![]() | The "AND" operator is unnecessary -- we include all search terms by default. [details] |
Scholar | Results 1 - 50 of about 348 for SP1 and SRY. (0.19 seconds) |
Characterization of two Sp1 binding sites of the human sex determining SRY promoter
M Desclozeaux, F Poulat, P de Santa Barbara, S … - Biochimica et Biophysica Acta (BBA)/Gene Structure and …, 1998 - ingentaconnect.com
... Characterization of two Sp1 binding sites of the human sex determining
SRY promoter. Authors: Desclozeaux M.; Poulat F.; de Santa ...
Cited by 13 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Identification of conserved potentially regulatory sequences of the SRY gene from 10 different … - Full text - MIT Libraries
E Margarit, A Guillen, C Rebordosa, J Vidal- … - Biochem Biophys Res Commun, 1998 - ingentaconnect.com
... Ten highly conserved potential regulatory elements have been identified in all 10
species (AP1, Barbie, GATA, Gfi1, cMyb, vMyb, NF1, Oct1, Sp1, and SRY). ...
Cited by 18 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov
… factor-1 contributes to the cyclic-adenosine monophosphate down-regulation of human SRY gene … - Full text - MIT Libraries
P de Santa Barbara, C Mejean, B Moniot, MH Malcles … - Biol Reprod, 2001 - bioone.org
... HeLa B3 RNAs (Fig. 1 ). Involvement of the Proximal NHR1 and Sp1 Sites
in the SRY Gene cAMP Regulation. To determine the genomic ...
Cited by 14 - Web Search - biolreprod.org - physiol.arizona.edu - ncbi.nlm.nih.gov - all 7 versions »
[CITATION] … . An inherited deletion in a Sp1 binding site in the 5’non-coding region of SRY gene is associated … - Full text - MIT Libraries
JG Assumpcao - J Mol Med, 2002
Cited by 1 - Web Search
Characterization of Bovidae sex-determining gene SRY
H Cheng, H Shi, R Zhou, Y Guo, L Liu, J Liu, Y … - Genet. Sel. Evol, 2001 - edpsciences.org
... gene, sequences that are potentially important for transcriptional regulation of
the gene, such as CAAT- box, TATA-box, SRY-binding site and Sp1-binding site ...
Cited by 1 - Web Search - edpsciences.org - ncbi.nlm.nih.gov - Get it from MIT Libraries
Porcine SRY promoter is a target for steroidogenic factor 1 - Full text - MIT Libraries
N Pilon, I Daneau, V Paradis, F Hamel, JG Lussier, … - Biol Reprod, 2003 - biolreprod.org
... This inhibition requires an interaction between SF-1 and SP1 proteins. Two SP1 binding
sites are reported within the human SRY promoter, at -150 and -130 [19]. ...
Cited by 13 - Web Search - bioone.org - biolreprod.org - ncbi.nlm.nih.gov - all 5 versions »
Murine relaxin-like factor promoter: functional characterization and regulation by transcription … - Full text - MIT Libraries
P Koskimies, J Levallet, P Sipila, I Huhtaniemi, M … - Endocrinology, 2002 - endo.endojournals.org
... arrow. The potential regulatory elements, such as the TATA box and putative
binding sites for Sp1 and SRY are underlined. The putative ...
Cited by 10 - Web Search - endo.endojournals.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Turning on the male – SRY, SOX 9 and sex determination in mammals - Full text - MIT Libraries
KC Knower, S Kelly, VR Harley, F Alert - Cytogenetic and Genome Research, 2003 - content.karger.com
... Two such factors that may contribute to SP1 regulation of SRY are Wilms’ tumor 1
(WT1) and NR5A1 (commonly referred to as steroidogenic factor-1; SF-1). ...
Cited by 9 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions »
Interactions between SRY and SOX genes in mammalian sex determination - Full text - MIT Libraries
JAM Graves - Bioessays, 1998 - doi.wiley.com
... no means unique, since other families of transcriptional regulators (eg, Sp1) contain
activators ... genes are quite compatible with a hypothesis that SRY and SOX3 ...
Cited by 44 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Expression of Sry, the mouse sex determining gene - Full text - MIT Libraries
A Hacker, B Capel, P Goodfellow, R Lovell-Badge - Development, 1995 - dev.biologists.org
... Testis determination in mammals occurs in the gonadal anlage due to the action of
the Y-linked gene Sry. ... Expression of Sry, the mouse sex determining gene ...
Cited by 154 - Web Search - dev.biologists.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Cancer-associated alternative usage of multiple promoters of human GalCer sulfotransferase gene - Full text - MIT Libraries
M Tsuda, M Egashira, N Niikawa, Y Wada, K Honke - European Journal of Biochemistry, 2000 - ejbiochem.org
... As for exon 1d, Lmo2, EF1, MyoD, Sp1, SRY, HFH-2, Nkx-2.5 and Ik-2 sites are present.
All the promoter regions lacked canonical TATA or CCAAT boxes. ...
Cited by 6 - Web Search - content.febsjournal.org - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
… and recovery of chondrocyte-specific phenotype in culture involves Sry-type high-mobility-group box … - Full text - MIT Libraries
DG Stokes, G Liu, R Dharmavaram, D Hawkins, S … - Biochem J, 2001 - bj.portlandpress.com
... COL2A1 promoter\enhancer gene construct and that differences in Sry-type high ...
chondrocytes express greater levels of the tran- scription factors Sp1 and nuclear ...
Cited by 20 - View as HTML - Web Search - biochemj.org - dx.doi.org - ncbi.nlm.nih.gov - all 6 versions »
Zinc fingers and other domains cooperate in binding of Drosophila sry beta and delta proteins at … - Full text - MIT Libraries
S Noselli, F Payre, A Vincent - Mol Cell Biol, 1992 - pubmedcentral.nih.gov
... Direct interaction between Sp1 and the BPV enhancer E2 protein mediates synergistic ...
S, Lefrère V, Vincent A. The closely related Drosophila sry beta and sry ...
Cited by 1 - Web Search - mcb.asm.org - ncbi.nlm.nih.gov
Role of Sp1 in insulin regulation of gene expression
SL Samson, NC Wong - J. Mol. Endocrinol, 2002 - journals.endocrinology.org
... Mendelsohn M, Nemes A, Temper V, Razin A & Cedar H. 1994 Sp1 elements protect ... M.
1998 IRE-ABP (insulin response element-A binding protein) an SRY-like protien ...
Cited by 14 - Cached - Web Search - dx.doi.org - jme.endocrinology-journals.org - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
REGULATION TRANSCRIPTIONNELLE DU GENE SRY HUMAIN ET PORCIN PAR LE FACTEUR DE TRANSCRIPTION GATA-4.
F DE MEDECINE - theses.ulaval.ca
... Gfi1, cMyb, vMyb, NF1, Oct1, Sp1 et SRY) sans toutefois de conservation
au niveau de leur position dans le promoteur (57;58). De ...
View as HTML - Web Search
Sry-negative XX sex reversal in purebred dogs
VN Meyers-Wallen, D Schlafer, I Barr, R Lovell- … - Molecular Reproduction and Development, 1999 - doi.wiley.com
... identified as Sry based on similarity to the nucleotide sequences of Sry deposited
in ... that include an HMG box (409–645 bp).Apotential CAAT box, Sp1 site, and ...
Cited by 19 - Web Search - doi.wiley.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
Sp1 and Egr1 regulate transcription of the Dmrt1 gene in Sertoli cells - Full text - MIT Libraries
N Lei, LL Heckert - Biol Reprod, 2002 - biolreprod.org
... The positive elements bind the transcription factors Sp1, Sp3, and Egr1, suggesting
that these ... have, in part, been described and include the genes for Sry, SF-1 ...
Cited by 11 - Web Search - bioone.org - biolreprod.org - ncbi.nlm.nih.gov - all 5 versions »
Activation of the human PAX6 gene through the exon 1 enhancer by transcription factors SEF and Sp1 - Full text - MIT Libraries
JB Zheng, YH Zhou, T Maity, WS Liao, GF Saunders - Nucleic Acids Res, 2001 - nar.oupjournals.org
... an E1E-2 site (CTAATG), an E1E-3 site (CCAGTGAGGAGCGG) and four Sp1 sites (Fig ... 1
(ARP-1), Islet-1 (Isl-1) and Drosophila serendipity-ß (D-Sry-ß), respectively ...
Cited by 4 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 6 versions »
SRY evolution in Cebidae (Platyrrhini, Primates) - Full text - MIT Libraries
MAM Moreira - J Mol Evol, 2002 - springerlink.com
... 1962; Benirschke and Brownhill 1962) explained why SRY ampli®cations occurred in
some blood DNA ... (1997), corresponding to two putative Sp1 transcription factor ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Mutations in SRY and WT1 genes required for gonadal development are not responsible for XY partial … - Full text - MIT Libraries
EB Tagliarini, JG Assumpcao, MR Scolfaro, MP de … - Braz J Med Biol Res, 2005 - scielo.br
... A paternally inherited 3-bp deletion in the SRY 5'UTR Sp1 binding site has been
demonstrated in a 46,XY female with pure gonadal dysgenesis (Assumpção JG ...
Cited by 1 - Cached - Web Search - scielo.br - ncbi.nlm.nih.gov
Expression of the SRY-related HMG box protein SOX2 in human gastric carcinoma - Full text - MIT Libraries
XL Li, Y Eishi, YQ Bai, H Sakai, Y Akiyama, M Tani … - Int J Oncol, 2004 - 147.52.72.117
... PCR, reverse transcription-polymerase chain reaction; RT, room temperature; SOX,
SRY box ... been reported that MUC5AC was also up-regulated by Sp1, an ubiquitous ...
Cited by 3 - View as HTML - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Differential Utilization of the Promoter of Peripheral-Type Benzodiazepine Receptor by Steroidogenic … - Full text - MIT Libraries
G CHRISTOFOROS, V PAPADOPOULOS - Endocrinology, 2004 - endo.endojournals.org
... putative transcription factor-binding sites, including Sp1/Sp3, AP2, Ik2,
AP1, SOX, GATA and SRY. Functional characterization revealed ...
Cited by 3 - Web Search - dx.doi.org - endo.endojournals.org - ncbi.nlm.nih.gov
In vitro Cre/loxP system in cells from developing gonads: Investigation of the Sry promoter - Full text - MIT Libraries
M Ito, K Yokouchi, K Naito, H Endo, Y Hakamata, J … - Development Growth and Differentiation, 2002 - blackwell-synergy.com
... 1998. Characterization of two Sp1 binding sites of the human sex determining
SRY promoter. Biochim. Biophys. Acta 1397, 247 252. ...
Web Search - ncbi.nlm.nih.gov
Mutations in SRY and WT1 genes required for gonadal development are not responsible for XY partial … - Full text - MIT Libraries
JG Assumpcao, MR Scolfaro, MP de Mello, AT Maciel- … - Braz J Med Biol Res, 2005 - scielo.br
... A paternally inherited 3-bp dele- tion in the SRY 5’UTR Sp1 binding site has been
demonstrated in a 46,XY female with pure gonadal dysgenesis (Assumpção JG ...
View as HTML - Web Search - scielo.br
Regulation of human SRY subcellular distribution by its acetylation/deacetylation - Full text - MIT Libraries
L Thevenet, C Mejean, B Moniot, N Bonneaud, N … - The EMBO Journal, 2004 - nature.com
... of the activity of several transcription factors such as Sp1 (Doetzlhofer et ... report,
we have demonstrated that human sex- determining factor SRY interacts with ...
Cited by 3 - Web Search - pubmedcentral.nih.gov - embojournal.npgjournals.com - ncbi.nlm.nih.gov - all 5 versions »
Trans-activation and DNA-binding properties of the transcription factor, Sox-18 - Full text - MIT Libraries
BM Hosking, GEO Muscat, PA Koopman, DH Dowhan, TL … - Nucleic Acids Res, 1995 - pubmedcentral.nih.gov
... J, Evans T, Gangadharan U, Greenfield A, Koopman P. The Sry-related gene ... for physical
interaction between the zinc-finger transcription factors YY1 and Sp1. ...
Cited by 27 - Web Search - nar.oupjournals.org - ncbi.nlm.nih.gov
Transcriptional regulation of the human DNA methyltransferase 3A and 3B genes by Sp3 and Sp1 zinc … - Full text - MIT Libraries
A JINAWATH, S MIYAKE, Y YANAGISAWA, Y AKIYAMA, Y … - Biochem. J, 2005 - biochemj.org
... speculate that the dysregulation of Sp3 and Sp1 contributes to DNMT3A and DNMT3B ...
sites for other transcription factors, including AP1, NF-Y, E2F, Ets, SRY etc. ...
View as HTML - Web Search - biochemj.org - ncbi.nlm.nih.gov
SOX 9 directly regulates the type-ll collagen gene
DM Bell, KKH Leung, SC Wheatley, LJ Ng, S Zhou, K … - Nature Genetics, 1997 - nature.com
... Sex-reversing mutations affect the architecture of SRY-DNA complexes ... Collagen II
promoter and enhancer interact synergistically through Sp1 and distinct nuclear ...
Cited by 184 - Web Search - nature.com - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov - Get it from MIT Libraries
The NKG 2 natural killer cell receptor family: comparative analysis of promoter sequences - Full text - MIT Libraries
C Brostjan, Y Sobanov, J Glienke, S Hayer, H … - Genes and Immunity, 2000 - nature.com
... GATA-1 Pur factor HFH-2 NF-GMa NF-GMa LyF-1 RARE INSAF/IEF-1 RARE RARE NF-E2 ROR
1 NF-GMa Sp1 SRY/TDF RARE Sp1 Oct* TCF-1 Sp-1 TCF-1 RARE TEF-2/AP-3 ...
Cited by 8 - Web Search - nature.com - ncbi.nlm.nih.gov
Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators
M Wilson, P Koopman - Curr Opin Genet Dev, 2002 - imb.uq.edu.au
... interactions between the angiogenic factor SOX18 and the MADS-box factor MEF2C
[24 •• ], the neural crest factor Sox10 and Sp1/3 [25], and SRY and the ...
Cited by 41 - View as HTML - Web Search - imb.uq.edu.au - ncbi.nlm.nih.gov - all 4 versions » - Get it from MIT Libraries
Isolation and characterization of the rat huntingtin promoter - Full text - MIT Libraries
C Holzmann, W Maueler, D Petersohn, T Schmidt, G … - Biochem. J, 1998 - biochemj.org
... in Figure 1. Several of the DNase I-protected sites do overlap with potential
transcription factor-binding sites [CdxA, EFII, SRY, SP1 and Nkx-2.5 (Figure 1 ...
Cited by 10 - Cached - Web Search - biochemj.org - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Computational analysis of composite regulatory elements - Full text - MIT Libraries
P Qiu, W Ding, Y Jiang, JR Greene, L Wang - Mammalian Genome, 2002 - springerlink.com
... Oct-1 TATA 230.5 MEF2 TATA 70.6 AP2 EGR3 33.1 CEBP SRY 224.2 CREL ETS1 67.0
AP1 RORA2 33.1 FREAC3 FREAC7 220.8 PBX1 TATA 66.3 SP1 USF 33.0 ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
Isolation and characterization of the rat huntingtin promoter - Full text - MIT Libraries
O RIESS - Biochem. J, 1998 - biochemj.org
... transcription factor-binding sites [CdxA, EFII, SRY, SP1 and Nkx-2.5 (Figure 1)].
One of the sites predominantly protected is the putative binding site for the ...
View as HTML - Web Search
Hypermethylation of the 5 0 CpG island of the gene encoding the serine protease Testisin promotes … - Full text - MIT Libraries
KJ Manton, ML Douglas, S Netzel-Arnett, DR … - British Journal of Cancer, 2005 - nature.com
... tis 5UTR 5 UTR Exon 1 Exon 1 5′ promoter Pgk2 AP1 Sp1/H1t SRY Sp1/Sp1 CpG site 82
84 103 105 107 109 114 methylated 97.6% 100.0% 92.8% 91.6% 0.0% 19.0% 4.8% ...
Web Search - nature.com - ncbi.nlm.nih.gov
Two types of zinc® fingers are required for dimerization of the Serendipity d transcriptional … - Full text - MIT Libraries
F Payre, P Buono, N Vanzo, A Vincent - Mol Cell Biol, 1997 - mcb.asm.org
... binding does not fit the proposed zinc finger-DNA recognition rules of the Sp1
subfamily and that individual zinc fingers of sry may be differentially involved ...
Cited by 11 - Web Search - pubmedcentral.nih.gov - mcb.asm.org - ncbi.nlm.nih.gov
Mutations and sequence variants in the testis-determining region of the Y chromosome in individuals … - Full text - MIT Libraries
R Veitia, A Ion, S Barbaux, MA Jobling, N … - Human Genetics, 1997 - springerlink.com
... dysplasia and autosomal sex reversal caused by mutations in an SRY-re- lated gene. ...
OA, Kontula K (1994) A single- base substitution in the proximal Sp1 site of ...
Cited by 43 - Web Search - ncbi.nlm.nih.gov - ncbi.nlm.nih.gov
Stage-specific regulatory element of mouseSry gene
K Yokouchi, M Ito, K Nishino, K Yamanouchi, K … - Molecular Reproduction and Development, 2003 - doi.wiley.com
... 1998. Characterization of two Sp1 binding sites of the human sex determining
SRY promoter. Biochem Biophys Acta 1397:247–252. ...
Cited by 1 - Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Contribution of the androgen receptor to prostate cancer predisposition and progression
G Buchanan, RA Irvine, GA Coetzee, WD Tilley - Cancer Metastasis Rev, 2001 - springerlink.com
... (A) Schematic representation of the AR gene structure on chromosome Xq11–12 showing
important binding sites for SRY and SP1 transcription factors. ...
Cited by 21 - Web Search - kluweronline.com - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The porcineSRY promoter is transactivated within a male genital ridge environment - Full text - MIT Libraries
I Daneau, N Pilon, A Boyer, R Behdjani, PA … - genesis, 2002 - doi.wiley.com
... Two functional Sp1 sites were recently demonstrated in the human SRY promoter
(Desclozeaux et al., 1998) using a human ter- atocarcinoma cell line (NT2D1) that ...
Cited by 10 - Web Search - ncbi.nlm.nih.gov
Genes envolvidos na determinacao e diferenciacao do sexo
MP de Mello, JG Assumpcao, C Hackel - Arq Bras Endocrinol Metab, 2005 - scielo.br
... Pelo menos três fatores de transcrição estão aparentemente envolvidos
na trans- ativação do SRY: Sp1, SF-1 e WT1 (24-26). ...
Cited by 4 - View as HTML - Web Search - scielo.br
Full Text View - Full text - MIT Libraries
N Pilon, I Daneau, V Paradis, F Hamel, JG Lussier, … - Biology of Reproduction - bioone.org
... Two SP1 binding sites are reported within the human SRY promoter, at
−150 and −130 [19]. Within the pig SRY promoter sequence ...
Web Search
New Solutions to an Ancient Riddle: Defining the Differences between Adam and Eve - Full text - MIT Libraries
LM Roberts, J Shen, HA Ingraham - The American Journal of Human Genetics, 1999 - journals.uchicago.edu
... F, de Santa Barbara P, Soullier S, Jay P, Berta P, Boizet-Bonhoure B (1998)
Characterization of two Sp1 binding sites of the human sex determining SRY promoter ...
Cited by 18 - Web Search - ncbi.nlm.nih.gov
In search of the function of the peripheral-type benzodiazepine receptor.
V Papadopoulos - ENDOCRINE RESEARCH, 2004 - taylorandfrancis.metapress.com
... absence of TATA or CCAAT boxes but the presence of many putative transcription
factor-binding sites, including Sp1/Sp3, AP2, Ik2, AP1, SOX, GATA, and SRY (24). ...
Web Search - ncbi.nlm.nih.gov - Get it from MIT Libraries
Cloning, organisation, chromosomal localization and expression analysis of the mouse Prkag1 gene
R Shamsadin, K Jantsan, I Adham, W Engel, F Alert - Cytogenetics and Cell Genetics, 2001 - content.karger.com
... bp 5' UTR was found to contain several putative transcription factor binding sites
for HNF-3 , HSF, ADR1, CdxA, SRY, CREB, SP1 and CAT- and TATA-boxes (Fig. ...
Cited by 1 - Web Search - dx.doi.org - karger.com - ncbi.nlm.nih.gov - all 5 versions » - Get it from MIT Libraries
Mammalian sex reversal and intersexuality:
D Vaiman, E Pailhoux - Trends Genet, 2000 - fulcrum.physbio.mssm.edu
... of the sex-determi- nation cascade started in the early 1990s with the long- awaited
discovery of the testis-determining factor (TDF), called SRY (for sex ...
Cited by 2 - View as HTML - Web Search - courses.washington.edu
Identification and characterization of the human XIST gene promoter: implications for models of X … - Full text - MIT Libraries
B Hendrich, RM Plenge, HF Willard - Nucleic Acids Research, 1997 - nar.oupjournals.org
... at room temperature or 4 o C. Antibodies (polyclonal anti-Sp1, no. ... G6 (
TACTCTTCCACTCACTTTTC) and H6 (AGAGAGTGCAACAACCCACA)] and primers for the Sry gene ...
Cited by 23 - Web Search - nar.oupjournals.org - pubmedcentral.nih.gov - ncbi.nlm.nih.gov - all 5 versions »
Functional characterization of the human SOX3 promoter: identification of transcription factors … - Full text - MIT Libraries
N Kovacevic Grujicic, M Mojsin, A Krstic, M … - Gene, 2005 - ncbi.nlm.nih.gov
... SRY-related HMG-box genes (Sox genes) constitute a large family of ... sequence that
bind transcription factors specificity protein 1 (Sp1), upstream stimulatory ...
Web Search
normally responsible for intracellular trafficing of the synthes-ized protein and changes in the …
G Analyzer - ingentaconnect.com
... Whereas in cattle there is a putative Sp1 binding site 3 base- pairs downstream
the TATA ... Exclusion of WT1 as a candidate gene for can- ine SRY -negative XX sex ...
Web Search
The promoter region of the human BUBR1 gene and its expression analysis in lung cancer
M Seike, A Gemma, Y Hosoya, Y Hosomi, T Okano, F … - Lung Cancer, 2002 - ingentaconnect.com
... from exon 1) showed promoter activity and includes multiple transcription factor
consensus binding motifs, including those for Sp1, Nkx-2, CdxA, SRY, MyoD, Ik-2 ...
Cited by 1 - Web Search - ingentaconnect.com - ncbi.nlm.nih.gov - Get it from MIT Libraries
The DNA-binding specificity of SOX 9 and other SOX proteins - Full text - MIT Libraries
S Mertin, SG McDowall, VR Harley - Nucleic Acids Research, 1999 - nar.oupjournals.org
... prime] G following the SCBE, while this Ala is substituted with Ser in SRY and Sox5 ...
SP1 and YY1 are two examples where their in vitro selected DNA-binding sites ...
Cited by 50 - Web Search - pubmedcentral.nih.gov - ingentaconnect.com - ncbi.nlm.nih.gov - all 7 versions »
|
©2005 Google