds to this
element has aM r of 42000 and is not Sp1. These results ...
Cited by 11 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
GATA-4 and GATA-6 modulate tissue-specific transcription of the human gene for P450c17 by direct … - Full text - MIT Libraries
CE Fluck, WL Miller - Mol Endocrinol, 2004 - ncbi.nlm.nih.gov
... Binding of Sp1, Sp3, and NF1-C (nuclear factor 1-C) to the first 227 bp of 5'flanking
DNA (-227/LUC) is crucial for basal transcription in human NCI-H295A ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
Association of p107 with Sp1: genetically separable regions of p107 are involved in regulation of E2 … - Full text - MIT Libraries
PK Datta, P Raychaudhuri, S Bagchi - Mol. Cell. Biol, 1995 - mcb.asm.org
... Consensus oligonucleotides containing Sp1, AP2, and NF1 binding sites were
obtained from Promega. The plus-strand sequence for the ...
Cited by 67 - Web Search - mcb.asm.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Extinction of an immunoglobulin kappa promoter in cell hybrids is mediated by the octamer motif and …
S Junker, S Pedersen, E Schreiber, P Matthias - Cell, 1990 - ncbi.nlm.nih.gov
... extinction" phenomenon. Replacement of this octamer site by an Sp1 or NF1 binding
site is sufficient to bypass extinction. Furthermore, in ...
Cited by 14 - Web Search - Get it from MIT Libraries
Molecular and Cell Biology of TGF-ß
AB Roberts - Miner Electrolyte Metab, 1998 - content.karger.com
... Whether transcription factors known to bind to AP1, Sp1, NF1, TCE, or TIE elements
will be found to associate directly with Smad proteins or whether other ...
Cited by 90 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
[CITATION] SF-1, C/EBPss and ubiquitous transcription factors NF1 and Sp1 are required for regulation of the … - Full text - MIT Libraries
C Aigueperse, P Val, C Pacot, C Darne, E Lalli, P … - Mol. Endocrinol, 2001
Cited by 3 - Web Search
Regulatory domains within the P0 promoter of human c-myc
JC Lang, NM Wilkie, AM Clark, A Chudleigh, S … - Oncogene, 1991 - ncbi.nlm.nih.gov
... DNAase 1 footprint analysis and gel retardation assays demonstrate binding
of transcription factors Sp1, NF1 and CBP to this region. ...
Cited by 5 - Web Search - Get it from MIT Libraries
Characterization and functional analysis of TFPI-2 gene promoter in a human choriocarcinoma cell … - Full text - MIT Libraries
F Hube, P Reverdiau, S Iochmann, C Cherpi-Antar, Y … - Thromb. Res, 2003 - ingentaconnect.com
... Moreover, several putative binding sites for transcription factors were identified
(MyoD, LYF1, NF-Y, GATA, oct-1, AP-1, Sp1, NF1, NF- B and egr-1). To ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The RACK1 scaffold protein: a dynamic cog in cell response mechanisms - Full text - MIT Libraries
A McCahill, J Warwicker, GB Bolger, MD Houslay, SJ … - Mol Pharmacol, 2002 - dx.doi.org
... The RACK1 gene promoter contains a number of transcription factor binding sites
including serum response element, AP1, SP1, NF1, and YY1 (Chou et al., 1999 ). ...
Cited by 23 - Web Search - molpharm.aspetjournals.org - ncbi.nlm.nih.gov
Characterization of the rat Class 3 aldehyde dehydrogenase gene promoter - Full text - MIT Libraries
Y Xie, K Takimoto, HC Pitot, WK Miskimins, R … - Mol. Pharmacol, 1999 - nar.oupjournals.org
... The double-stranded consensus sequence for AP1, mutant Sp1 sequence and antibodies
against Sp1 and NF1 were purchased from Santa Cruz Biotechnology, Inc. ...
Cited by 4 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Transcriptional regulation by triiodothyronine requires synergistic action of the thyroid receptor … - Full text - MIT Libraries
ML Voz, B Peers, MJ Wiedig, P Jacquemin, A Belayew … - Mol. Cell. Biol, 1992 - pubmedcentral.nih.gov
... Furthermore, synergy occurs not only with a GHF1-binding site but also with all
other factor recognition sequences tested (Sp1, NF1, CP1, Oct1, and CACCC boxes ...
Cited by 9 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov
CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in … - Full text - MIT Libraries
IG Sharina, E Martin, A Thomas, KL Uray, F Murad - Proc Natl Acad Sci USA, 2003 - intl.pnas.org
... of CBF (pCAAT), NF1 (pNF1), and GFI1 (pGFI1) binding sites; double core deletions
of CBF and GFI1 (pCAAT-GFI1) binding sites, of SP1 and NF1 (pSPNF) binding ...
Cited by 4 - Web Search - pnas.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 6 versions »
NF 1/X represses PDGF A-chain transcription by interacting with Sp 1 and antagonizing Sp 1 occupancy … - Full text - MIT Libraries
LA Rafty, FS Santiago, LM Khachigian - The EMBO Journal, 2002 - embojournal.npgjournals.com
... Gel-shift analysis revealed that recombinant Sp1 and NF1/X each bind [ 32 P]Oligo
A (Figure 5A). However, NF1/X blocked the formation of an Sp1 complex ...
Cited by 7 - Web Search - nature.com - emboj.org - pubmedcentral.nih.gov - all 6 versions »
Repression of histone H5 gene expression in chicken mature erythrocytes is correlated with reduced …
JM Sun, CG Penner, JR Davie - ncbi.nlm.nih.gov
... The histone H5 promoter has binding sites for Sp1 and UPE-binding protein. The 3'
histone H5 enhancer has binding sites for Sp1, GATA-1 and NF1. ...
Cited by 4 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Characterization of the 5'regulatory region of the human sodium-dependent multivitamin transporter, …
S Dey, VS Subramanian, NS Chatterjee, SA Rubin, HM … - Biochimica et Biophysica Acta (BBA)/Gene Structure and …, 2002 - ingentaconnect.com
... sequences were TATA-less, CAAT-less, contained highly GC-rich sites, and had multiple
putative regulatory cis-elements (eg, AP1, AP2, C/EBP, SP1, NF1, and GATA ...
Cited by 7 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Regulation of the Integrin Subunit {alpha} 5 Gene Promoter by the Transcription Factors Sp1/Sp3 Is … - Full text - MIT Libraries
ME Gingras, K Larouche, N Larouche, S Leclerc, C … - Invest Ophthalmol Vis Sci, 2003 - iovs.org
... 5 promoter ( 5.1, 5.2, 5.3, an 5-FRE) or target sequences for known transcription
factors (Sp1 and NF1) were added as unlabeled competitors during the assay. ...
Cited by 6 - Web Search - dx.doi.org - iovs.org - ncbi.nlm.nih.gov - all 5 versions »
Nuclear factor 1 is a component of the nuclear matrix
JM Sun, HY Chen, JR Davie - J Cell Biochem, 1994 - ncbi.nlm.nih.gov
... We show that NF1, but not Sp1, GATA-1, or UPE-binding protein, is associated
with the internal nuclear matrices of these erythroid cells. ...
Cited by 14 - Web Search - Get it from MIT Libraries
Characterization of the rat catechol-O-methyltransferase gene proximal promoter: Identification of a …
J Tenhunen - DNA Cell Biol, 1996 - ncbi.nlm.nih.gov
... Analysis of this region by DNase I footprinting and gel retardation assays identified
the presence of several DNA elements with SP1 and NF1 recognition site ...
Cited by 2 - Web Search - Get it from MIT Libraries
Multiple cloning sites from mammalian expression vectors interfere with gene promoter studies in … - Full text - MIT Libraries
A Beliveau, S Leclerc, M Rouleau, SL Guerin - European Journal of Biochemistry, 1999 - content.febsjournal.org
... revealed that the pBluescript(TM) MCS contains many potential binding sites for
potent, ubiquitous transcriptional activators such as Sp1, NF1, AP1, as well as ...
Cited by 2 - Cached - Web Search - ejbiochem.org - blackwell-synergy.com - ncbi.nlm.nih.gov - all 6 versions »
Novel transcriptional regulation of the human CYP3A7 gene by Sp1 and Sp3 through nuclear factor … - Full text - MIT Libraries
T Saito, Y Takahashi, H Hashimoto, T Kamataki - J. Biol. Chem, 2001 - jbc.org
... 6B). HNF-3 , NF1, USF1, and Sp1/Sp3 as Proteins Binding to the Proximal Promoter
Region of the CYP3A7 Gene-- To identify the factors detected with the 136/ 99 ...
Cited by 24 - Web Search - jbc.org - ncbi.nlm.nih.gov
[CITATION] Site specific DNA methylation in the neurofibromatosis (NF1) promoter interferes with binding of …
D Rodenhiser, DN Mancini, SM Singh, TK Archer - Am J Hum Genet Suppl, 1998
Cited by 1 - Web Search - Get it from MIT Libraries
Transcriptional Regulation of the Rat Poly (ADP-ribose) Polymerase Gene by Sp 1
MJ Bergeron, S Leclerc, MA Laniel, GG Poirier, SL … - European Journal of Biochemistry, 1997 - blackwell-synergy.com
... transcription factors NF1 and Sp1. The position of the well-known Sp1 doublet is
indicated (R1 and R2) as well as that of an additional complex ...
Cited by 10 - Web Search - ejbiochem.org - content.febsjournal.org - ncbi.nlm.nih.gov - all 6 versions » - Get it from MIT Libraries
Genomic Organization and Promoter Analysis of the Gene ifngr2 Encoding the Second Chain of the Mouse …
C EBENSPERGER, S RHEE, G MUTHUKUMARAN, D LEMBO, R … - Scand. J. Immunol. 44, 1996 - ingentaconnect.com
... This region has a high GC content, but no TATA or CAAT box. Potential binding sites
were found for transcription factors Sp1, AP-2, NF1, EGR and NF ...
Cited by 5 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Regulation of the Human MAT 2 B Gene Encoding the Regulatory beta Subunit of Methionine … - Full text - MIT Libraries
L LeGros, AB Halim, ME Chamberlin, A Geller, M … - J Biol Chem, 2001 - jbc.org
... The region from 4 to +93 has several Sp1 and NF1 sites; however, neither the
Sp1 nor the NF1 antibodies caused supershift of the complexes. ...
Cited by 4 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Xenobiotic induction of cytochrome P450 2B1 (CYP2B1) is mediated by the orphan nuclear receptor … - Full text - MIT Libraries
R Muangmoonchai, D Smirlis, SC Wong, M Edwards, IR … - Biochem J, 2001 - biochemj.org
... 3h; NF1, 5h-TCGATTTTGGATTGAAGCCAATATGA- TA3h;CYP2B1(k88\k66),5h-TCGATAGCTAAAGCAGGA-
GGCGTGAAC-3h; CYP2B1 (k48\k26), 5h-TCGATGAGTG- GAGGGGCGGATTCAGCA-3h; Sp1, 5h ...
Cited by 22 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Molecular and cell biology of TGF-ß
AB Roberts - Miner Electrolyte Metab, 1998 - content.karger.com
... Whether transcription factors known to bind to AP1, Sp1, NF1, TCE, or TIE elements
will be found to associate directly with Smad proteins or whether other ...
Cited by 26 - Web Search - content.karger.com
Regulation of the poly (ADP-ribose) polymerase-1 gene expression by the transcription factors Sp1 … - Full text - MIT Libraries
K Zaniolo, A Rufiange, S Leclerc, S Desnoyers, SL … - Biochem J, 2005 - biochemj.org
... When indicated, unlabeled double-stranded oligonucleotides bearing various DNA target
sequences for known transcription factors (Sp1, NF1 and Sp1m) ...
Cited by 1 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
of the Drosophila FTZ-F1 Family - Full text - MIT Libraries
LUC GALARNEAU, JF PARE, D ALLARD, D HAMEL, L … - Molecular AND Cellular Biology, 1996 - mcb.asm.org
... copies (as a synthetic oligonucleotide with EcoRI overhangs) upstream of the
105-bp thymidine kinase (TK) promoter (containing SP1 and NF1 binding sites) or ...
Cited by 96 - Web Search - kb.u-psud.fr - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
GATA-4 and GATA-6 modulate tissue-specific transcription of the human gene for P450c17 by direct … - Full text - MIT Libraries
CE Flueck, WL Miller, PWL Miller - Mol. Endocrinol, 2004 - mend.endojournals.org
... cells. Human placental JEG-3 cells contain Sp1, Sp3 and NF1, but do not express
-227/LUC, even ... Figure 2 Sp1, not NF1-C, activates the –227/LUC construct. ...
Cited by 5 - Web Search - mend.endojournals.org
Uroporphyrinogen III Synthase - Full text - MIT Libraries
GI Aizencang, DF Bishop, D Forrest, KH Astrin, RJ … - J Biol Chem, 2000 - jbc.org
... Analysis of the TATA-less housekeeping promoter upstream of exon 1A revealed binding
sites for ubiquitously expressed transcription factors Sp1, NF1, AP1, Oct1 ...
Cited by 16 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
The promoter of the long variant of collagen XVIII, the precursor of endostatin, contains liver- … - Full text - MIT Libraries
J LIETARD, N THERET, M REHN, O MUSSO, D DARGERE, T … - Hepatology, 2000 - ncbi.nlm.nih.gov
... HNF3alpha. Gel-shift analyses showed that HNF3, NF1/CTF, and Sp1-like sites
specifically recognized nuclear factors. Super-shift ...
Cited by 9 - Web Search - ncbi.nlm.nih.gov
Transcriptional activation of the minimal human pro α 1 (I) collagen promoter: obligatory … - Full text - MIT Libraries
HM POPPLETON, R RAGHOW - Biochem. J, 1997 - biochemj.org
... NF1 and Sp1 have both been shown to bind to two regions of the mouse Proα1(I) collagen
gene between k129 and k110 bp and between k105 and k78 bp; over ...
Cited by 5 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
Down-regulation of Cdc 6, a Cell Cycle Regulatory Gene, in Prostate Cancer - Full text - MIT Libraries
LD Robles, AR Frost, M Davila, AD Hutson, WE … - J Biol Chem, 2002 - jbc.org
... Computer analysis of the promoter sequence revealed a variety of putative transcription
factor binding sites, including E2F, Sp1, NF1, NF , Oct1, and C/EBP (Fig ...
Cited by 8 - Web Search - jbc.org - ncbi.nlm.nih.gov
Activation of a Fibroblast-Specific Enhancer of the Pro 2 (I) Collagen Gene in Tight-Skin Mice - Full text - MIT Libraries
CP Denton, B Zheng, X Shiwen, Z Zhang, G Bou- … - ARTHRITIS & RHEUMATISM, 2001 - doi.wiley.com
... derma remain incompletely understood, although regu- latory elements in the proximal
promoter that interact with the transcription factor Sp1 and NF1 (18), and ...
Cited by 9 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov
The enhancer of human papillomavirus type 16: binding sites for the ubiquitous transcription factors … - Full text - MIT Libraries
T Chong, D Apt, B Gloss, M Isa, HU Bernard - J. Virol, 1991 - pubmedcentral.nih.gov
... Only NF1 showed some qualitative cell type-specific differences. ... type 16 is activated
in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. ...
Cited by 44 - Web Search - pubmedcentral.nih.gov - ncbi.nlm.nih.gov
Genomic organization and differential splicing of the mouse and human Pcyt2 genes
A Poloumienko, A Cote, ATT Quee, L Zhu, M Bakovic - 2004 - ingentaconnect.com
... at a matching distance (-85/-70 bp) from the transcription start site and contain
cis-elements for transcription factors of the CAAT, Sp1 and NF1 family, all ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
Transcriptional regulation of the rat type IIA phospholipase A 2 gene by cAMP and interleukin-1β in … - Full text - MIT Libraries
M RAYMONDJEAN - Biochem. J, 2002 - biochemj.org
... GTTCGCCAACCGGAAGTTAGGATC NF-κB GGGACAGAGGGGACTTTCCGAGAGG NF1 GGATGGCCACGTGCGCCAAGGCG
NFY GGGGTAGGAACCAATGAAATGAAACGTTA Sp1 AGCTTCCGTTGGGGCGGGGCTTCACGTCC YY1 ...
Cited by 5 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 5 versions »
Expression of the alpha 5 Integrin Subunit Gene Promoter Is Positively Regulated by the … - Full text - MIT Libraries
K Larouche, S Leclerc, C Salesse, SL Guerin - J Biol Chem, 2000 - jbc.org
... culture dishes in the presence of either 100- or 500-fold molar excess of various
unlabeled double-stranded oligonucleotide competitors (FRE, Sp1, NF1, and p12 ...
Cited by 13 - Web Search - jbc.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cloning and functional characterization of the human heterogeneous nuclear ribonucleoprotein type I …
MG Romanelli, L Faggioli, P Lorenzi, C Morandi - Biochim Biophys Acta, 2001 - ncbi.nlm.nih.gov
... 5'-rapid amplification of cDNA ends, shows a high 'GC' content, lacks canonical
TATA sequences and contains multiple putative Sp1 and NF1 transcription factor ...
Web Search - Get it from MIT Libraries
Transcript heterogeneity of the human reduced folate carrier results from the use of multiple … - Full text - MIT Libraries
L Zhang, SC Wong, LH Matherly - Biochem. J, 1998 - biochemj.org
... Putative regulatory elements/transcription factor- binding sites (AP2, SP1,
NF1, CREB and EF2 in the sense strand) are underlined. ...
Cited by 15 - View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cyclic AMP inducibility of the myelin basic protein gene promoter requires the NF1 site
RE Clark, WK Miskimins, R Miskimins - International Journal of Developmental Neuroscience, 2002 - ingentaconnect.com
... flanking region. This region contains numerous transcription factor binding
sites, including sites for NF1, Sp1, and MEBA. In order ...
Cited by 3 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Role of zinc-coordination and of the glutathione redox couple in the redox susceptibility of human … - Full text - MIT Libraries
L Knoepfel, C Steinkuhler, MT Carri, G Rotilio - Biochem Biophys Res Commun, 1994 - ncbi.nlm.nih.gov
... these results with the redox behaviour of two other transcription factors, OTF-1
and NF1, which was found to be different in several aspects from that of Sp1. ...
Cited by 17 - Web Search
|
©2005 Google